An escherichia coli mutant strain with phenolic stress tolerance and a construction method and application thereof
Patent Information
- Application Number
- CN202310550179.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-16
- Publication Date
- 2026-08-21
- Estimated Expiration
- 2043-05-16
AI Technical Summary
但目前大肠杆菌对于间苯三酚的耐受水平仍然有限,使得间苯三酚生物合成过程中产量很低,有待通过基因工程、分子生物学等手段进一步提高耐受性
Smart Images

Figure CN116478847B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a mutant strain of Escherichia coli with tolerance to phenolic stress, its construction method, and its application. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Phenolic compounds are a class of compounds formed by the direct combination of hydroxyl groups and aromatic hydrocarbon groups. They are important fine and bulk chemicals with various applications in industrial and consumer sectors. However, phenolic compounds are also among the most widespread pollutants and are highly toxic to organisms. Phloroglucinol and its derivatives are secondary metabolites widely found in biological systems. Phloroglucinol has high application value; it can be used as a drug to treat smooth muscle spasms, as a pesticide for pest and disease control, and also in the production of tire thickeners, rubber, and fuels. Researchers have employed various methods to increase the yield of phloroglucinol biosynthesis, such as altering culture conditions, changing the stability of production plasmids, or modifying the metabolic pathways of the strains themselves, but they have yet to reach a bottleneck. Our research has revealed that the toxicity of phloroglucinol itself to microorganisms is the main reason limiting its yield increase. To solve this problem, it is urgent to understand the bactericidal mechanism of phenolic compounds, comprehensively elucidate the bacterial tolerance mechanism to phenolic substances, and, based on this, create highly phenol-tolerant microbial strains suitable for industrial applications.
[0004] In recent years, researchers have conducted extensive work on the mechanisms of microbial stress tolerance, including stresses such as low temperature, high osmotic pressure, high acidity, high alkaliness, radiation, and organic solvents. The research focuses primarily on Gram-negative bacteria, with model strains (such as *Escherichia coli*) being the main focus. It has been reported that phenolic compounds increase intracellular reactive oxygen species levels, but the specific mechanisms remain unclear. Therefore, a comprehensive analysis of bacterial adaptation mechanisms under phenolic stress is urgently needed.
[0005] Escherichia coli, as a model organism, is widely used in genetic engineering and industrial production due to its advantages such as clear genetic background, rapid growth, simple structure, and mature gene editing tools. However, the tolerance level of E. coli to phloroglucinol is still limited, resulting in very low yields during phloroglucinol biosynthesis. Further improvements in tolerance are needed through genetic engineering and molecular biology techniques. Summary of the Invention
[0006] To address the shortcomings of existing technologies, this invention provides a mutant strain of *Escherichia coli* with phenolic stress tolerance, its construction method, and its applications. This invention constructs the mutant strain using molecular biology techniques and verifies its phenotypic characteristics, discovering that superoxide dismutase SodB, an ATP-dependent molecular chaperone ClpX in the ClpXP protease complex, and the iron export protein FetAB are crucial for tolerance to phloroglucinol. Based on this, a series of overexpression engineered strains are further constructed. This invention lays a solid foundation for elucidating the mechanisms of bacterial tolerance to phenolic compounds and provides new insights for creating strains that efficiently produce phenolic compounds.
[0007] To achieve the above-mentioned technical objectives, the technical solution adopted by the present invention is as follows:
[0008] In a first aspect, the present invention provides a mutant strain of *Escherichia coli* with tolerance to phenolic stress, said mutant strain being obtained by modifying wild-type *Escherichia coli* using any one or more of the following genetic engineering methods (a1)-(a3):
[0009] (a1) Knock out the superoxide dismutase gene sodB;
[0010] (a2) Knock out clpX, an ATP-dependent molecular chaperone gene in the ClpXP protease complex;
[0011] (a3) The nucleotide upstream of the start codon of the mutated iron export protein gene fetAB.
[0012] The wild-type Escherichia coli can be E. coli BL21(DE3).
[0013] The superoxide dismutase gene sodB is derived from Escherichia coli, Genebank ID: 253977814;
[0014] The ATP-dependent molecular chaperone gene clpX is derived from Escherichia coli, Genebank ID: 253976618;
[0015] The iron ion export protein gene fetAB is derived from Escherichia coli, Genebank ID: 253976670 / 253976671; more specifically, in (a3), a mutation C→G is made at 60 bp upstream of the start codon of fetA.
[0016] Furthermore, the mutant strain of *E. coli* with phenolic stress tolerance is wild-type *E. coli* that, based on the above mutations, overexpresses any one or more of the *Pseudomonas fluorescens* polyketide synthase gene *phlD*, the multivariate resistance activator gene *marA*, and the acetyl-CoA carboxylase gene *accADBC*, thereby further increasing the yield of phloroglucinol produced by the mutant strain.
[0017] A second aspect of the present invention provides a method for constructing the above-mentioned mutant strain of *Escherichia coli* with phenolic stress tolerance, the method comprising: modifying wild-type *Escherichia coli* using any one or more of the following genetic engineering methods (a1)-(a3):
[0018] (a1) Knock out the superoxide dismutase gene sodB;
[0019] (a2) Knock out clpX, an ATP-dependent molecular chaperone gene in the ClpXP protease complex;
[0020] (a3) The nucleotide upstream of the start codon of the mutated iron export protein gene fetAB.
[0021] The wild-type Escherichia coli can be E. coli BL21(DE3).
[0022] The superoxide dismutase gene sodB is derived from Escherichia coli, Genebank ID: 253977814;
[0023] The ATP-dependent molecular chaperone gene clpX is derived from Escherichia coli, Genebank ID: 253976618;
[0024] The iron ion export protein gene fetAB is derived from Escherichia coli, Genebank ID: 253976670 / 253976671; more specifically, in (a3), a mutation C→G is made at 60 bp upstream of the start codon of fetA.
[0025] Furthermore, the construction method also includes preparing competent cells using the above-mentioned mutated strain as a host, and introducing the expression plasmid pACYC-accADBC-marA-phlD into the competent cells to obtain recombinant cells.
[0026] A third aspect of the present invention provides the use of the above-described Escherichia coli mutant strain in any one or more of the following:
[0027] (c1) Research on ferroptosis induced by phenolic compounds and related mechanisms;
[0028] (c2) Fermentation to produce phloroglucinol.
[0029] The beneficial technical effects of one or more of the above technical solutions are as follows:
[0030] 1. The above technical solution provides a method for constructing a mutant strain of Escherichia coli with tolerance to phenolic stress. This method is the first to achieve an increase in the yield of phloroglucinol by responding to phenol-induced ferroptosis.
[0031] 2. The above technical solution provides a mutant strain of Escherichia coli with tolerance to phenolic stress. It is based on E. coli BL21(DE3) as the starting strain. The sodB and clpX on the genome are knocked out by homologous recombination technology, and a mutation (C→G) is made at 60 bp upstream of the fetA start codon in the fetAB gene to obtain a mutant strain of E. coli with tolerance to phloroglucinol.
