Application of TRM family protein gene OsSSD2 in regulating plant height of gramineae crops

CN116479005BActive Publication Date: 2026-09-25SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310087745.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-18
Publication Date
2026-09-25
Estimated Expiration
2043-01-18

AI Technical Summary

Technical Problem

[0005]水稻中TRM(TON1 Recruiting Motif)家族蛋白编码基因的功能仍鲜有研究

Benefits of technology

(1)本发明利用反转录PCR技术从水稻中克隆到了OsSSD2基因,证实了其在调控禾本科作物株高中的作用,是一种重要的调控禾本科作物株高的基因。本发明有助于了解OsSSD2基因的作用机制,为进一步了解禾本科作物的株高的调控奠定了基础。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116479005B_ABST
    Figure CN116479005B_ABST
Patent Text Reader

Abstract

The application discloses application of a TRM family protein gene OsSSD2 in regulation of plant height of a gramineous crop. The application discloses that the OsSSD2 gene can regulate the plant height of the gramineous crop. The application constructs an overexpression vector of the OsSSD2, transforms a receptor rice variety Nipponbare, and obtains an OX-OsSSD2 strain with overexpression of the OsSSD2. The OX-OsSSD2 strain has a significantly reduced plant height compared with the receptor rice variety Nipponbare and does not affect the grain shape of the rice. The application constructs a targeted gene editing vector of the OsSSD2, transforms a japonica rice variety Nipponbare, and obtains an OsSSD2-KO strain with 2bp deleted in a coding region of the OsSSD2. The OsSSD2-KO strain has a significantly increased plant height compared with the receptor rice Nipponbare and does not affect the grain shape of the rice. The application provides a candidate gene resource and potential application for regulation of the plant height of the gramineous crop.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, and specifically relates to TRM family protein genes. OsSSD2 Application in regulating plant height in gramineous crops. Background Technology

[0002] Rice holds a vital position as a food crop, feeding nearly half of the world's population. With population growth, the demand for rice is increasing. However, increasing arable land to meet this enormous demand is impractical. Therefore, given the limited arable land, improving rice yield per unit area has been a key research focus for scientists. Besides increasing yield per rice plant, improving yield per unit area by constructing an ideal plant type has been a focus for Chinese scientists. An ideal rice plant type can be improved by considering plant height, number of tillers, leaf type, and leaf arrangement. Rice plant height, referring to the distance from the base of the stem to the top of the main panicle at maturity, is a crucial supporting trait of an ideal plant type and a significant factor determining rice yield. Rice plant height is primarily determined by the elongation of the stem, which develops from repeated nodes and internodes. Excessive plant height typically results in thin stems, reduced load-bearing capacity, and increased susceptibility to lodging. Conversely, excessively short plants often lead to smaller seeds, excessive tillering, and weakened stress resistance. Therefore, both excessively tall and short rice plants significantly impact biomass yield. In conclusion, research on genes regulating rice plant height has significant theoretical and practical implications for targeted improvement of plant height.

[0003] The identification and utilization of dwarf genes have accelerated research into the functional mechanisms of dwarf-related genes. The cloning and application of sd1, a key gene in the gibberellin anabolic pathway, not only improved the lodging resistance of rice but also created new highs in rice yield (Spieleyer W, Ellis MH, Chandler PM). Semidwarf ( sd-1 ), "green revolution" rice, contains a defective gibberellin 20-oxidase gene. Proceedings of the National Academy of Sciences of the United States of America. 2002, 99: 9043-9048.), but sd1 Excessive use of genes can lead to problems such as narrow genetic base and yield bottlenecks (Gu Fulin, Zhai Huqu, Wan Jianmin, et al. Preliminary analysis of dwarf genotypes in new dwarf rice sources. Jiangsu Agricultural Sciences, 2003, (6): 15-18.). Shivashankar et al. in rice variety Pusa 1652SD1 In the gene, a gene that does not carry... sd1-d Functional SNP mutation in the allele, the mutation site is located in Pusa 1652 SD1 A T-to-A mutation occurred at codon 300 of the third exon of the gene, resulting in the production of a stop codon. OsGA20ox2 The premature termination of translation blocks the biosynthesis of GA3, and the presence of this allele makes it the most widely used [gene] in rice. sd1-d An alternative is provided (Bhuvaneswari S, Gopala Krishnan S, Ellur RK, et al . Discovery of a novelinduced polymorphism in SD1 Gene governing semi-dwarfism in rice and development of a functional marker for marker-assisted selection. Plants (Basel), 2020, 9:1198.). Currently, most identified genes related to plant height regulation are associated with plant hormones. GID1 is a GA-specific receptor in rice. GID1 After gene mutation, GA cannot form a complex with GID1, leading to abnormal GA signaling. Therefore, the mutant exhibits a dwarfing phenotype and is insensitive to exogenous GA. However, some genes are unaffected by plant hormone regulation and thus do not influence plant height. d1 This is the first GAs-insensitive dwarf mutant discovered in rice, and its GA content is higher than that of the wild type (Ueguchi-Tanaka M, Fujisawa Y, Kobayashi M, et al Ricedwarf mutant d1 , which is defective in the alpha subunit of the heterotrimericG protein, affects gibberellin signal transduction. Proceedings of the National Academy of Sciences of the United States of America, 2000, 97(21):11638-11643.).

