Plant flower color regulation method based on carbon quantum dot gene delivery platform

Abstract

The application relates to the field of biotechnology and discloses a plant flower color regulation method based on a carbon quantum dot gene delivery platform. CQDs are positively charged particles synthesized by a hydrothermal method by taking dicyandiamide and sodium citrate as carbon sources. The CQDs can be quickly combined with negatively charged siRNA to form a complex siRNA-CQDs. The siRNA-CQDs can enter plant cells through a cell wall, mediate RNAi silencing of a flower color regulation gene, and thus realize plant flower color change. Compared with traditional genetic transformation methods and virus-mediated gene silencing, the flower color regulation technology based on the carbon quantum dot gene delivery platform has a plurality of unique characteristics, including that the synthesized carbon quantum dots have positive charges, flower color change is obvious, operation is simple and easy to implement, and the application range is wide, and the like. Therefore, the technology provides a brand-new approach for plant flower color change and has wide application prospects.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for regulating plant flower color based on a carbon quantum dot gene delivery platform. Background Technology

[0002] Flower color is one of the most important characteristics in ornamental plant breeding. While biotechnology provides plant breeders with additional tools to improve various traits desired by growers and consumers of horticultural crops, traditional genetic transformation methods (such as Agrobacterium-mediated transformation, gene gun transformation, and polyethylene glycol-mediated transformation) suffer from drawbacks such as low transformation efficiency, poor gene stability, complex operation, and high cost. Furthermore, virus-mediated gene silencing (VIGS) requires the construction of viral vectors, which not only carries certain risks but is also difficult to perform; even slight errors can negatively impact plant growth and development. Therefore, we need a more efficient, safe, simple, and low-cost method to regulate flower color.

[0003] Chalcone isomerase (CHI) is essential for the conversion of chalcone to naringenin, which is necessary for anthocyanin biosynthesis. Therefore, CHI is a key enzyme in the anthocyanin synthesis pathway, and changes in its expression level in plants can affect flower color. Currently, RNAi has become a widely used research technique for achieving catalytic inhibition of expression levels targeting specific gene sequences. In RNAi technology, exogenous small interfering RNA (siRNA) can be delivered into the plant cytoplasm to exert its function. However, compared to mammalian cells, plant cells possess a supporting cellulose cell wall. This cell wall, while surrounding the cell membrane, also provides protection and limits the influence of non-biological molecular delivery methods (such as electroporation, heat shock, cationic lipids, and positively charged polymers) on plant transformation, thus ensuring cell stability and safety. The presence of the cell wall severely hinders the application of RNAi in plants.

[0004] Therefore, developing a method for accurately and efficiently delivering siRNA in plants so that it can play its proper role is a technical problem that needs to be solved. Summary of the Invention

[0005] To address the aforementioned difficulties in altering flower color, this invention provides a method and application for establishing a system of carbon quantum dot (CQD)-mediated silencing of key enzyme genes (chalcone isomerase: CHI) for regulating flower color in plants.

[0006] A method for regulating plant flower color based on a carbon quantum dot gene delivery platform.

[0007] After fully combining siRNA designed and synthesized based on the gene sequence regulating plant flower color synthesis with carbon quantum dots, it is directly applied to the surface of the plant, preferably to the surface of the petals, to achieve flower color change.

[0008] Furthermore, after fully combining siRNA with carbon quantum dots, a surfactant is added, mixed thoroughly, and then applied to the surface of the plant.

[0009] Further optimization involves using 0.05% Silwet L-77 as the surfactant.

[0010] Furthermore, the synthesized carbon quantum dots have a particle size of less than 10 nm, enabling them to penetrate cell walls and enter cells.

[0011] The specific process for synthesizing the siRNA-CQDs complex using the method described above is as follows:

[0012] Mix 90-110 μM siRNA with 25-35 mg / ml CQDs solution at a volume ratio of 1:1.2-1.8, and finally add 0.08-0.12 M salt solution to make up to 100 μL; then sonicate the mixture in a water bath to disperse the aggregated CQDs, which facilitates the binding of CQDs and siRNA; incubate the sonicated solution at room temperature for at least 30 min, and centrifuge to remove unbound CQDs to obtain the siRNA-CQDs complex.

[0013] Furthermore,

[0014] The mixture was subjected to ultrasonic oscillation in a water bath, using a 3mm probe tip and an amplitude of 50% (~40W) before incubation.

[0015] The salt solution includes: sodium chloride solution.

