A pseudouridine engineering bacterium and application thereof, and a method for producing pseudouridine

Abstract

The application discloses a pseudo-uridine engineering bacterium, which is obtained by knocking out pyrimidine biosynthesis pathway related genes in a host bacterium by genetic engineering technology, and the host bacterium is Escherichia coli. The pyrimidine biosynthesis pathway related genes knocked out are pepA, thrA and argF genes, and the genes of UDP, psuG and phosphatase are overexpressed. The protein sequence of the UDP gene is SEQ ID No. 55, the protein sequence of the psuG gene is SEQ ID No. 56, SEQ ID No. 57, SEQ ID No. 58 or SEQ ID No. 59, and the protein sequence of the phosphatase gene is SEQ ID No. 54, SEQ ID No. 60, SEQ ID No. 61, SEQ ID No. 62 or SEQ ID No. 63. The strain is knocked out of psuK and psuT genes, and the sequence of the psuK gene is SEQ ID No. 22, and the sequence of the psuT gene is SEQ ID No. 29.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a pseudouridine engineered bacterium and its application, and a method for producing pseudouridine. Background Technology

[0002] Pseudouridine (ψ) is an isomer of uridine, unlike uridine, in which the bases are linked to the ribose sugar via a C-C bond instead of an N-C bond. It is a widely distributed RNA modification in organisms, hence it is also known as the "fifth base." The structural formula of pseudouridine is shown below. Figure 1 As shown.

[0003] Studies have found that pseudouridine is widely present in tRNA, rRNA, mRNA, snRNA, and snoRNA, enhancing RNA stability and improving protein translation efficiency. Pseudouridine is excreted exclusively by the kidneys, making it useful for monitoring tumor development and progression, as well as for diagnosing and treating kidney diseases. Further research has revealed significantly elevated urinary pseudouridine levels in patients with gout and psoriasis. Therefore, pseudouridine can serve as a potential biomarker for the diagnosis and treatment monitoring of various diseases, including kidney disease and tumors. In recent years, the development of nucleic acid drugs, particularly COVID-19 mRNA vaccines, has shown that pseudouridine, when replacing uridine, can increase antigen expression levels and enhance immune responses. Consequently, the potential demand for pseudouridine is growing, and its production methods are attracting widespread attention.

[0004] Currently, there are several methods for producing pseudouridine. One is chemical synthesis. Chemical synthesis involves many reaction steps, has a low yield, and also faces pressure regarding production safety and environmental protection. In 2021, American scientists proposed a semi-enzymatic synthesis method, but the overall yield still needs improvement, and the starting materials are relatively expensive. Patent CN112592880B utilizes E. coli fermentation to produce pseudouridine, but the yield is still not high enough. Patent CN112592880B discloses a method for producing pseudouridine using Streptomyces fermentation, but the yield is low, and Streptomyces grows slowly, preventing commercial production.

[0005] To address the problems in the production of pseudouridine, this invention proposes a green and economical method for producing pseudouridine by constructing a genetically engineered Escherichia coli strain that produces high levels of pseudouridine. Summary of the Invention

[0006] To address the above problems, this invention provides a pseudouridine-producing engineered bacterium:

[0007] A pseudouridine-producing engineered bacterium was obtained by using genetic engineering technology to knock out genes related to the pyrimidine biosynthesis pathway and overexpress genes related to pseudouridine nucleoside synthesis in the host bacteria, thus producing a pseudouridine-producing engineered bacterium.

[0008] Preferably, the knocked-out genes related to the pyrimidine biosynthesis pathway are: pepA, thrA, and argF genes; the pepA gene sequence is SEQ ID No. 1, the thrA gene sequence is SEQ ID No. 8, and the argF gene sequence is SEQ ID No. 15.

[0009] Preferably, the overexpressed pseudouridine nucleoside synthesis-related genes are UDP, psuG, and phosphatase genes, wherein the protein sequence of the UDP gene is SEQ ID No. 55; the protein sequence of the psuG gene is SEQ ID No. 56, SEQ ID No. 57, SEQ ID No. 58, or SEQ ID No. 59; and the protein sequence of the phosphatase gene is SEQ ID No. 54, SEQ ID No. 60, SEQ ID No. 61, SEQ ID No. 62, or SEQ ID No. 63.