[0032] 3. The above technical solution provides an engineered Escherichia coli strain with phenolic stress tolerance, which is obtained by overexpressing pACYC-accADBC-marA-phlD in a mutant strain of Escherichia coli with phenolic stress tolerance, thereby obtaining an engineered Escherichia coli strain that can produce high levels of phloroglucinol.
[0033] 4. The above technical solution provides a mutant strain of Escherichia coli with tolerance to phenolic stress. Its tolerance to phloroglucinol in iron-containing culture medium is 485 times higher than that of the control strain, which lays a good foundation for subsequent research on tolerance mechanism and molecular modification of strain.
[0034] 5. The above-mentioned technical solution provides an engineered Escherichia coli strain with phenolic stress tolerance, which increases the yield of phloroglucinol in iron-containing medium by 172% compared with the control strain, providing a new idea for the creation of high-efficiency phloroglucinol production strains in the future.
[0035] 6. The above technical solution provides a bactericidal mechanism of phenolic compounds. Phenolic compounds form complexes with iron ions, which promote the Fenton reaction, thereby causing excessive accumulation of hydroxyl radicals in cells and inducing bacterial iron death.
[0036] 7. The mechanism for dealing with phenolic compound-induced ferroptosis provided by the above technical solution shows that bacteria under iron-free conditions have significantly higher tolerance to phloroglucinol, phenol, catechol, phloroglucinol, and β-naphthol than under iron-containing conditions. Attached Figure Description
[0037] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0038] Figure 1 To compare the tolerance of wild-type and mutant strains to PG.
[0039] Figure 2 To compare the tolerance of overexpressing strains to PG.
[0040] Figure 3 To compare the tolerance of mutant strains to 5 g / L PG.
[0041] Figure 4 The results show the intracellular iron ion concentration measurements of the pfetAB strain and the control strain.
[0042] Figure 5 Survival of wild E. coli BL21(DE3) under different conditions.
[0043] Figure 6 The effect of iron ion chelator DFO on PG tolerance in wild-type E. coli BL21(DE3).
[0044] Figure 7 The effect of different conditions on PG tolerance of ΔsodB mutant bacteria.
[0045] Figure 8 This describes the properties of ferrous iron solutions in the presence and absence of PG.
[0046] Figure 9 The results of intracellular HO· concentration determination in wild-type E. coli BL21(DE3) cells under different conditions.
[0047] Figure 10 The effect of different concentrations of DMSO on bacterial tolerance to PG.
[0048] Figure 11 The expression levels of RpoS protein in wild-type and mutant strains are shown.
[0049] Figure 12 The results are the transcriptional level analysis results of RpoS-dependent oxidative stress-related genes.
[0050] Figure 13 Results of shake-flask fermentation for the production of PG using wild-type and engineered strains.
[0051] Figure 14 This study compares the tolerance of wild-type strains to various phenolic substances under iron-containing and iron-free conditions. Detailed Implementation
[0052] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0053] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. It should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for the purpose of describing specific embodiments and not for limiting the scope of protection of the present invention.
[0054] Definitions and abbreviations
[0055] Phloroglucinol: PG
[0056] Isopropyl galactothioglycoside: IPTG
[0057] Superoxide dismutase gene: sodB
[0058] ClpX is an ATP-dependent molecular chaperone gene in the ClpXP protease complex: clpX
[0059] Iron ion export protein gene: fetAB
[0060] Protein gene containing the PHB domain: qmcA
[0061] RNA polymerase Sigma factor: RpoS
[0062] Polyketide synthase gene: phlD
[0063] Multiple resistance activator gene: marA
[0064] Acetyl-CoA carboxylase gene: accADBC
[0065] Escherichia coli: E. coli
[0066] Hydrogen peroxide: H2O2
[0067] Hydroxyl radical: HO·
[0068] "Gene knockout" refers to the deletion of a specific gene, either entirely or partially, from the genome through certain methods, thereby causing the specific gene to lose its function.
[0069] "Overexpression" or "overexpression" refers to the expression of a specific gene in a cell exceeding its original level after being regulated by various signals. This can be achieved by enhancing endogenous expression or introducing exogenous genes.
[0070] All publications, patents, and published patent specifications cited in this invention are incorporated herein by reference in their entirety.
[0071] As mentioned earlier, Escherichia coli currently has limited tolerance to phloroglucinol, resulting in very low yields during phloroglucinol biosynthesis.
[0072] In view of this, in a typical specific embodiment of the present invention, a mutant strain of *E. coli* with tolerance to phenolic stress is provided, wherein the mutant strain of *E. coli* is obtained by modifying wild-type *E. coli* using any one or more of the following genetic engineering methods (a1)-(a3):
[0073] (a1) Knock out the superoxide dismutase gene sodB;
[0074] (a2) Knock out clpX, an ATP-dependent molecular chaperone gene in the ClpXP protease complex;
[0075] (a3) The nucleotide upstream of the start codon of the mutated iron export protein gene fetAB.
[0076] The wild-type Escherichia coli can be E. coli BL21(DE3).
[0077] The superoxide dismutase gene sodB is derived from Escherichia coli, Genebank ID: 253977814;
[0078] The ATP-dependent molecular chaperone gene clpX is derived from Escherichia coli, Genebank ID: 253976618;
[0079] The iron ion export protein gene fetAB is derived from Escherichia coli, Genebank ID: 253976670 / 253976671; more specifically, in (a3), a mutation C→G is made at 60 bp upstream of the start codon of fetA.
[0080] The Escherichia coli mutant strains obtained by the above-mentioned genetic engineering methods have significantly improved their tolerance to phenolic compounds such as phloroglucinol. Furthermore, by overexpressing phloroglucinol-related genes (such as any one or more of the following: Pseudomonas fluorescens polyketide synthase gene phlD, multiple resistance activator gene marA, and acetyl-CoA carboxylase gene accADBC) in the above-mentioned Escherichia coli mutant strains with phenolic stress tolerance, the yield of phloroglucinol produced by the mutant strains can be further increased.
[0081] Therefore, in another specific embodiment of the present invention, the Escherichia coli mutant strain with phenolic stress tolerance is a wild-type Escherichia coli that, based on the above-mentioned mutation, overexpresses any one or more of the following genes: phlD (fluorescein Pseudomonas polyketide synthase gene), marA (multiple resistance activator gene), and accADBC (acetyl-CoA carboxylase gene), thereby further increasing the yield of phloroglucinol produced by the mutant strain.
[0082] The *Pseudomonas fluorescens* polyketide synthase gene *phlD* has a Genebank ID of 11830552; the multivariate resistance activator gene *marA* is derived from *Escherichia coli* and has a Genebank ID of 6060688; the acetyl-CoA carboxylase gene *accADBC* is derived from *Escherichia coli*, with subunit *accA* having a Genebank ID of 6062185, subunit *accB* having a Genebank ID of 6058890, subunit *accC* having a Genebank ID of 6058863, and subunit *accD* having a Genebank ID of 6059083.