[0004] The genome of the dicotyledonous Arabidopsis thaliana contains 34 TRM (TON1 Recruiting Motif) family protein-coding genes, but the functions of only a few TRM family protein genes have been elucidated. TRM1 can recruit TON1 cells to form periplasmic microtubule arrays (Drevensek S, Goussot M, Duroc Y, ...) in interphase cells. et al The Arabidopsis TRM1–TON1 Interaction Reveals a Recruitment Network Common to Plant Cortical Microtubule Arrays and Eukaryotic Centrosomes. Plant Cell, 2012, 24:178-191.), TRM6–8 participate in the formation of the preprophase band (PPB) during cell division, thereby ensuring the symmetry of cell division (Schaefer E, Belcram K, Uyttewaal M, et al . The preprophase bandofmicrotubules controls the robustness of division orientation in plants. Science, 2017, 356:186-189.).

[0005] The function of TRM (TON1 Recruiting Motif) family protein-coding genes in rice remains poorly studied. Summary of the Invention

[0006] This invention discovered TRM family protein genes during the research. OsSSD2 It is similar to Arabidopsis thaliana. TRM6 , TRM7 and TRM8 They are orthologous genes; OsSSD2 It is expressed in all tissues of grass crops, with the highest relative expression level in the internodes; OsSSD2 Overexpression of genes can reduce plant height in gramineous crops, while targeted gene editing to functionally inactivate them in recipient gramineous crops can increase plant height. To overcome the shortcomings of existing technologies, the present invention aims to provide TRM family protein genes. OsSSD2 Application in regulating plant height in gramineous crops.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: OsSSD2The application of genes or their related sequences in regulating plant height in gramineous crops, wherein the gene OsSSD2 The relevant sequence is any one or more of the following sequences: (1) OsSSD2 The CDS nucleotide sequence of the gene; (2) OsSSD2 The amino acid sequence encoded by the gene.

[0008] The aforementioned OsSSD2 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The aforementioned OsSSD2 The CDS nucleotide sequence of the gene is shown in SEQ ID NO.2; The aforementioned OsSSD2 The amino acid sequence encoded by the gene is shown in SEQ ID NO.3.

[0009] Furthermore, the regulation of gramineous crop plant height is to reduce the plant height of gramineous crops, and the application includes the following steps: Build OsSSD The overexpression vector of gene 2 was used to transform recipient grass crops, resulting in transgenic grass crops that overexpressed the OsSSD2 protein.

[0010] The overexpression OsSSD2 The transgenic grasses containing protein had reduced plant height compared to the wild-type grasses of the recipient.

[0011] Furthermore, the regulation of gramineous crop plant height is to increase the plant height of gramineous crops, and the application includes the following steps: Targeted editing using CRISPR / Cas9 technology OsSSD2 Genes, construction OsSSD2 Gene editing vectors are introduced into recipient grass crops to achieve inhibition. OsSSD2 Transgenic grasses with gene expression.

[0012] The suppression OsSSD2 The transgenic grasses expressing the gene showed increased plant height compared to the wild-type grasses of the recipient.

[0013] The above OsSSD2 The application of inhibitors or blockers of genes or their related sequences in increasing the height of grass crops.