[0010] Preferably, the pseudouridine nucleokinase gene psuK was knocked out in the host bacteria using genetic engineering technology. The gene sequence is SEQ ID No. 22.

[0011] Preferably, the psuT gene was knocked out in the host bacteria using genetic engineering technology. The gene sequence is SEQ ID No. 29.

[0012] Application of a genetically engineered bacterium that produces pseudouridine in pseudouridine production.

[0013] A method for producing pseudouridine involves inoculating a single colony of a genetically engineered bacterium producing a pseudouridine nucleoside into a test tube containing LB broth, adding kanamycin sulfate to a final concentration of 50 μg / ml, and incubating overnight at 30°C and 220 rpm. Then, 1% of the culture is inoculated into a shake flask containing 20 ml of fermentation broth, and incubated for four hours at 37°C and 220 rpm. After that, IPTG is added to a final concentration of 50 μg / ml, and the shake flask is then placed in a fermentation culture at 30°C and 220 rpm to produce pseudouridine.

[0014] Preferably, the LB culture medium consists of: 0.5% yeast extract, 1.0% tryptone, and 1.0% sodium chloride. The fermentation medium consists of: 1.0% tryptone, 0.5% yeast extract, 2.0% glycerol, 0.1 mM manganese sulfate, 0.231% KH2PO4, 1.254% K2HPO4, and pH 7.0.

[0015] Another method for producing pseudouridine involves selecting a single colony of the aforementioned genetically engineered bacteria producing pseudouridine and inoculating it into a seed culture medium. The culture is then incubated at 36°C and 250 rpm for 15 hours to obtain a seed solution. One unit volume of the seed solution is then added to the fermentation culture medium at a 10% inoculation rate, resulting in a total culture medium volume of 10 units. The fermentation culture medium formula (g / L) is as follows: glucose 15, KH₂PO₄ 4, yeast extract 6; ammonium sulfate 8, MgSO₄·7H₂O 4; other components (mg / L) in the culture medium are: FeSO₄·7H₂O 150, MnSO₄·7H₂O 20, cobalt chloride 3.5, zinc sulfate 3.5, calcium chloride 8. Additionally, 50 mg / L of kanamycin is added to the culture medium.

[0016] Preferably, during fermentation, the pH of the culture medium is adjusted to 7.0 using ammonia water containing 13 mol / L ammonia, the fermentation temperature is maintained at 37℃ for 0-3 hours, IPTG is added at the 3rd hour of fermentation to a final concentration of 50 μg / ml, and the fermentation temperature is adjusted to 30℃. Glucose is fed in at a final concentration of about 0.1%, the aeration is set to 1.0 vvm during fermentation, and the dissolved oxygen is controlled at 30%-40% by linking the stirring speed and dissolved oxygen. The fermentation cycle is 72 hours.

[0017] Explanation of the principle:

[0018] 1. Modify the pyrimidine biosynthetic pathway

[0019] Aspartic acid and Carbamoyl-P are precursors for pyrimidine biosynthesis, and they are synthesized from thrA and argF, respectively, into 4-phosphate aspartic acid and citrulline. Therefore, knocking out thrA and argF can increase the metabolic flux for pyrimidine synthesis and increase the yield of uracil, the precursor for pseudouridine. During pyrimidine biosynthesis, the carAB gene is negatively regulated by pepA and is subject to pyrimidine feedback inhibition. Therefore, knocking out pepA can relieve this feedback inhibition. Overexpression of the udp gene, the final step in pyrimidine biosynthesis, increases the efficiency of uracil synthesis and reduces uridine accumulation.

[0020] 2. Synthesis of pseudouridine (Ψ) catalyzed by uracil and ribose 5-phosphate as substrates.

[0021] The ΨMP glycosidase gene (psuG) is ubiquitous in prokaryotes, catalyzing the synthesis of ΨMP from uracil and ribose-5-phosphate. Some eukaryotes also possess genes with ΨMP glycosidase activity, but these are often bifunctional genes, frequently also exhibiting ΨMP kinase activity. Overexpression of psuG and the phosphorylase gene in *Escherichia coli* ultimately leads to the production of pseudouridine.