[0083] In another specific embodiment of the present invention, a method for constructing the above-mentioned Escherichia coli mutant strain with phenolic stress tolerance is provided, the method comprising: modifying wild-type Escherichia coli using any one or more of the following genetic engineering methods (a1)-(a3):
[0084] (a1) Knock out the superoxide dismutase gene sodB;
[0085] (a2) Knock out clpX, an ATP-dependent molecular chaperone gene in the ClpXP protease complex;
[0086] (a3) The nucleotide upstream of the start codon of the mutated iron export protein gene fetAB.
[0087] The wild-type Escherichia coli can be E. coli BL21(DE3).
[0088] The superoxide dismutase gene sodB is derived from Escherichia coli, Genebank ID: 253977814;
[0089] The ATP-dependent molecular chaperone gene clpX is derived from Escherichia coli, Genebank ID: 253976618;
[0090] The iron ion export protein gene fetAB is derived from Escherichia coli, Genebank ID: 253976670 / 253976671; more specifically, in (a3), a mutation C→G is made at 60 bp upstream of the start codon of fetA.
[0091] In another specific embodiment of the present invention, the construction method includes:
[0092] (b1) Using the genome of *Escherichia coli* BL21(DE3) as a template, the left and right homologous arms of the superoxide dismutase gene sodB, an ATP-dependent molecular chaperone gene clpX from the ClpXP protease complex, and the iron export protein gene fetAB were amplified by PCR. Using the pTarget plasmid as a template, the sgRNAs of the superoxide dismutase gene sodB, an ATP-dependent molecular chaperone gene clpX from the ClpXP protease complex, and the iron export protein gene fetAB were amplified by PCR. Using the pTarget plasmid as a template, the vector backbone was amplified by PCR. Using the pKSI-1 plasmid as a template, the vector backbone was amplified by PCR. Using the pMIDAI plasmid as a template, the apramycin resistance gene expression module (ApmR) was amplified by PCR. Using the genome of the evolved Q3331 strain as a template, the mutated fragment of the iron export protein gene fetAB was amplified by PCR.
[0093] (b2) The left and right homologous arms, sgRNA, and pTarget vector backbone of the above-mentioned genes sodB and clpX were recombined using genetic engineering techniques; the left and right homologous arms, sgRNA, apramycin resistance gene expression module, and pTarget vector backbone of the above-mentioned gene fetAB were recombined using genetic engineering techniques; the above-mentioned gene fetAB mutant fragment and pKSI-1 vector backbone were recombined using genetic engineering techniques; and the above-mentioned genes were chemically transformed into Escherichia coli DH5α for replication.
[0094] (b3) Extract recombinant plasmids, use a gene editing system to modify any one or more of the above genes in the genome of Escherichia coli BL21(DE3) and eliminate the plasmids to obtain mutant strains.
[0095] Furthermore, the construction method also includes preparing competent cells using the above-mentioned mutated strain as a host, and introducing the expression plasmid pACYC-accADBC-marA-phlD into the competent cells to obtain recombinant cells.
[0096] The expression plasmid pACYC-accADBC-marA-phlD can be found in Zhang R, Cao Y, Liu W, et al. Improving phloroglucinol tolerance and production in Escherichia coli by GroESL overexpression. Microbial Cell Factories, 2017, 16(1):1-10 or CN106929527A. Further details are omitted here.
[0097] In another specific embodiment of the present invention, the above-mentioned Escherichia coli mutant strain is provided for use in any one or more of the following:
[0098] (c1) Research on ferroptosis induced by phenolic compounds and related mechanisms;
[0099] (c2) Fermentation to produce phloroglucinol.
[0100] In application (c1), the phenolic compounds include, but are not limited to, phloroglucinol, phenol, catechol, resorcinol, phloroglucinol and β-naphthol.
[0101] This invention has discovered the bactericidal mechanism of phenolic compounds through research. Specifically, phenolic compounds form complexes with iron ions, promoting the Fenton reaction and thus causing an excessive accumulation of hydroxyl radicals in cells, inducing bacterial iron death. Therefore, bacteria exhibit significantly higher tolerance to phloroglucinol, phenol, catechol, and β-naphthol under iron-free conditions compared to iron-containing conditions. The series of mutant strains constructed in this application show better stress tolerance and biotransformation ability in high-concentration phenolic substances and iron ion systems. For example, they can grow normally in the presence of 0.3 g / L ferric ammonium citrate and 5 g / L phloroglucinol. In terms of phloroglucinol production, 2.53 ± 0.05 g / L phloroglucinol can be produced in iron-containing fermentation medium.
[0102] To better illustrate the purpose, technical solution, and advantages of this invention, the following detailed description is provided in conjunction with specific embodiments. Unless otherwise specified, all materials and reagents used in the following embodiments are commercially available. Restriction endonucleases were purchased from New England Biolabs; kits used for plasmid extraction, PCR product recovery, and gel extraction were purchased from OMEGA, USA, and the procedures were performed according to the product instructions; all culture media were prepared with deionized water unless otherwise specified; the RT-PCR kit was purchased from Beijing Adley Technology Co., Ltd.; and the Iron Colorimetric Assay Kit was purchased from Applyge.
[0103] Culture medium formulation:
[0104] 1) Seed culture medium
[0105] LB medium: yeast extract 5 g / L, NaCl 10 g / L, peptone 10 g / L.
[0106] 2) Fermentation medium with iron
[0107] K2HPO4·3H2O 9.8g / L, Citric acid·H2O 2.1g / L, Ferric ammonium citrate 0.3g / L, (NH4)2SO4 3.0g / L, Glucose 20g / L, MgSO4·7H2O 0.4g / L, 1000× Trace elements ((NH4)6Mo7O 24 ·4H2O 3.7g / L; ZnSO4·7H2O 2.9g / L; H3BO3 24.7g / L; CuSO4·5H2O 2.5g / L; MnCl2·4H2O 15.8g / L).
[0108] 3) Iron-free fermentation medium
[0109] K2HPO4·3H2O 9.8g / L, Citric acid·H2O 2.1g / L, (NH4)2SO4 3.0g / L, Glucose 20g / L, MgSO4·7H2O 0.4g / L, 1000× Trace elements ((NH4)6Mo7O 24 ·4H2O 3.7g / L; ZnSO4·7H2O 2.9g / L; H3BO3 24.7g / L; CuSO4·5H2O 2.5g / L; MnCl2·4H2O 15.8g / L).
[0110] Note: K₂HPO₄·3H₂O 9.8 g / L, Citric acid·H₂O 2.1 g / L, (ferric ammonium citrate 0.3 g / L), and (NH₄)₂SO₄ 3.0 g / L were mixed and adjusted to pH 7.0, then autoclaved at 121℃ for 20 min. Glucose stock solution was 500 g / L, sterilized separately at 115℃ for 20 min; MgSO₄·7H₂O stock solution was 200 g / L, sterilized separately at 121℃ for 20 min; and 1000× trace element solution was sterilized by filtration through a 0.22 μm filter membrane. During inoculum transfer, the separately sterilized glucose, MgSO₄·7H₂O, 1000× trace element stock solution, and antibiotics were added separately.