[0016] Furthermore,

[0017] The specific process of synthesizing CQDs:

[0018] Dissolve 0.76 g of dicyandiamide and 0.294 g of sodium citrate in 40 ml of distilled water, using sonication to aid dissolution. Bring the volume to 60 ml and transfer to a 100 ml hydrothermal reactor. React at 200 °C for 4 h. After the reactor cools naturally to room temperature, centrifuge at 3000 r / min for 30 min to remove larger precipitates. Figure 1 The leftmost image shows the dried precipitate. The supernatant containing nanoscale carbon quantum dots was removed and dried at 55°C until a precipitate appeared (approximately 24 hours for 60 ml of reaction solution), yielding two colors of powder, one of which was a grayish-white powder (…). Figure 1 The rightmost one is a carbon quantum dot with a particle size of less than 10 nm that has the function of protecting nucleic acids.

[0019] Furthermore,

[0020] The specific procedure for using the siRNA-CQDs complex:

[0021] Add the surfactant to the siRNA-CQDs complex, mix well, and then sprinkle it on the surface of the plant.

[0022] Preferably, 0.05% Silwet L-77 surfactant is added to the siRNA-CQDs complex, mixed well, and then sprinkled on the surface of the petals.

[0023] The flower color regulation technology of this invention possesses several unique characteristics, including the synthesized carbon quantum dots carrying a positive charge, significant flower color changes, simple and easy operation, and wide applicability. Therefore, this technology provides a completely new approach to altering plant flower color and has broad application prospects.

[0024] This invention utilizes a constructed nucleic acid delivery platform to alter the flower color of plants. Unlike traditional plasmid delivery methods, carbon quantum dots are easier to fabricate, and carbon quantum dots-mediated silencing is faster, resulting in more efficient changes in plant flower color.

[0025] The carbon quantum dots synthesized in this invention have a positive charge and do not require additional modification during the binding of siRNA.

[0026] This invention first synthesizes carbon quantum dots carrying positive charges, then uses an ultrasonic tip to thoroughly mix and combine siRNA and carbon quantum dots, uses Silwet L-77 surfactant to enhance the penetration of siRNA-CQDs, and finally applies them to petals to change flower color.

[0027] The CQDs of this invention are positively charged particles synthesized via a hydrothermal method using dicyandiamide and sodium citrate as carbon sources. They can rapidly bind to negatively charged siRNA to form the complex siRNA-CQDs. siRNA-CQDs can penetrate the cell wall and enter plant cells, mediating RNAi silencing of flower color regulating genes, thereby achieving changes in plant flower color.

[0028] The present invention also provides a carbon quantum dot gene delivery platform, comprising siRNA and carbon quantum dots designed and synthesized based on the gene sequence regulating plant flower color synthesis.

[0029] Furthermore, it also includes a surfactant; preferably 0.05% Silwet L-77 as the surfactant.

[0030] Compared with the prior art, the advantages and beneficial effects of this invention are as follows:

[0031] 1. The hydrothermal synthesis method for carbon quantum dots mentioned in this invention produces atoms that carry a positive charge immediately after synthesis, without the need for additional experimental modification.

[0032] 2. This invention utilizes a nucleic acid delivery platform to significantly shorten the time for color change to within 1 hour.

[0033] 3. This invention is suitable for applications with good modification effects and broad applicability.

[0034] Existing technical challenges:

[0035] Carbon quantum dots synthesized using conventional methods are typically negatively charged, or even uncharged. Positively charged carbon quantum dots require subsequent modification with PEI and amino groups to bind with siRNA. This modification process is complex and technically challenging. The method described in this invention allows for immediate complexation with siRNA to form siRNA-CQDs after synthesis, meaning the synthesized carbon quantum dots possess a positive charge effect. Currently, methods for altering flower color mainly focus on genetic transformation and virus-mediated gene silencing. These methods are difficult to implement and operate. The method described in this invention is simple and easy to implement.

[0036] Features of this invention:

[0037] CHI enzyme is a key enzyme in the anthocyanin synthesis pathway, and changes in its expression level in plants can affect flower color. Using the technology of this invention, siRNA-CQDs can be applied to various angles of fresh flowers according to personal preference, and white spots can be observed in the flowers within just 1 hour, enhancing their ornamental value. The features of this invention are: the ability to see color changes in a very short time, providing a unique viewing experience; the method for synthesizing positively charged carbon quantum dots is simple; and the efficiency of color change is improved after silencing the CHI gene.

[0038] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments. Attached Figure Description

[0039] Figure 1 The carbon quantum dots synthesized in this invention.

[0040] Figure 2 Electron micrograph and particle size distribution of the carbon quantum dots synthesized in this invention.

[0041] Figure 3 The present invention provides gel protection experimental results for detecting whether synthesized carbon quantum dots have the ability to bind and protect siRNA.