[0022] 3. Blocking the metabolic degradation pathway of pseudouridine

[0023] psuG exhibits bidirectional catalytic activity; it can catalyze both the synthesis of pseudouridine monophosphate and the degradation of pseudouridine monophosphate into ribose-5-phosphate and uracil. psuK, on ​​the other hand, possesses pseudouridine kinase activity, enabling the phosphorylation of pseudouridine, which is then degraded under the catalysis of psuG. Therefore, knocking out psuK is beneficial in reducing the degradation of pseudouridine.

[0024] 4. Blocking the transport of pseudouridine into cells

[0025] psuT possesses pseudouridine transport capabilities, enabling the uptake of extracellular pseudouridine. Knockout of psuT promotes the extracellular accumulation of pseudouridine.

[0026] Beneficial effects: Compared with existing methods for producing pseudouridine, firstly, the existing fermentation methods yield only 7 g / L, while this method can achieve a yield of up to 11.6 g / L, significantly increasing output and reducing costs; secondly, other existing production methods generally rely on chemical synthesis, which requires high temperature control, involves many chemical steps and reagents, and is highly hazardous and polluting, while this method directly uses fermentation tanks, simplifying the fermentation process and facilitating large-scale production; finally, the raw materials used in this method do not contain any environmentally harmful chemicals, resulting in less environmental impact and contributing to environmental protection. Attached Figure Description

[0027] Figure 1 This is the structural diagram of pseudouridine. Detailed Implementation

[0028] Existing microorganisms can all produce pseudouridine according to the present invention, such as Escherichia coli and Bacillus. The applicant has conducted detailed research on various strains. Since Escherichia coli has a high degree of application, the following examples use Escherichia coli strain as an example, specifically Escherichia coli MG1665.

[0029] Example 1: Knockout of pepA in E. coli

[0030] Gene knockout was performed using the method described in the literature (Yu Jiang, Multigene editing in the Escherichia coligenome via the CRISPR-Cas9 system, Appl Environ Microbiol. 2015, 81(7):2506-14). The gene sequence of pepA is shown in SEQ ID No. 1. Primers pepF1 and pepR1 amplified the upstream homologous fragment; pepF2 and pepR2 amplified the downstream homologous fragment; using the upstream and downstream homologous fragments as templates, primers pepF1 and pepR2 amplified the upstream and downstream fusion homologous fragments used for gene knockout. The resulting knockout strain was numbered ΔpepA. Primers pep20F and pep20R amplified the gRNA plasmid. The sequences of the primers are as follows:

[0031] SEQ ID No2: pepF1:cacgaagtcatcgcaaca

[0032] SEQ ID No3: pepR1:agttgttcctgatactcgtgacgcactttccagtag

[0033] SEQ ID No4: pepF2:ctactggaaagtgcgtcacgagtatcaggaacaact

[0034] SEQ ID No5: pepR2:cttcacaggcgatgagca

[0035] SEQ ID No6: pep20F:gagatgaagtacgatatgtggttttagagctagaaatagc

[0036] SEQ ID No7: pep20R:cacatatcgtacttcatctcACTAGTATTATACCTAGGAC

[0037] Example 2: Knockout of thrA in E. coli

[0038] Gene knockout was performed using the method described in the literature (Yu Jiang, Multigene editing in the Escherichia coligenome via the CRISPR-Cas9 system, Appl Environ Microbiol. 2015, 81(7):2506-14). The gene sequence of thrA is shown in SEQ ID No. 8. Primers thrF1 and thrR1 amplified the upstream homologous fragment; thrF2 and thrR2 amplified the downstream homologous fragment; using the upstream and downstream homologous fragments as templates, primers thrF1 and thrR2 amplified the upstream and downstream fusion homologous fragments used for gene knockout. The strain after knocking out thrA based on strain ΔpepA was numbered ΔpepAΔthrA. Primers thr20F and thr20R amplified the gRNA plasmid. The sequences of the primers are as follows:

[0039] SEQ ID No9: thrF1:gttcggcggtacatcagt

[0040] SEQ ID No10: thrR1:ttgctgacgcttcagttgcaatatcgacggtagatt

[0041] SEQ ID No11: thrF2:aatctaccgtcgatattgcaactgaagcgtcagcaa

[0042] SEQ ID No12: thrR2:ctcatgccttcgtctaac

[0043] SEQ ID No13: thr20F:ggaacggctggccattatctgttttagagctagaaatagc

[0044] SEQ ID No14: thr20R:agataatggccagccgttccactagtattatacctaggac

[0045] Example 3: Knockout of argF in E. coli

[0046] Gene knockout was performed using the method described in the literature (Yu Jiang, Multigene editing in the Escherichia coligenome via the CRISPR-Cas9 system, Appl Environ Microbiol. 2015, 81(7):2506-14). The gene sequence of argF is shown in SEQ ID No. 15. Primers argF1 and argR1 amplified the upstream homologous fragment; argF2 and argR2 amplified the downstream homologous fragment; using the upstream and downstream homologous fragments as templates, primers argF1 and argR2 amplified the upstream and downstream fusion homologous fragments used for gene knockout. The strain after knocking out argF based on strain ΔpepAΔthrA was numbered ΔpepAΔthrAΔargF. Primers arg20F and arg20R amplified the gRNA plasmid. The sequences of the primers are as follows:

[0047] SEQ ID No16: argF1:gtggagcagcatgacaaag

[0048] SEQ ID No17: argR1:gtcggtatagataaagtcagcagagaagtgaactgt

[0049] SEQ ID No18: argF2:acagttcacttctctgctgactttatctataccgac

[0050] SEQ ID No19: argR2:gaggatctgcaacgcacg

[0051] SEQ ID No20: arg20F:tatgacggcattcagtatcggttttagagctagaaatagc

[0052] SEQ ID No21: arg20R:cgatactgaatgccgtcataactagtattatacctaggac

[0053] Example 4: Knockout of psuK in Escherichia coli

[0054] Gene knockout was performed using the method described in the literature (Yu Jiang, Multigene editing in the Escherichia coligenome via the CRISPR-Cas9 system, Appl Environ Microbiol. 2015, 81(7):2506-14). The gene sequence of psuK is shown in SEQ ID No. 22. Primers psuF1 and psuR1 amplified the upstream homologous fragment; psuF2 and psuR2 amplified the downstream homologous fragment; using the upstream and downstream homologous fragments as templates, primers psuF1 and psuR2 amplified the upstream and downstream fusion homologous fragments used for gene knockout. The strain after knocking out psuK based on strain ΔpepAΔthrAΔargF was numbered ΔpepAΔthrAΔargFΔpsuK. Primers psu20F and psu20R amplified the gRNA plasmid. The sequences of the primers are as follows:

[0055] SEQ ID No23: psuF1: gcctgctcaaatctgcccat

[0056] SEQ ID No24: psuR1:acgttggcaatcgataaaatcgacataaacgccaga

[0057] SEQ ID No25: psuF2:tctggcgtttatgtcgattttatcgattgccaacgt

[0058] SEQ ID No26: psuR2:gcgatgcacaccaccaat

[0059] SEQ ID No27: psu20F:accaatgttattaatgttacgttttagagctagaaatagc

[0060] SEQ ID No28: psu20R:gtaacattaataacattggtactagtattatacctaggac

[0061] Example 5: Knocking out psuT in E. coli

[0062] Gene knockout was performed using the method described in the literature (Yu Jiang, Multigene editing in the Escherichia coligenome via the CRISPR-Cas9 system, Appl Environ Microbiol. 2015, 81(7):2506-14). The psuT gene sequence is shown in SEQ ID No. 29. Primers psuTF1 and psuTR1 amplified the upstream homologous fragment; psuTF2 and psuTR2 amplified the downstream homologous fragment; using the upstream and downstream homologous fragments as templates, primers psuTF1 and psuTR2 amplified the upstream and downstream fusion homologous fragments used for gene knockout. The strain after knocking out psuT based on strain ΔpepAΔthrAΔargFΔpsuK was numbered ΔpepAΔthrAΔargFΔpsuKΔpsuT. Primers psuT20F and psuT20R amplified the gRNA plasmid. The primer sequences are as follows:

[0063] SEQ ID No30: psuTF1:gaaattgcccgtgcaatg

[0064] SEQ ID No31: psuTR1:tcatcatcgaaccagcaatgggaagtagagcatgat

[0065] SEQ ID No32: psuTF2:atcatgctctacttcccattgctggttcgatgatga

[0066] SEQ ID No33: psuTR2:ctcaggtaagcgacgaat

[0067] SEQ ID No34: psuT20F:gtgatgtcttacagtgatgcgttttagagctagaaatagc

[0068] SEQ ID No35: psuT20R:gcatcactgtaagacatcacactagtattatacctaggac

[0069] Example 6: Overexpression of phoA in Escherichia coli

[0070] The phoA gene (gene sequence shown in SEQ ID No. 36, protein sequence shown in SEQ ID No. 54) was amplified using primers phoAF and phoAR, and recovered using a Shanghai Sangon Biotech gel extraction kit after electrophoresis. The recovered fragment was double-digested with NdeI and BglII, and then cloned into the NdeI and BglII restriction sites of pET-30a(+). The cloned plasmid was named pET30phoA. The primer sequences are as follows:

[0071] SEQ ID No37: phoAF:atccatatgaaacaaagcactattg

[0072] SEQ ID No38: phoAR:acaagatctttttatttcagccccaga

[0073] Example 7: Simultaneous overexpression of phoA and udp in Escherichia coli

[0074] The udp gene (gene sequence shown in SEQ ID No. 39, protein sequence shown in SEQ ID No. 55) was amplified using primers udpF and udpR, and recovered using a Shanghai Sangon Biotech gel extraction kit after electrophoresis. The recovered fragment was double-digested with BglII and HindIII, and then cloned into the HindIII and BglII restriction sites of pET30phoA. The cloned plasmid was named pET30phoAUDP. Primer sequences are as follows:

[0075] SEQ ID No40: udpF:acaagatctaaaggaggatatacatatgtccaagtctgatgtt

[0076] SEQ ID No41: udpR:agaaagcttgaagagaattacagcaga

[0077] Example 8: Overexpression of psuG in Escherichia coli

[0078] The psuG gene from *E. coli* (gene sequence shown in SEQ ID No. 42, protein sequence shown in SEQ ID No. 56) was amplified using primers psuGF and psuGR, and recovered using a Shanghai Sangon Biotech gel extraction kit after electrophoresis. The recovered fragment was double-digested with NdeI and BglII, and then cloned into the NdeI and BglII restriction sites of pET-30a(+). The cloned plasmid was named pET30psuG. Primer sequences are as follows:

[0079] SEQ ID No43: psuGF:gtgcatatgtctgaattaaaaatttc

[0080] SEQ ID No44: psuGR:ataagatctctgcccgtcagaaattaa

[0081] Example 9: Overexpression of psuG in Escherichia coli

[0082] The psuG gene (gene sequence shown in SEQ ID No. 45, protein sequence shown in SEQ ID No. 57) derived from Klebsiella spallanzanii was synthesized by Nanjing Genscript Biotech Co., Ltd. and cloned into the NdeI and BglII restriction sites of pET-30a(+). The cloned plasmid was named pET30psuG45.

[0083] Example 10: Overexpression of psuG in Escherichia coli

[0084] The psuG gene (gene sequence shown in SEQ ID No. 46, protein sequence shown in SEQ ID No. 58) derived from *Streptomyces platensis* was synthesized by Nanjing Genscript Biotech Co., Ltd. and cloned into the NdeI and BglII restriction sites of pET-30a(+). The cloned plasmid was named pET30psuG46.

[0085] Example 11: Overexpression of psuG in Escherichia coli

[0086] The psuG gene (gene sequence shown in SEQ ID No. 47, protein sequence shown in SEQ ID No. 59) derived from Rhizobium sp. CF142 was synthesized by Nanjing Genscript Biotech Co., Ltd. and cloned into the NdeI and BglII restriction sites of pET-30a(+). The cloned plasmid was named pET30psuG47.

[0087] Example 12: Simultaneous overexpression of phoA, udp, and psuG in Escherichia coli

[0088] Using pET30phoAUDP as a template, the phoAUDP gene was amplified with primers phoAF4 and udpR2, and recovered using a Shanghai Sangon Biotech gel extraction kit after electrophoresis. pET30psuG was double-digested with EcoRV and XhoI, and recovered using a kit after electrophoresis. Both recovered fragments were then used for recombinant cloning using a plasmid cloning and recombination kit from a biotechnology company. The recombinant plasmid was named pET30psuGphoAUDP and then transformed into *E. coli* MG1665, strain ΔpepAΔthrAΔargF (Example 3), strain ΔpepAΔthrAΔargFΔpsuK (Example 4), and strain ΔpepAΔthrAΔargFΔpsuKΔpsuT (Example 5), respectively. The transformed strains were numbered as follows: MG1665-pET30psuGphoAUDP, ΔpepAΔthrAΔargF-pET30psuGphoAUDP, ΔpepAΔthrAΔargFΔpsuK-pET30psuGphoAUDP, and ΔpepAΔthrAΔargFΔpsuKΔpsuT-pET30psuGphoAUDP. The primer sequences are as follows:

[0089] SEQ ID No48 phoAF4:tgaagatctgggtacttttgtttaactttaaga

[0090] SEQ ID No49 udpR2:cagccggatctcagtgaagagaattacagcaga

[0091] Example 13 Overexpression of pumD in Escherichia coli

[0092] The pumD gene (gene sequence shown in SEQ ID No. 50, protein sequence shown in SEQ ID No. 60) was synthesized by Nanjing Genscript Biotech Co., Ltd. and cloned into the NdeI and BglII restriction sites of pET-30a(+). The cloned plasmid was named pET30pumD.

[0093] Example 14: Overexpression of PHM8 in Escherichia coli

[0094] The PHM8 gene (gene sequence shown in SEQ ID No. 51, protein sequence shown in SEQ ID No. 61) was synthesized by Nanjing Genscript Biotech Co., Ltd. and cloned into the NdeI and BglII restriction sites of pET-30a(+). The cloned plasmid was named pET30PHM8.

[0095] Example 15: Overexpression of SDT1 in Escherichia coli

[0096] The SDT1 gene (gene sequence shown in SEQ ID No. 52, protein sequence shown in SEQ ID No. 62) was synthesized by Nanjing Genscript Biotech Co., Ltd. and cloned into the NdeI and BglII restriction sites of pET-30a(+). The cloned plasmid was named pET30SDT1.

[0097] Example 16: Overexpression of YKL033W-A in Escherichia coli

[0098] The YKL033W-A gene (gene sequence shown in SEQ ID No. 53, protein sequence shown in SEQ ID No. 63) was synthesized by Nanjing Genscript Biotech Co., Ltd. and cloned into the NdeI and BglII restriction sites of pET-30a(+). The cloned plasmid was named pET30YKL033W-A.

[0099] Example 17: Simultaneous overexpression of SDT1 and udp in Escherichia coli

[0100] The udp gene (SEQ ID No. 39) was amplified using primers SEQ ID No. 40 and SEQ ID No. 41, and recovered using a Shanghai Sangon Biotech gel extraction kit after electrophoresis. The recovered fragment was double-digested with BglII and HindIII, and then cloned into the HindIII and BglII restriction sites of pET30SDT1. The cloned plasmid was named pET30SDT1UDP.

[0101] Example 18: Simultaneous overexpression of SDT1, udp, and psuG in Escherichia coli

[0102] Using pET30SDT1UDP as a template, the SDT1 and udp genes were amplified with primers SEQ ID No. 48 and SEQ ID No. 49, and recovered using a Shanghai Sangon Biotech gel recovery kit after electrophoresis. pET30psuG46 was double-digested with EcoRV and XhoI, and recovered using a kit after electrophoresis. Both recovered fragments were then recombinantly cloned using a plasmid cloning and recombination kit from Tulugang Biotechnology Co., Ltd. The recombinant plasmid was named pET30psuG46SDT1UDP. After transforming plasmid pET30psuG46SDT1UDP into the strain ΔpepAΔthrAΔargFΔpsuKΔpsuT from Example 5, the transformed strain was numbered ΔpepAΔthrAΔargFΔpsuKΔpsuT-pET30psuG46SDT1UDP.

[0103] Example 19: The HPLC method for detecting pseudouridine in fermentation broth is as follows:

[0104] After 24 hours of fermentation, 1 ml of the fermentation broth was taken, centrifuged at 12000 rpm for 10 minutes, and the supernatant was filtered. The filtrate was then analyzed by HPLC. The detection method was as follows: mobile phase: 0.2% ammonium acetate: acetonitrile = 95:5, detection wavelength: 260 nm, Waters XBridgeAmide C18 (250 mm × 460 mm) column temperature: 30 ℃, flow rate: 1 ml / min, detection time: 15 min, injection volume: 10 μl.