[0111] Example 1: Construction of Escherichia coli mutant strain
[0112] Using E. coli BL21(DE3) as the starting strain, the sodB and clpX genes were knocked out, and a mutation (C→G) was made 60 bp upstream of the fetA start codon in the fetAB gene to obtain a mutant strain that is highly tolerant to PG. The PG-producing plasmid pACYC-accADBC-marA-phlD was introduced into the mutant strain and the control strain E. coli BL21(DE3) for PG fermentation detection at the shake flask and fermenter levels.
[0113] Those skilled in the art should understand that the gene editing experiments of E. coli BL21(DE3) described above were performed in accordance with standard molecular cloning techniques.
[0114] 1. The following is an example of constructing the pTarget-ΔclpX plasmid that knocks out the clpX gene in E. coli BL21(DE3):
[0115] (1) Plasmid backbone amplification. Using pTaregtF plasmid as template, Prime STAR was used to amplify the plasmid with Prime STAR primers TargetVF (5'gtcgacctgcagaagcttag 3') and TargetVR (5'actagtattatacctaggactgagc 3'), followed by overnight digestion with DpnI and purification.
[0116] (2) sgRNA-editing amplification. Using pTargetF plasmid as a template, and H-BclpX-gF (5'cctaggtataatactagt taccagcaatggcgtcgagtgttttagagctagaaatagca 3') and gRNAR2 (5'tctagagaattcaaaaaaagcac 3') as primers, PrimeSTAR was used for amplification and purification.
[0117] (3) Amplification of left and right homologous arms. Using the E. coli BL21(DE3) genome as a template, Pre_BclpXF(5'
[0118] Using primers cataacacagggactagctgataatccgtc 3') and Aft_BclpXR (5'gagaagctgattatatcgtccgggttcac 3') as primers, the amplification and purification were performed using PrimeSTAR. This product was then used as a template for H-BclpXHLF...
[0119] Using primers (5'ctttttttgaattctctaga gatatctattctcgtctacttaag 3') and BclpXHLR (5'catgggtcaaaacctcttc 3'), H-BclpXHRF (5'aagaggttttgacccatggcggccgctaattaaccattcccatacaattag 3') and H-BclpXHRR (5'aagcttctgcaggtcgacctgtaatgataggcaattcag 3'), the fragments were amplified and purified using PrimeSTAR to obtain the left and right homologous arm fragments, respectively.
[0120] (4) Multi-fragment in vitro recombination. Following the instructions of the multi-fragment in vitro recombination kit, the above four fragments were recombined. The reaction products were transformed into E. coli DH5Aα and cultured on spectinomycin plates. Using colonies as templates, and with pTargetF (5'gtatttcacaccgcatatgc 3') and pTargetR (5'gtcggtggtgataaacttatc 3') as primers, colony PCR was performed using RapidTaq Mix for verification. Positive colonies were sequenced using primers pTargetF and pTargetR to confirm correct preservation, thus obtaining the plasmid pTarget-ΔclpX for clpX gene knockout.
[0121] Following a similar method, the plasmid pTarget-ΔsodB for sodB gene knockout was constructed. The primer sequence for amplifying sgRNA-editing was (5'cctaggtataatactagtgagattattcgcagctctgagttttagagctagaaatagca 3'), and the template used for amplifying the left and right homologous arms was the E. coli BL21(DE3) genome. The primer used for amplifying the left homologous arm was (5'...
[0122] The primers used for amplification of the right homologous arm are (5'taaaggagagtagcaatggcggccgctaataactgatggcaaatgcagcattg 3') and (5'aagcttctgcaggtcgacgatacagctttgtgccggtg 3').
[0123] 2. Construct the pTarget-ΔfetA::ApmR plasmid with the fetAB gene mutation in E.coli BL21(DE3), as follows: (1) Plasmid backbone amplification. Using pTaregtF plasmid as template, Prime STAR was used to amplify the plasmid with Prime STAR primers TargetVF (5'gtcgacctgcagaagcttag3') and TargetVR (5'actagtattatacctaggactgagc 3'), followed by overnight digestion with DpnI and purification.
[0124] (2) sgRNA-editing amplification. Using pTargetF plasmid as a template, H-BP_fetA-gF(5') was used for amplification.
[0125] cctaggtataatactagtgttcccccttattcctgcgagttttagagctagaaatagca 3') and gRNAR2 (5'
[0126] Using tctagagaattcaaaaaaagcac 3' as primers, the amplification and purification were performed using PrimeSTAR.
[0127] (3) Amplification of left and right homologous arms. Using the E. coli BL21(DE3) genome as a template, Pre-BP_fetAF(5'
[0128] Using primers tcagcctgtaaaaacgccgactg 3') and Aft-BP_fetAR (5'agcattaatgccagtgctaatgattcgttag 3') as primers, the amplification and purification were performed using PrimeSTAR. Using this product as a template, H-BP_fetAHLF (5') was used for amplification and purification.
[0129] ctttttttgaattctcttagagttcattgaagagataagctct 3') and H-BP_fetAHLR(5'
[0130] tagggataacagggtaattctctttcagtaatcaggtataatttg 3'), H-BP_fetAHRF(5'
[0131] attaccctgttatccctagcggccgcataaactgtttttagtaaaaatcagaaaaag 3') and H-BP_fetAHRR(5'
[0132] Using aagcttctgcaggtcgacacataacgatggatcatctc 3' as primers, the fragments were amplified and purified using PrimeSTAR to obtain the left and right homologous arm fragments, respectively.
[0133] (4) Using pMDIAI plasmid as a template, the apramycin resistance gene expression module was amplified using primers Pre_IS-GF (5'agctatgaccatgattacgaac 3') and Aft_IS-GR (5'cagtgccaaagaagcatgac 3').
[0134] (5) Multi-fragment in vitro recombination. Following the instructions of the multi-fragment in vitro recombination kit, the above five fragments were recombined. The reaction product was transformed into E. coli DH5α and plated on spectinomycin agar plates. Using the colonies as templates, pTargetF(5')
[0135] Using primers gtatttcacaccgcatatgc 3') and pTargetR (5'gtcggtggtgataaacttatc 3'), colony PCR was performed using Rapid Taq Mix for verification. Positive colonies were sequenced using primers pTargetF and pTargetR to confirm proper preservation, thus obtaining the pTarget-ΔfetA::ApmR plasmid for fetAB gene mutation.
[0136] 3. Construction of the pKSIMBfetA plasmid containing a mutation in the fetAB gene of E. coli BL21(DE3), as described below:
[0137] (1) Using the genome of the laboratory-preserved E. coli BL21(DE3) evolutionary strain Q3331 (see also: Zhao Zhiqiang. Systematic optimization of phloroglucinol synthesizing strains. University of Chinese Academy of Sciences, 2021) as a template, Pre-BP_fetAF(5'
[0138] Using primers tcagcctgtaaaaacgccgactg 3') and Aft-BP_fetAR (5'agcattaatgccagtgctaatgattcgttag 3') as primers, the amplification and purification were performed using PrimeSTAR. Using this product as a template, M-PfetAF (5') was used for amplification and purification.
[0139] catgagctcgttcattgaagagataagctctgccg 3') and M-PfetAR(5'
[0140] Using cagaagcttacataacgatggatcatctcattgacg 3' as primers, the amplification and purification were performed using PrimeSTAR.