[0014] Furthermore, the inhibitor or blocker is used for gene knockout. OsSSD2 The gene editing vector; the gene editing vector is a CRISPR / Cas9 gene editing vector; the target of the CRISPR / Cas9 gene editing vector is... OsSSD2The genome sequence 761-780 bp, which is CDS nucleotide sequence 6-25 bp, has the following nucleotide sequence: 5'-tgtggagaagcctacttcaa-3'.

[0015] contain OsSSD2 Applications of gene or related sequence expression vectors, expression cassettes, transgenic cell lines, and host bacteria in regulating the growth rate of gramineous crops.

[0016] The aforementioned grass crops include rice, wheat, and maize, with rice being the preferred variety.

[0017] The present invention has the following advantages and effects compared with the prior art: (1) This invention uses reverse transcription PCR technology to clone from rice... OsSSD2 The gene was identified, confirming its role in regulating plant height in gramineous crops, making it an important gene for regulating plant height in gramineous crops. This invention contributes to the understanding of... OsSSD2 The mechanism of gene action lays the foundation for further understanding the regulation of plant height in gramineous crops.

[0018] (2) The present invention provides OsSSD2 Genes have significant application value in the breeding of grass crop varieties with different plant heights. Attached Figure Description

[0019] Figure 1 TRM family protein genes OsSSD2 The structural information diagram.

[0020] Figure 2 Phylogenetic tree of TRM family protein OsSSD2 and 34 TRM family members in Arabidopsis thaliana.

[0021] Figure 3 This is a schematic diagram illustrating the overexpression of the empty vector pOX in rice.

[0022] Figure 4 For rice OsSSD2 Gene overexpression plants OX - OsSSD2 With the recipient variety Nipponbare OsSSD2 Gene expression level comparison chart.

[0023] Figure 5 For rice OsSSD2 Gene overexpression plants OX - OsSSD2 A statistical comparison of plant height phenotypes with the recipient variety, Nipponbare.

[0024] Figure 6 For rice OsSSD2 A graph showing the regulatory effects of gene overexpression and knockout on rice plant height; where 'a' represents...OsSSD2 Gene overexpression plants OX - OsSSD2 A comparison of plant height phenotypes with the recipient variety Nipponbare, b is... OsSSD2 Gene knockout plants OsSSD2-KO A comparison of plant height phenotypes with the recipient variety, Nipponbare.

[0025] Figure 7 For rice OsSSD2 Gene overexpression plants OX - OsSSD2 A comparison of grain length and grain width phenotypes between the recipient variety, Nipponbare, and the recipient variety.

[0026] Figure 8 This is a schematic diagram of the sgRNA intermediate vector (empty vector) pYLgRNA.

[0027] Figure 9 A schematic diagram of the structure of the binary vector (empty vector) pYLCRISPR / Cas9Pubi-H for plant genome editing.

[0028] Figure 10 for OsSSD2 Schematic diagram of gene editing target locations and knockout mutants OsSSD2-KO Image showing the deletion of 2bp at the target site and its sequencing results.

[0029] Figure 11 for OsSSD2 Gene knockout plants OsSSD2-KO A statistical comparison of plant height phenotypes with the recipient variety, Nipponbare.

[0030] Figure 12 for OsSSD2 Gene knockout plants OsSSD2-KO A comparison of grain length and grain width phenotypes between the recipient variety, Nipponbare, and the recipient variety. Detailed Implementation

[0031] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and raw materials used in the present invention are all commercially available.

[0032] rice OsSSD2 The gene's lookup number in the GenBank database (https: / / www.ncbi.nlm.nih.gov) is Os03g0831700. This gene is located on chromosome 3 of rice and has a DNA length of 5002 bp. OsSSD2 The nucleotide sequence of the gene is shown in SEQ ID NO.1. OsSSD2The gene encodes two transcripts, 3409 bp and 3145 bp in length, respectively, each containing 6 exons and 5 introns. The difference between the two transcripts lies within the 5'-untranslated region (UTR) (e.g., ...). Figure 1 (As shown). OsSSD2 The gene's CDS (coding sequence) nucleotide length is 2661 bp ( OsSSD2 The CDS nucleotide sequence of the gene is shown in SEQ ID NO.2, predicting that the amino acid sequence of the protein it encodes is 886 amino acids (aa), and its amino acid sequence is shown in SEQ ID NO.3. Protein sequence analysis shows that the TRM family protein OsSSD2 is on the same branch of the phylogenetic tree as Arabidopsis TRM6, TRM7, and TRM8 (e.g., Figure 2 (As shown).