[0042] Figure 4 : Test results from the nucleic acid delivery platform.

[0043] Figure 5Results of applying siRNA-CQDs to flower petals to change flower color. Detailed Implementation

[0044] The following experimental examples are further illustrative of the present invention and are not intended to limit the invention. Specific experimental conditions and methods are not specified in the following examples, and the techniques used are generally conventional methods well known to those skilled in the art.

[0045] Example 1: Synthesis of carbon quantum dots, the specific steps are as follows:

[0046] Weigh 0.76 g of dicyandiamide and 0.294 g of sodium citrate, dissolve them in 40 ml of distilled water, and sonicate to aid dissolution. Make up the volume to 60 ml, then transfer to a 100 ml hydrothermal reactor and react at 200 °C for 4 h. Centrifuge at 3000 r / min for 30 min to remove larger precipitates. Figure 1 The leftmost image shows the dried precipitate. The supernatant containing nanoscale carbon quantum dots was removed and dried at 55°C until a precipitate appeared (approximately 24 hours for 60 ml of reaction solution). Two colors of powder were obtained (the centrifuge tube was tilted during drying, and the dried precipitate adhered to the tube wall). The powder near the top of the centrifuge tube was grayish-white, and the powder near the bottom was cyan. After drying, these powders needed to be scraped into smaller centrifuge tubes for later use. The grayish-white powder (… Figure 1 The rightmost one (referring to carbon quantum dots) has a particle size of less than 10 nm and protects nucleic acids; its electron micrograph and particle size distribution map are shown below. Figure 2 .

[0047] Example 2: Detection of the charge and protective effect of carbon quantum dots, the specific steps are as follows:

[0048] siRNA (100 μM) was mixed with carbon quantum dot solution (30 mg / ml) at volume ratios of 1:1, 1:1.5, and 1:2, and finally 0.1 M NaCl was added to bring the volume to 100 μL. The mixture of CQDs and RNA was sonicated in a water bath at room temperature for 10 min. Then, it was sonicated for 30 min at 50% amplitude (~40 W) using a 3 mm probe tip. The sonicated solution was incubated at room temperature for 30 min and centrifuged at 16100 rpm for 1 h to remove unbound CQDs, obtaining the siRNA-CQDs complex. The siRNA-CQDs complex was co-reacted with ribonuclease at 37 °C for 3 min, and a negative control (a complex without ribonuclease) was added. The complex was detected by 1% agarose gel electrophoresis. Figure 3 The results showed that a 1:1.5 ratio provided the best protection and binding effect, with a mass of approximately 10 ng / μl, indicating that carbon quantum dots are suitable as a nucleic acid delivery platform.

[0049] Material characterization was performed before and after carbon quantum dots were bound to siRNA, with siRNA:CQDs = 1:1.5.

[0050] A ratio of 1:1.2 to 1.8 is acceptable.

[0051]

[0052] Example 3: Nucleic acid delivery platform detection, the specific steps are as follows:

[0053] Two-week-old tobacco plants were used as experimental materials, and healthy, well-developed leaves were selected. siRNA of the GFP gene was mixed with carbon quantum dots in the optimal ratio described in Example 2, and then 0.05% Silwet L-77 surfactant was added and mixed thoroughly. This mixture was then applied to the tobacco leaves, and after 6 hours of internalization, the phenomena were observed under an inverted fluorescence microscope. Figure 4 Compared with the control, the green fluorescence was significantly weakened, indicating that carbon quantum dots can completely deliver siRNA into the cytoplasm and achieve a good RNA silencing effect.

[0054] Example 4: Changing the flower color of petunias. The specific steps are as follows:

[0055] Fully blooming petals were used as experimental material. The siRNA of the CHI gene was mixed with carbon quantum dots in the optimal ratio described in Example 2, and 0.05% Silwet L-77 surfactant was added and mixed thoroughly. The mixture was then pipetted onto the periphery of the petals and applied as a spreader. Figure 5 The flower color changes rapidly within 1 hour, forming a unique flower shape, adding a new variety to the ornamental value of petunias.

[0056] The above embodiments are only used to explain the inventive concept of the present invention, and are not intended to limit the protection of the present invention. Any non-substantial modifications and substitutions made to the relevant details of the present invention using this concept should fall within the protection scope of the present invention.