[0141] (2) The amplification product from step (1) and the pKSI-1 plasmid were digested with SacI and HindIII. After the digestion products were recovered, the vector and gene were mixed in a molar ratio of 1:4, and ligase was added and ligated at 16°C for 6-12 hours. The ligation products were heat-shocked at 42°C to transform E. coli DH5α competent cells, plated on ampicillin-resistant plates, and positive clones were screened by PCR. After the positive clones were cultured, the plasmid was extracted and sequenced to confirm that it was stored correctly, thus obtaining the pKSIMBfetA plasmid for fetAB gene mutation.
[0142] 4. The edited plasmids pTarget-ΔclpX, pTarget-ΔsodB, and pTarget-ΔfetA::ApmR were chemically transformed into BL21(DE3) strains containing pCas and plated on kanamycin and spectinomycin plates, respectively, and cultured at 30°C. Positive clones were screened by PCR. Subsequently, bacteria were picked and cultured in liquid LB medium containing kanamycin at 30°C. IPTG was added to induce the elimination of pTarget type plasmids. Then, the bacteria were transferred to antibiotic-free liquid LB medium and cultured at 37°C to eliminate pCas plasmids, finally obtaining strains with clpX, sodB, and ΔfetA knocked out, respectively. The fetAB gene mutation was completed through a second recombination: the pREDTKI and pKSIMBfetA plasmids were chemically transformed into ΔfetA strains and plated on kanamycin, ampicillin, and glucose plates, and cultured at 30°C. The bacteria were then picked and cultured in LB medium containing kanamycin and L-arabinose at 30°C for 2-3 hours, followed by IPTG induction and a further 10-15 hours of culture. The culture was then plated onto plates containing kanamycin, L-arabinose, and glucose and cultured at 30°C. Positive clones were screened by PCR, and the bacteria were then picked and cultured in antibiotic-free liquid LB medium at 37°C to eliminate the plasmid, ultimately yielding a strain with a point mutation in the fetAB gene.
[0143] 5. Through step 4, multiple rounds of gene editing can be performed to obtain a strain ΔclpX / ΔsodB / qmcA-fetAB (SNP) with the clpX and sodB genes knocked out as well as the qmcA-fetAB gene point mutations.
[0144] 6. Construct overexpression plasmids pfetAB and pqmcA for fetAB and qmcA, and control strain Vector.
[0145] (1) Plasmid backbone amplification. Using pTrcHis2B plasmid as template, and pTrc-F (5'ggtaccatatgggaattcgaag 3') and pTrc-R (5'agatctcgagctcggatccatg 3') as primers, the plasmid was amplified with PrimeSTAR, digested with DpnI overnight, and then purified.
[0146] (2) Using the E. coli BL21(DE3) genome as a template, fetABF(5'
[0147] gatccgagctcgagatctatgcaggaaaatagtcctttgcttc 3') and fetABR (5'
[0148] The fetAB gene fragment was obtained by amplification and purification using PrimeSTAR with the fragment qmcAF(5'aattcccatatggtaccatggcttcttcaattgcgtcacc 3') and qmcAR(5').
[0149] The qmcA gene fragment was obtained by amplifying and purifying the aattcccatatggtaccatggctgagtccgcttgttg 3' using PrimeSTAR.
[0150] (3) Multi-fragment in vitro recombination. Following the instructions of the in vitro multi-fragment recombination kit, the pTrcHis2B vector backbone was recombinated with the fetAB gene fragment and the qmcA gene fragment, respectively. The reaction products were transformed into DH5α and cultured on ampicillin plates. Using colonies as templates, pTrcyanF(5'tcgaccggaattatcgattaac 3') and pTrcyanR(5') were used for recombination.
[0151] Using primers tcaatgatgatgatgatgatggtc 3'), colony PCR was performed using Rapid Taq Mix for verification. Positive colonies were sequenced using primers pTrcyanF and pTrcyanR to confirm proper preservation, thus obtaining the pTrc-fetAB plasmid for fetAB gene overexpression and the pTrc-qmcA plasmid for qmcA overexpression.
[0152] 7. Plasmids pTrcHis2B, pTrc-fetAB, and pTrc-qmcA were transformed into BL21(DE3) strain by chemical transformation and plated on ampicillin plates and cultured at 37°C. Positive clones were screened by PCR to obtain the negative control strain Vector, as well as strains pfetAB and pqmcA that overexpress fetAB and qmcA, respectively.
[0153] 8. The production plasmid pACYC-accADBC-marA-phlD was transformed into E. coli BL21(DE3) strain and ΔclpX / ΔsodB / qmcA-fetAB(SNP) mutant strain respectively by chemical transformation to obtain phloroglucinol producing strains Q3595 and Q4333.
[0154] Example 2: Comparison of PG tolerance between E. coli mutant strains and wild-type strains
[0155] ΔclpX, ΔsodB, qmcA-fetAB (SNP), and wild-type E. coli BL21 (DE3) strains were inoculated into 4 mL LB medium and cultured overnight at 37°C and 180 rpm. Subsequently, 20% of each strain was inoculated into 100 mL of iron-containing fermentation medium and cultured at 37°C until OD200. 600 =2.5, take the bacterial suspension and serially dilute it 10-fold to the required concentration, then add 1.3 g / L PG and continue incubation for 4 hours. Take the bacterial suspension and serially dilute it 10-fold to the required concentration, then spot it onto a TLC plate. Incubate statically at 37℃, and count the viable cells after colonies appear to calculate the survival rate. Figure 1 It was found that after 4 hours of treatment with iron ions and PG, the survival rates of the three engineered strains were significantly higher than those of the control strain E. coli BL21(DE3). This indicates that knockout of the clpX and sodB genes and point mutation of the qmcA-fetAB gene improved the tolerance of E. coli to PG, suggesting that superoxide dismutase, an ATP-dependent molecular chaperone in the ClpXP protease complex, and an iron ion export protein have a significant effect on improving the PG tolerance of E. coli.
[0156] Since the qmcA-fetAB (SNP) mutation site is located in the shared promoter region of qmcA and fetAB, we further investigated the effect of this site on the two genes. Vector strain, pqmcA strain, and pfetAB strain were inoculated into 4 mL LB medium and cultured overnight at 37°C. Subsequently, 20% of each strain was inoculated into 100 mL of iron-containing fermentation medium and cultured at 37°C and 180 rpm until OD reached. 600 =0.6, add 0.5mM IPTG, incubate at 37℃ until OD 600=2.5, take the bacterial suspension and serially dilute it 10-fold to the required concentration, then add 1.3 g / L PG and continue incubation for 4 hours. Take the bacterial suspension and serially dilute it 10-fold to the required concentration, then spot it onto a TLC plate. Incubate statically at 37℃, and count the viable cells after colonies appear to calculate the survival rate. Figure 2 It can be seen that after 4 hours of treatment with iron ions and PG, the survival rate of the pfetAB strain was significantly higher than that of the control strains Vector and pqmcA. Furthermore, the survival rates of the pqmcA and Vector strains were almost the same, indicating that overexpression of fetAB can improve the bacterial tolerance to PG, while overexpression of qmcA has no effect on tolerance. This suggests that the mutation at the qmcA-fetAB (SNP) site actually increases the expression of the fetAB gene.