[0105] Example 20: Shake-flask fermentation experiment of genetically engineered bacteria is as follows:

[0106] Single colonies of the strains from Example 12 (MG1665-pET30psuGphoAUDP, ΔpepAΔthrAΔargF-pET30psuGphoAUDP, ΔpepAΔthrAΔargFΔpsuK-pET30psuGphoAUDP, ΔpepAΔthrAΔargFΔpsuKΔpsuT-pET30psuGphoAUDP) and the strain from Example 18 (ΔpepAΔthrAΔargFΔpsuKΔpsuT-pET30psuG46SDT1UDP) were picked and inoculated into test tubes containing LB broth. Kanamycin sulfate was added to the broth to a final concentration of 50 μg / ml, and the mixture was incubated overnight at 30°C and 220 rpm. Then, 1% of the yeast extract was inoculated into a shake flask containing 20 ml of fermentation broth. After incubation at 37°C and 220 rpm for four hours, IPTG was added to a final concentration of 50 μg / ml. The shake flask was then incubated at 30°C and 220 rpm for further fermentation. The LB broth composition was: 0.5% yeast extract, 1.0% tryptone, and 1.0% sodium chloride. The fermentation medium composition was: 1.0% tryptone, 0.5% yeast extract, 2.0% glycerol, 0.1 mM manganese sulfate, 0.231% KH₂PO₄, 1.254% K₂HPO₄, pH 7.0. The results showed that the pseudouridine production of these strains was as follows:

[0107] Control group: MG1665-pET30psuGphoAUDP: 16.5μg / ml;

[0108] Experimental group 1: ΔpepAΔthrAΔargF-pET30psuGphoAUDP: 48.4μg / ml;

[0109] Experimental group 2: ΔpepAΔthrAΔargFΔpsuK-pET30psuGphoAUDP: 56.7μg / ml;

[0110] Experimental group 3: ΔpepAΔthrAΔargFΔpsuKΔpsuT-pET30psuGphoAUDP: 78.3 μg / ml; Experimental group 4: ΔpepAΔthrAΔargFΔpsuKΔpsuT-pET30psuG46SDT1UDP: 1073.6 μg / ml

[0111] Comparison of yields between the experimental and control groups (average of multiple groups) shows that, under the same conditions, knocking out genes pepA, thrA, and argF significantly increases yield. Comparison between the control and experimental groups 1-3 shows that, under the same conditions, knocking out genes psuK and psuT further increases yield. Comparison between experimental groups 3 and 4 shows that different phosphatase genes also increase yield.

[0112] Example 21: Fermentation of genetically engineered bacteria in a fermenter

[0113] In Example 18, a single colony of the bacteria was picked and inoculated into a seed culture medium. The culture was then incubated at 36°C and 250 rpm for 15 hours to obtain a seed culture. 1 L of the seed culture was then added to the fermentation medium at a 10% inoculation rate, resulting in a total culture medium volume of 10 L. The fermentation culture medium formulation (g / L) was as follows: glucose 15, KH₂PO₄ 4, yeast extract 6, ammonium sulfate 8, MgSO₄·7H₂O 4; other components (mg / L) were: FeSO₄·7H₂O 150, MnSO₄·7H₂O 20, cobalt chloride 3.5, zinc sulfate 3.5, calcium chloride 8, and kanamycin 50 mg / L was added to the medium. During fermentation, the pH of the culture medium was adjusted to 7.0 using ammonia water containing 13 mol / L ammonia. The fermentation temperature was maintained at 37℃ from 0 to 3 hours. At the 3rd hour of fermentation, IPTG was added to a final concentration of 50 μg / ml, and the fermentation temperature was adjusted to 30℃. Glucose was fed in continuously to maintain a final concentration of approximately 0.1%. Aeration was set at 1.0 vvm, and dissolved oxygen was controlled at 30%-40% by linking stirring speed and dissolved oxygen levels. The fermentation cycle was 72 hours. HPLC analysis of the fermentation broth showed that the final pseudouridine yield reached 11.6 g / L.

[0114] Obviously, the above embodiments of the present invention are merely illustrative examples and not intended to limit the implementation of the invention. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. However, these obvious variations or modifications derived from the essential spirit of the present invention still fall within the scope of protection of the present invention.