[0033] Example 1

[0034] Internode tissue of the Nipponbare rice variety, 40 days after field transplanting, was selected as material. Following standard methods in genetic engineering and the reagent company's instruction manual, RNA was extracted from the rice tissue using Invitrogen's Trizol reagent (USA). cDNA was then obtained through reverse transcription using Takara Bio's PrimeScript™ II 1st Strand cDNA Synthesis Kit (China). Finally, cDNA was amplified by PCR using Takara Bio's PrimeSTAR® GXL DNA Polymerase (China). OsSSD2 The CDS nucleotide sequence of the gene, OsSSD2 The CDS nucleotide sequence of the gene is shown in SEQ ID NO.2, and its length is 2661 bp.

[0035] The PCR amplification program was as follows: 98℃ for 30 seconds; then 98℃ for 10 seconds, 58℃ for 15 seconds, 72℃ for 3 minutes, for a total of 30 cycles; and finally 72℃ for 10 minutes.

[0036] The primers used for PCR are: OX-OsSSD2-F: 5'- AGGGTACCGGCGCGCC aagctt ATGGATGTGGAGAAGCCTACTTCA -3'; and OX-OsSSD2-R: 5'- CAATTCACACTTGTA ggatcc CTACAAAGAAGTGTCAGACACTAGAAGTAG -3'.

[0037] The single underlined portion represents the homologous arm sequence of the pOX vector, and the two lowercase letters represent the use of...Hin dⅢ and Bam The restriction enzyme recognition sequence for double digestion of the vector by HⅠ, the double-underlined part is... OsSSD2 Gene-specific sequences are used for amplification OsSSD2 Full-length gene sequence (excluding the stop codon TGA).

[0038] After sequencing verification confirms correctness, OsSSD2 The full-length CDS fragment of the gene (excluding the stop codon) is inserted into the pOX vector (see diagram of the vector). Figure 3 As shown in the diagram, a system driven by the UBI bootloader is constructed. OsSSD2 Gene overexpression (i.e.) P ubi :: OsSSD2 The pOX vector was provided by Academician Liu Yaoguang of the State Key Laboratory of Subtropical Agricultural Bioresources Conservation and Utilization, South China Agricultural University. Information regarding the vector has been published in "Li YH, Yang YQ, Liu Y, et al Overexpression of OsAGO1b This is disclosed in the article "Induces adaxially rolled leaves by affecting leafabaxial sclerenchymatous cell development in rice. Rice (NY), 2019, 12(1):60." The completed [cell structure / structure] will be [developed / constructed / disseminated]. OsSSD2 Gene overexpression vectors were transferred into *E. coli*. After sequencing verification, plasmids were extracted and transformed into *Agrobacterium* using the electrode method. *Agrobacterium* was then used to infect *Nipponbare* callus tissue, and transformed seedlings were obtained through tissue culture differentiation and screening. The transformed seedlings and their progeny were then planted and identified to obtain... OsSSD2 Independent, stable, homozygous lines with overexpressed genes OX-OsSSD2 .

[0039] Selected seedlings that have grown for 4 weeks using conventional seedling transplanting methods OsSSD2 Gene overexpression lines OX-OsSSD2Using leaves from seedlings of the recipient variety Nipponbare as materials, and following standard methods in the field of genetic engineering, RNA was extracted from rice tissues using Invitrogen's Trizol reagent (USA) according to the reagent company's instruction manual. cDNA was then obtained through reverse transcription using Takara Bio's PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time). Finally, the cDNA was analyzed using Takara Bio's TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) quantitative PCR kit. OsSSD2 Gene expression levels were detected by qRT-PCR. The primers used for qRT-PCR were: OsSSD2-qF: 5'-CAAATTCGTTCCTTGAAGATGC-3'; OsSSD2-qR: 5'- CCCATAAGCCTTGCTACAACAG-3'.

[0040] The amplification program was: 95℃ for 30 s; then 95℃ for 5 s, 60℃ for 30 s, for a total of 40 cycles.