[0157] Subsequently, the ΔclpX, ΔsodB, qmcA-fetAB (SNP) and ΔclpX / ΔsodB / qmcA-fetAB (SNP) triple mutant strains were inoculated into 4 mL LB medium and cultured overnight at 37°C and 180 rpm. Then, 20% of each strain was inoculated into 100 mL of iron-containing fermentation medium and cultured at 37°C until OD500. 600 =2.5, take the bacterial suspension and serially dilute it 10-fold to the required concentration, then add 5 g / L PG and continue culturing for 4 hours. Take the bacterial suspension and serially dilute it 10-fold to the required concentration, then spot it onto a TLC plate. Incubate statically at 37℃, and count the viable cells after colonies appear to calculate the survival rate. Figure 3 It was found that after treatment with 5 g / L PG for 4 hours, the ΔclpX, qmcA-fetAB (SNP), and ΔclpX / ΔsodB / qmcA-fetAB (SNP) triple mutant strains all grew normally. Although the growth of the ΔsodB strain was inhibited, some strains still survived, indicating that the triple mutant strains can tolerate high concentrations of PG.
[0158] Example 3: Determination of iron ions in Escherichia coli and the effect of iron ions on PG tolerance
[0159] Vector and pfetAB strains were inoculated into 4 mL LB medium and cultured overnight at 37°C and 180 rpm, respectively. Subsequently, 20% of each strain was inoculated into 100 mL of iron-containing fermentation medium and cultured at 37°C and 180 rpm until OD reached [value missing]. 600 =0.6, add 0.5mM IPTG, incubate at 30℃ and 180rpm for 0.5h, take appropriate amounts of bacterial suspension, continue incubating until the mid-to-late logarithmic phase, add 1.3g / LPG, incubate for 0.5h, and take appropriate amounts of bacterial suspension again. Analyze using the Iron Colorimetric Assay Kit. Figure 4It can be seen that the iron ion concentration in the cells of the pfetAB strain was significantly lower than that of the Vector strain, indicating that overexpression of fetAB improves the bacterial tolerance to PG by reducing the concentration of iron ions in the cells, thereby reducing the toxic effect of PG on the bacteria.
[0160] The effect of iron ions on PG tolerance in *E. coli* was then investigated. Wild-type *E. coli* BL21(DE3) strain was inoculated at 20% in 100 mL of iron-containing and iron-free fermentation media, respectively, and cultured at 37°C and 180 rpm until OD200 was reached. 600 =2.5, the bacterial culture was serially diluted 10-fold to the required concentration, and cultured for 4 hours with or without 1.3 g / L PG. The culture was then serially diluted 10-fold to the required concentration and spotted onto a TLC plate. The plates were incubated statically at 37°C. After colonies appeared, the viable cell count was determined, and the survival rate was calculated. To further demonstrate the effect of iron ions, an iron chelating agent, DFO, was added to an additional iron-containing medium 1 hour before the addition of PG, and the survival rate was calculated by TLC. Figure 5 It can be seen that under PG conditions for 4 hours, the survival rate of wild-type BL21(DE3) in iron-free medium was significantly higher than that in iron-containing medium. Figure 6 It can be seen that the survival rate of the strains in the culture medium with added DFO was significantly higher than that in the culture medium without added DFO, indicating that iron ions are a necessary substance for PG to produce toxicity to Escherichia coli.
[0161] To investigate the effect of H2O2 on the PG tolerance of Escherichia coli, we inoculated ΔsodB strain at 20% in 100 mL of iron-containing fermentation medium and cultured it at 37°C and 180 rpm until OD200. 600 =2.5, and cultured for 4 hours under the following conditions: addition of 0.3 g / L H2O2, 1.3 g / L PG, simultaneous addition of 0.3 g / L H2O2 and 1.3 g / L PG, and no addition of either. Before and after treatment, bacterial suspensions were taken and serially diluted 10-fold to the desired concentration, and spotted onto a plate. The suspensions were then incubated statically at 37°C. After colonies appeared, the viable cell count was determined, and the survival rate was calculated. Figure 7 It was found that under conditions of simultaneous addition of 0.3 g / L H2O2 and 1.3 g / L PPG for 4 h, the survival rate of strain ΔsodB was significantly lower than that under conditions of only PG, only H2O2, and neither. Under the latter three conditions, there was no significant difference in the survival rate of *E. coli*. KatG and KatE enzymes can decompose H2O2. Overexpression of katG and KatE improved PG tolerance, indicating that H2O2 is a necessary substance for PG to produce toxicity in *E. coli*.
[0162] Example 4: Iron ions and PG can form a complex.
[0163] It is known that ferric ions undergo the Fenton reaction with H₂O₂ to generate hydroxyl radicals. Simultaneously, ferric ions can form complexes with phenolic hydroxyl-containing compounds (such as the ligand *salen*), promoting the generation of HO· in the Fenton reaction. Since PG is also a phenolic compound containing three hydroxyl groups, we investigated whether ferric ions could react with PG to form a complex. First, 175 mg / L FeSO₄·7H₂O and 0.03% H₂O₂ were mixed and allowed to stand. Then, 150 mg / L PG was added and allowed to stand. Figure 8 It can be seen that when there is no PG, FeSO4·7H2O and H2O2 will form a precipitate after standing. This is because Fe 2+ First oxidized to Fe 3+ Fe(OH)3 is then formed. Subsequently, with the addition of PG, the precipitate gradually disappears, forming a homogeneous brown aqueous solution. This result indicates that PG can react with Fe... 3+ Formation of complexes.
[0164] Example 5: Determination of hydroxyl radicals (HO·) in Escherichia coli and their effect on PG tolerance.
[0165] Although hydroxyl radicals can damage DNA, the concentration of HO· in cells is normally very low and does not affect cell growth. To determine whether the complex formed by iron ions and PG can promote the Fenton reaction and generate a large number of hydroxyl radicals in cells, we investigated the concentration of hydroxyl radicals in bacteria under iron- and iron-free conditions, as well as under PG- and PG-free conditions. 2 mL of overnight cultured E. coli BL21(DE3) strain seed culture was inoculated into 100 mL of iron-containing or iron-free fermentation medium and cultured at 37°C and 180 rpm until OD200. 600 =2.5, with or without 1.3 g / L PG, incubate for 4 hours, three replicates each. Take 1*10 9 Intracellular hydroxyl radicals were measured using hydroxyphenyl fluorescein (HPF) (Shanghai Maokang Biotechnology, Cat#MX4804-1MG). Simultaneously, bacterial suspensions were serially diluted at appropriate ratios, and 2 μL of the suspension was spotted onto antibiotic-free LB agar plates and incubated at 37°C. Viable cell counts were then calculated. Figure 9 It was found that the content of hydroxyl radicals in cells was about 230 times higher when iron ions and PG were present simultaneously than under other conditions. This indicates that the complex formed by iron ions and PG promotes the Fenton reaction, resulting in the accumulation of large amounts of HO· in cells.