[0057] CDS region of the CHI gene:

[0058] ATGTCTCCTCCAGTGTCCGTTACTAAAATGCAGGTTGAGAATTACGCTTTCGCACCGACCGTGAACCCTGCTGGTTCCACCAATACCTTGTTCCTTGCTGGTGCTGGGCATAGAGGTCTGGAGATAGAAGGGAAGTTTGTTAAGTTTACGGCGATAGGTGTGTATCTAGAAGAGAGTGCTATTCCTTTTCTGGCCGAAAAATGGAAAGGCAAAACCCCCCAGGAGTTGACTGACTCGGTCGAGTTCTTTAGGGATGTTGTTACAGGTCCATTTGAGAAATTTACTCGAGTTACTATGATCTTGCCCTTGACGGGCAAGCAGTACTCGGAGAAGGTGGCGGAGAATTGTGTTGCGCATTGGAAGGGGATAGGAACGTATACTGATGATGAGGGTCGTGCCATTGAGAAGTTTCTAGATGTTTTCCGGAGTGAAACTTTTCCACCTGGTGCTTCCATCATGTTTACTCAATCACCCCTAGGGTTGTTGACGATTAGCTTCGCTAAAGATGATTCAGTAACTGGCACTGCGAATGCTGTTATAGAGAACAAGCAGTTGTCTGAAGCAGTGCTGGAATCAATAATTGGGAAGCATGGAGTTTCTCCTGCGGCAAAGTGTAGTGTCGCTGAAAGAGTAGCGGAACTGCTCAAAAAGAGCTATGCTGAAGAGGCATCTGTTTTTGGAAAACCGGAGACCGAGAAATCTACTATTCCAGTGATTGGAGTCTAG, see SEQ ID NO.1.

[0059] The siRNA sequence described above is shown in SEQ ID No.2-3.

[0060] siRNA-333

[0061] sense(5'-3')GGUGGCGGAGAAUUGUGUUTT

[0062] antisense(5'-3')AACACAAUUCUCCGCCACCTT.

Claims

1. A method for regulating plant flower color based on a carbon quantum dot gene delivery platform, characterized in that, The siRNA designed and synthesized based on the gene sequence regulating plant flower color synthesis was fully combined with carbon quantum dots, then mixed with surfactant and applied to the plant surface to achieve flower color change; the siRNA was designed and synthesized based on the CDS region of the gene sequence CHI regulating plant flower color synthesis; the siRNA sequence is shown in SEQ ID No. 2-3; Positively charged carbon quantum dots were synthesized using dicyandiamide and sodium citrate as carbon sources via a hydrothermal method. The synthesized carbon quantum dots had a particle size of less than 10 nm and were able to penetrate the cell wall and enter the cell. siRNA and carbon quantum dots were mixed at a volume ratio of 1:1.2-1.8, with 90-110 μM siRNA and 25-35 mg / mL carbon quantum dot solution.

2. The method according to claim 1, characterized in that, Apply directly to the surface of the petals.

3. The method according to claim 1, characterized in that, The surfactant used is 0.05% Silwet L-77.

4. The method according to any one of claims 1-3, characterized in that, The specific process for synthesizing the siRNA-carbon quantum dot complex is as follows: 90-110 μM siRNA is mixed with 25-35 mg / ml carbon quantum dot solution at a volume ratio of 1:1.2-1.8, and finally, 0.08-0.12 M salt solution is added to bring the volume to 100 μL. The mixture is then sonicated in a water bath to disperse the aggregated carbon quantum dots, facilitating the binding of carbon quantum dots and siRNA. The sonicated solution is incubated at room temperature for at least 30 min, and then centrifuged to remove unbound carbon quantum dots, yielding the siRNA-carbon quantum dot complex.

5. The method according to claim 4, characterized in that, The mixture was subjected to ultrasonic oscillation in a water bath, using a 3mm probe tip, with an amplitude of 50% and a power of ~40 W, followed by incubation.

6. A carbon quantum dot gene delivery platform, characterized in that, The product comprises the siRNA, carbon quantum dots, and surfactant designed and synthesized based on the plant flower color synthesis regulatory gene sequence as described in claim 1; the siRNA is designed and synthesized based on the CDS region of the plant flower color synthesis regulatory gene sequence CHI; the siRNA sequence is shown in SEQ ID No. 2-3; Positively charged carbon quantum dots were synthesized using dicyandiamide and sodium citrate as carbon sources via a hydrothermal method. The synthesized carbon quantum dots had a particle size of less than 10 nm and were able to penetrate the cell wall and enter the cell. siRNA and carbon quantum dots were mixed at a volume ratio of 1:1.2-1.8, with 90-110 μM siRNA and 25-35 mg / mL carbon quantum dot solution.

7. The carbon quantum dot gene delivery platform according to claim 6, characterized in that, 0.05% Silwet L-77 was used as a surfactant.

Images