[0041] The FhaB gene (Os06g0316100) was used as an internal reference gene, and the primers used were: FhaB-qF: 5'-GAGAAGCAGAAGCAGAAGGA-3'; FhaB-qR: 5'-CTTGAATAGGACCATCAGGC-3'.

[0042] The results are as follows Figure 4 As shown, OsSSD2 Gene overexpression lines OX-OsSSD2 middle OsSSD2 The gene expression level was more than 1,000 times higher than that of the recipient variety, Nipponbare.

[0043] When the transplanted materials mature, measure them separately. OsSSD2 Gene overexpression lines OX-OsSSD2 The plant height, grain length, and grain width of the recipient variety Nipponbare were also studied. The results showed that compared to the recipient variety Nipponbare, OsSSD2 Gene overexpression lines OX-OsSSD2 Plant height decreased significantly (e.g.) Figure 5 and Figure 6 As shown in a), the grain length and grain width did not change significantly (as shown in a). Figure 7 (As shown).

[0044] Example 2 Based on the principles of CRISPR / Cas9 gene editing technology, target sites were analyzed and designed using an online website (http: / / skl.scau.edu.cn / ). OsSSD2 Genome sequences with low off-target rates were selected. OsSSD2 The target site is located at 761-780 bp of the genome sequence, i.e., the 6th-25th bp of the CDS nucleotide sequence, and the following target primers were designed.

[0045] Forward primer OsSSD2-gRT: 5'-TGTGGAGAAGCCTACTTCAAgttttagagctagaaat-3'; Reverse primer OsSSD2-U6a: 5'-TTGAAGTAGGCTTCTCCACAcggcagccaagccagca-3'.

[0046] The uppercase letters in the forward primer OsSSD2-gRT are: OsSSD2 The target sequence, with the lowercase letters representing the pYLgRNA vector preserved in our laboratory (vector schematic diagram shown in Figure 1). Figure 8 The sgRNA sequence shown is shown; the uppercase part of the reverse primer OsSSD2-U6a is... OsSSD2 The complementary sequence to the target sequence, with the lowercase letter part being the U6a promoter sequence in the pYLgRNA vector. The pYLgRNA vector was provided by Academician Liu Yaoguang of the State Key Laboratory of Subtropical Agricultural Bioresources Conservation and Utilization, South China Agricultural University. Vector-related information has been published in the article "Zeng Dongchang, Ma Xingliang, Xie Xianrong, et al. Operational methods for construction and mutation analysis of plant CRISPR / Cas9 multi-gene editing vectors. Science in China: Life Sciences, 2018, 48(7): 783-794."

[0047] OsSSD2 The construction of the targeted gene editing vector is carried out according to the following steps: (1) First round of PCR. The purpose of this step is to introduce the target sequence downstream of the U6a promoter and upstream of the sgRNA sequence, respectively. According to the reagent company's manual, the high-fidelity enzyme Phanta® Max Super-Fidelity DNA Polymerase from Vazyme was used for amplification. The PCR program was: 95℃ for 10 s, 58℃ for 15 s, and 72℃ for 15 s, for a total of 25 cycles. The primers used were OsSSD2-gRT, OsSSD2-U6a, primer UF (primer sequence 5'-CTCCGTTTTACCTGTGGAATCG-3') and primer gR-R (primer sequence 5'-CGGAGGAAAATTCCATCCAC-3'). (2) Second round of PCR. The purpose of this step is to construct the promoter, target site and sgRNA into a complete expression cassette. The PCR program is 95℃ for 10 s, 58℃ for 15 s and 72℃ for 20 s, for a total of 28 cycles. The primers used are Pps-R (5'- TTCAGAGGTCTCTCTCGACTAGTATGGAATCGGCAGCAAAGG-3') and Pgs-2 (5'- AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3'). The PCR template used is the product of the first round of PCR.