[0166] Subsequently, to investigate the relationship between hydroxyl radicals and bacterial tolerance to PG, 2 mL of overnight cultured E. coli BL21(DE3) strain seed culture was inoculated into 100 mL of iron-containing fermentation medium and cultured at 37°C and 180 rpm for 6 h. Different concentrations (0, 0.4%, 0.8%) of the HO· scavenger DMSO (BioSharp, Cat#BS087) were added first, followed by 1.3 g / L PG and incubation for another 4 h. Viable cell counts were measured before and after the addition of PG. Figure 10 It is known that DMSO can improve PG tolerance, and the survival rate of bacteria gradually increases with the increase of DMSO concentration. This indicates that the concentration of HO· in cells affects bacterial growth, and the complex formed by iron ions and PG promotes the production of HO· from hydrogen peroxide catalyzed by iron ions in the Fenton reaction, leading to excessive accumulation of HO· in cells and thus inducing ferroptosis.
[0167] Example 6: Comparison of RpoS protein expression levels in Escherichia coli mutant strains and wild-type strains
[0168] RNA polymerase sigma factor RpoS is a global regulatory factor in bacteria, capable of responding to various stresses. The stability of the RpoS protein is mainly regulated by two proteins, RssB and ClpX. As shown in Example 2, the ΔclpX strain exhibits significantly enhanced tolerance to PG. Therefore, we investigated whether the altered PG tolerance of the ΔclpX strain is related to the expression level of RpoS. First, 2 mL of overnight cultured E. coli BL21(DE3) strain and the ΔclpX strain seed culture were inoculated into 100 mL of iron-containing fermentation medium and cultured at 37°C and 180 rpm until OD... 600 =2.5, with or without 1.3 g / L PG, three replicates each. After culturing for 0.5 h, take 5 mL of bacterial culture, centrifuge, resuspend the precipitate in 1.2 mL TBS (pH = 7.5), autoclave, collect the supernatant, normalize the concentration, and detect by Western blotting using RpoS-specific antibody. Figure 11 It can be seen that RpoS is almost undetectable in wild strains, but the expression level of RpoS is very high in strain ΔclpX. This indicates that the improved tolerance of strain ΔclpX to PG is mainly due to the increased expression level of RpoS in cells, suggesting that RpoS can improve the tolerance of Escherichia coli to PG.
[0169] Example 7: Comparison of expression levels of RpoS-dependent oxidative stress-related genes in Escherichia coli mutant and wild-type strains
[0170] Ferroptosis is an iron-dependent oxidative cell death process. Because the complex formed by iron ions and PG promotes the Fenton reaction, leading to an excess of HO· in cells and thus generating strong oxidative stress, we investigated the expression of some RpoS-regulated genes related to oxidative stress in cells. Two mL of overnight cultured E. coli BL21(DE3) and ΔclpX seed culture were inoculated into 100 mL of iron-containing fermentation medium, with three replicates for each strain. The cultures were incubated at 37°C and 180 rpm until the logarithmic growth phase (OD2). 600 =1.6), take appropriate amounts of bacterial culture and extract RNA using the EASYspin Plus Bacterial RNA Rapid Extraction Kit (Beijing Adelaide, Cat#RN4302). Reverse transcription was performed using the Evo M-MLVf Reverse Transcription Kit II (Beijing Adelaide, Cat#AG11711-S), followed by RT-PCR assay using specific primers and the SYBR Green Pro Taq HS Premixed qPCR Kit (Beijing Adelaide, Cat#AG11701). The primers used for uspB were qPCR-uspBF (5'tgggctttatgtgtcgtttgcattg 3') and qPCR-uspBR (5'aatggatcgcagttacgcagtacc 3'); the primers used for yaiA were qPCR-yaiAF (5'cagagccgatcatcctaaaccagac 3') and qPCR-yaiAR (5'cactctttgtcagggtcctcatagc 3'); the primers used for bsmA were qPCR-bsmAF (5'gtgttgatgttaagtgcctgtagc 3') and qPCR-bsmAR (5'ggcgaatctcttgcggatggtc 3'); and the primers used for yggE were qPCR-yggEF (5'ggatggaccgcatattgtcacctc 3') and qPCR-yggER(5'gccacgttaacttcaatcgcaag3'); the primers used for yodB were qPCR-yodBF(5'ctccgtggctggtttcctaaagg3') and qPCR-yodBR(5'cacccaaacgaatatacccgcattg 3'); the primers used for ychH were qPCR-ychHF(5'ggcgtggggtattcaatcctcaac3') and qPCR-ychHR(5'aacggtcgcacacctgttcatg 3'). From Figure 12It can be seen that, compared with wild-type E. coli BL21(DE3), the expression levels of some genes related to oxidative stress regulated by RpoS protein in the ΔclpX strain were upregulated, such as uspB, yaiA, bsmA, yggE, yodB, and ychH. This indicates that the RpoS protein enhances the bacteria's tolerance to PG mainly by increasing the expression of some genes related to oxidative stress in order to cope with the oxidative stress caused by excessive hydroxyl radicals.
[0171] Example 8: Production of PG by shake-flask fermentation of engineered and wild-type Escherichia coli strains
[0172] 1.2 mL of E. coli BL21(DE3) strain Q3595 containing the production plasmid pACYC-accADBC-marA-phlD, which had been cultured overnight, and the ΔclpX / ΔsodB / qmcA-fetAB (SNP) triple mutant strain Q4333 were inoculated into a shake flask containing 50 mL of iron-containing or iron-free fermentation medium, and 50 μg / mL Cm was added. The mixture was incubated at 37°C and 180 rpm until OD... 600 =0.8, add 0.1mM IPTG for induction, culture at 30℃ and 180rpm, add ammonia every 12h to adjust pH to 7.0. Stop fermentation after about 24h. The concentration of PG in the fermentation broth was determined using the cinnamaldehyde colorimetric method. Ethanol and concentrated hydrochloric acid were mixed at a volume ratio of 3:1, and cinnamaldehyde was added dropwise to the mixture at a ratio of 1:10000 to prepare the colorimetric solution. The fermentation broth was centrifuged at 10000xg for 1 min, and 5μL of the supernatant was added to 1mL of cinnamaldehyde colorimetric solution. After mixing, the mixture was allowed to react at room temperature for 15 min, and the absorbance was measured at 446nm using a UV spectrophotometer. Figure 13 It can be seen that, under iron-containing conditions, the PG production of the ΔclpX / ΔsodB / qmcA-fetAB(SNP) mutant strain increased from 0.93±0.02 g / L in the control strain to 2.53±0.05 g / L. This experiment shows that the increased tolerance of bacteria to PG is beneficial to PG biosynthesis.
[0173] Example 9: Comparison of the tolerance of Escherichia coli to various phenols under iron ion and iron-free conditions
[0174] Wild-type E. coli BL21(DE3) strain was inoculated into 4 mL LB medium and cultured overnight at 37°C and 180 rpm. Subsequently, 20% of the strain was inoculated into 100 mL of iron-containing and iron-free fermentation medium, respectively, and cultured at 37°C until OD200. 600=2.5, take the bacterial suspension and serially dilute it 10-fold to the required concentration, then add 2.5 g / L phenol, 2.5 g / L resorcinol, 2.5 g / L catechol, 4 g / L pyrogallol and 0.27 g / L β-naphthol respectively, and incubate for 5 h. Take the bacterial suspension and serially dilute it 10-fold to the required concentration, spot it on a TLC plate. Incubate statically at 37℃, and count the viable cells after colonies appear to calculate the survival rate. Figure 14 It can be seen that after 5 hours of treatment in the presence of iron ions and phenolic substances, the survival rate of Escherichia coli was significantly lower than that in the absence of iron ions, indicating that various phenolic substances can induce ferroptosis in bacteria.
[0175] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention. Although the specific embodiments of the present invention have been described above, they are not intended to limit the protection scope of the present invention. Those skilled in the art should understand that various modifications or variations that can be made by those skilled in the art without creative effort based on the technical solutions of the present invention are still within the protection scope of the present invention.
Claims
1. A mutant strain of *Escherichia coli* with tolerance to phenolic stress, characterized in that, The mutant strain of *E. coli* was obtained by modifying wild-type *E. coli* using the following genetic engineering methods: Mutant iron export protein gene fetAB The nucleotide upstream of the start codon is a pair fetA A mutation C→G is performed 60 bp upstream of the start codon; Alternatively, knock out the superoxide dismutase gene. sodB Knockout of an ATP-dependent molecular chaperone gene in the ClpXP protease complex clpX Mutant iron export protein gene fetAB The nucleotide upstream of the start codon is a pair fetA A mutation C→G is performed 60 bp upstream of the start codon.
2. The *E. coli* mutant strain with phenolic stress tolerance as described in claim 1, characterized in that, The wild-type Escherichia coli is E. coli BL21(DE3).
3. The *E. coli* mutant strain with phenolic stress tolerance as described in claim 1, characterized in that, The superoxide dismutase gene sodB Derived from Escherichia coli, Genebank ID: 253977814; The ATP-dependent molecular chaperone gene clpX Derived from Escherichia coli, Genebank ID: 253976618; Iron ion export protein gene fetAB Derived from Escherichia coli, Genebank ID: 253976670 / 253976671.
4. The *E. coli* mutant strain with phenolic stress tolerance as described in claim 1, characterized in that, The mutant strain of *E. coli* exhibiting phenolic stress tolerance is a wild-type *E. coli* strain that, based on the aforementioned mutations, overexpresses the *Pseudomonas fluorescens* polyketide synthase gene. phlD Multiple resistance activator gene marA and acetyl-CoA carboxylase gene accADBC Any one or more of them.
5. The *E. coli* mutant strain with phenolic stress tolerance as described in claim 4, characterized in that, The fluorescent Pseudomonas polyketide synthase gene phlD Genebank ID: 11830552; the multi-resistance activator gene marA Derived from Escherichia coli, Genebank ID: 6060688; the acetyl-CoA carboxylase gene. accADBC It originates from E. coli, among which, the subunit accA Genebank ID: 6062185, subunit accB Genebank ID: 6058890, subunit accC Genebank ID: 6058863, subunit accD Genebank ID: 6059083.
6. The method for constructing the *Escherichia coli* mutant strain with phenolic stress tolerance according to any one of claims 1-5, characterized in that, The construction method includes: modifying wild-type Escherichia coli using the following genetic engineering methods: Mutant iron export protein gene fetAB The nucleotide upstream of the start codon is a pair fetA A mutation C→G is performed 60 bp upstream of the start codon; Alternatively, knock out the superoxide dismutase gene. sodB Knockout of an ATP-dependent molecular chaperone gene in the ClpXP protease complex clpX Mutant iron export protein gene fetAB The nucleotide upstream of the start codon is a pair fetA A mutation C→G is performed 60 bp upstream of the start codon.
7. The construction method as described in claim 6, characterized in that, The construction method includes: (b1) Using the genome of Escherichia coli BL21(DE3) as a template, the superoxide dismutase gene was amplified by PCR. sodB A type of ATP-dependent molecular chaperone gene in the ClpXP protease complex. clpX Iron ion export protein gene fetAB The left and right homologous arms were identified; the superoxide dismutase gene was amplified by PCR using pTarget plasmid as a template. sodB A type of ATP-dependent molecular chaperone gene in the ClpXP protease complex. clpX Iron ion export protein gene fetAB The sgRNA was amplified using pTarget plasmid as a template by PCR; the vector backbone was amplified using pKSI-1 plasmid as a template by PCR; the apramycin resistance gene (ApmR) expression module was amplified using pMIDAI plasmid as a template by PCR; and the iron ion export protein gene was amplified using the genome of strain Q3331 as a template by PCR. fetAB Mutated fragments; (b2) Using genetic engineering techniques to modify the above-mentioned genes sodB , clpX The left and right homologous arms, sgRNA, and pTarget vector backbone were recombined; the above genes were then used to... fetAB The left and right homologous arms, sgRNA, apramycin resistance gene expression module, and pTarget vector backbone were recombined; the above genes were then used to... fetAB The mutant fragment and the pKSI-1 vector backbone were recombined and chemically transformed into Escherichia coli DH5α for replication. (b3) Extract recombinant plasmids, use a gene editing system to modify any one or more of the above genes in the genome of Escherichia coli BL21(DE3) and eliminate the plasmids to obtain mutant strains.
8. The construction method as described in claim 6 or 7, characterized in that, The construction method further includes preparing competent cells using the above-mentioned mutated strain as a host, and expressing the plasmid pACYC -accADBC-marA-phlD Recombinant cells were obtained by introducing competent cells.
9. The use of the *Escherichia coli* mutant strain according to any one of claims 1-5 in any one or more of the following: (c1) Research on phenolic compound-induced ferroptosis and its mechanism; (c2) Fermentation to produce phloroglucinol.
10. The application as described in claim 9, characterized in that, In application (c1), the phenolic compounds include phloroglucinol, phenol, catechol, resorcinol, phloroglucinol and β-naphthol.
11. The application of a mutant strain of *Escherichia coli* with phenolic stress tolerance in any one or more of the following: (c1) Research on phenolic compound-induced ferroptosis and its mechanism; (c2) Fermentation production of phloroglucinol; The Escherichia coli mutant strain was obtained by modifying wild-type Escherichia coli using any one or more of the following genetic engineering methods (a1)-(a2): (a1) Knockout of superoxide dismutase gene sodB ; (a2) Knockout of an ATP-dependent molecular chaperone gene in the ClpXP protease complex clpX .
12. The application as described in claim 11, characterized in that, In application (c1), the phenolic compounds include phloroglucinol, phenol, catechol, resorcinol, phloroglucinol and β-naphthol.
Citation Information
Patent Citations
Genetically engineered bacteria with high phloroglucinol synthesis capability and construction method and application
CN106929527A
Application of phenolic compound induced ferroptosis in cell growth and tumor treatment
CN116585293A