[0048] (3) Insert the expression cassette with the selection marker hygromycin resistance gene. HPT The binary vector pYLCRISPR / Cas9Pubi-H vector (see schematic diagram of vector structure as shown) Figure 9 (as shown). Among them, the pYLCRISPR / Cas9Pubi-H vector was provided by Academician Liu Yaoguang of the State Key Laboratory of Subtropical Agricultural Bioresources Conservation and Utilization, South China Agricultural University. The relevant information about the vector has been published in the article "Zeng Dongchang, Ma Xingliang, Xie Xianrong, et al. Operational methods for construction and mutation analysis of plant CRISPR / Cas9 multi-gene editing vectors. Science in China: Life Sciences, 2018, 48(7): 783-794." The method of cutting and ligating simultaneously was adopted, and the enzymes used were NEB (China) enzymes. Bsa I-HF and T4 DNA ligase from Takara Bio (China) were used. The PCR program was 37℃ for 5 min, 10℃ for 5 min, 20℃ for 5 min, for a total of 15 cycles; the final cycle was 37℃ for 5 min.

[0049] Completed OsSSD2The targeted gene editing vector was transferred into *E. coli*. After sequencing verification, the plasmid was extracted and transformed into *Agrobacterium* using the electrode method. *Agrobacterium* was then used to infect *Nipponbare* callus tissue, and transformed seedlings were obtained through tissue culture differentiation and screening. The transformed seedlings and their progeny were then planted and identified to obtain... OsSSD2 Stable homozygous expression lines with 2 bp deletions in both nucleotide chains of the gene OsSSD2-KO .

[0050] Select seedlings that have grown to about 2 weeks old through conventional seedling transplanting. OsSSD2-KO Using leaves as material, genomic DNA was extracted using conventional plant DNA extraction methods, employing 2 x Taq Master Mix from Vazyme. OsSSD2-KO Genomic DNA was used as a template for amplification.

[0051] The PCR program was as follows: 94℃ for 2 min pre-denaturation; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 3 min, for a total of 30 cycles; and finally 72℃ for 5 min.

[0052] The primers used are: Cas-OsSSD2-F: 5'-AAAGTCGCTGGTTTTGGGAGCTT-3'; Cas-OsSSD2-R: 5'-TGGGACGGAGGGAGTGGTTAAT-3'.

[0053] The amplified fragment was a PCR product containing the target site. The PCR product was sequenced for verification, and the results are as follows. Figure 10 As shown, Figure 10 a shows that the target site is located at 6-25 bp in the CDS sequence. Figure 10 b and Figure 10 c display OsSSD2-KO In OsSSD2 The gene has a 2 bp deletion at position 21-22 bp on the positive strand of the CDS nucleotide sequence.

[0054] When the transplanted materials mature, measure them separately. OsSSD2-KO The plant height, grain length, and grain width of the strains and the recipient variety Nipponbare were studied. The results showed that, compared with the recipient variety Nipponbare, OsSSD2-KO The plant height of the strains increased significantly (e.g. Figure 11 and Figure 6 As shown in b), the grain length and grain width did not change significantly (as shown in b). Figure 12 (As shown).

[0055] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. OsSSD2 The application of gene CDS in regulating rice plant height is characterized by, The aforementioned OsSSD2 The nucleotide sequence of the gene's CDS is shown in SEQ ID NO.2; The regulation of rice plant height was achieved through overexpression. OsSSD2 The CDS gene reduces rice plant height, or knockout reduces it. OsSSD2 The CDS gene increases rice plant height.

2. The claim 1 OsSSD2 The application of CDS inhibitors or blockers in increasing rice plant height.

3. The application according to claim 2, characterized in that: The inhibitor or blocker mentioned is used for gene knockout. OsSSD2 The gene editing vector; the gene editing vector is a CRISPR / Cas9 gene editing vector; the target site of the CRISPR / Cas9 gene editing vector is located at... OsSSD2 The nucleotide sequence of the genome sequence from 761 to 780 bp, which is the 6th to 25th bp of the CDS nucleotide sequence, is: 5'-tgtggagaagcctacttcaa-3'.

4. Containing the contents of claim 1 OsSSD2 Application of gene CDS expression vectors, expression cassettes, or transgenic cell lines in regulating rice plant height; The regulation of rice plant height was achieved through overexpression. OsSSD2 The CDS gene reduces rice plant height, or knockout reduces it. OsSSD2 The CDS gene increases rice plant height.

Citation Information

Patent Citations

  • Application of OsMADS47 gene to regulation of rice grain form

    CN106011146A

  • Rice grain shape gene OsMKK3 coding gene and application thereof

    CN113528540A