[0115] SEQ ID No. 1pepA gene sequence

[0116] Atggagttta gtgtaaaaag cggtagcccg gagaaacagc ggagtgcctg catcgtcgtgggcgtcttcg aaccacgtcg cctttctccg attgcagaac agctcgataa aatcagcgat gggtacatcagcgccctgct acgtcggggc gaactggaag gaaaaccggg gcagacattg ttgctgcacc atgttccgaatgtactttcc gagcgaattc tccttatgg ttgcggcaaa gaacgtgagc tggatgagcg tcagtacaagcaggttatc agaaaaccat taatacgctg aatgatactg gctcaatgga agcggtctgc tttctgactgagctgcacgt taaaggccgt aacaactact ggaaagtgcg tcaggctgtc gagacggcaa aagagacgctctacagtttc gatcagctga aaacgaacaa gagcgaaccg cgtcgtccg tgcgtaagat ggtgttcaacgtgccgaccc gccgtgaact gaccagcggt gagcgcgcga tccagcacgg tctggcgatt gccgccgggattaaagcagc aaaagatctc ggcaatatgc cgccgaatat ctgtaacgcc gcttacctcg cttcacaagcgcgccagctg gctgacagct acagcaagaa tgtcatcacc cgcgttatcg gcgaacagca gatgaaagagctgggggatgc attcctatct ggcggtcggt cagggttcgc aaaacgaatc gctgatgtcg gtgattgagtacaaaggcaa cgcgtcggaa gatgcacgcc caatcgtgct ggtgggtaaaa ggtttaacct tcgactccggcggtatctcg atcaagcctt cagaaggcat ggatgagatg aagtacgata tgtgcggtgc ggcagcggtttacggcgtga tgcggatggtcgcggagcta caactgccga ttaacgttat cggcgtgttg gcaggctgcgaaaacatgcc tggcggacga gcctatcgtc cgggcgatgt gttaaccacc atgtccggtc aaaccgttgaagtgctgaac accgacgctg aaggccgcct ggtactgtgc gacgtgttaa cttacgttga gcgttttgagccggaagcgg tgattgacgt ggcgacgctg accggtgcct gcgtgatcgc gctgggtcat catattactggtctgatggc gaaccataat ccgctggccc atgaactgat tgccgcgtct gaacaatccg gtgaccgcgcatggcgctta ccgctgggtg acgagtatca ggaacaactg gagtccaatt ttgccgatat ggcgaacattggcggtcgtc ctggtggggc gattaccgca ggttgcttcc tgtcacgctt tacccgtaag tacaactgggcgcacctgga tatcgccggt accgcctggc gttctggtaa agcaaaaggc gccaccggtc gtccggtagcgttgctggca cagttcctgt taaaccgcgc tgggtttaac ggcgaagagt aa

[0117] SEQ ID No 8 thrA gene sequence

[0118] atgcgagtgt tgaagttcgg cggtacatca gtggcaaatg cagaacgttt tctgcgtgttgccgatattc tggaaagcaa tgccaggcag gggcaggtgg ccaccgtcct ctctgccccc gccaaaatcaccaaccacct ggtggcgatg attgaaaaaa ccattagcgg ccaggatgct ttacccaata tcagcgatgccgaacgtatt tttgccgaac ttttgacggg actcgccgcc gcccagccgg ggttcccgct ggcgcaattgaaaactttcg tcgatcagga atttgcccaa ataaaacatg tcctgcatgg cattagtttg ttggggcagtgcccggatag catcaacgct gcgctgattt gccgtggcga gaaaatgtcg atcgccatta tggccggcgtattagaagcg cgcggtcaca acgttactgt tatcgatccg gtcgaaaaac tgctggcagt ggggcattacctcgaatcta ccgtcgatat tgctgagtcc acccgccgta ttgcggcaag ccgcattccg gctgatcacatggtgctgat ggcaggtttc accgccggta atgaaaaagg cgaactggtg gtgcttggac gcaacggttccgactactct gctgcggtgc tggctgcctg tttacgcgcc gattgttgcg agatttggac ggacgttgacggggtctata cctgcgaccc gcgtcaggtg cccgatgcga ggttgttgaa gtcgatgtcc taccaggaagcgatggagct ttcctacttc ggcgctaaag ttcttcaccc ccgcaccatt acccccatcg cccagttccagatcccttgc ctgattaaaa ataccggaaa tcctcaagca ccaggtacgc tcattggtgc cagccgtgatgaagacgaat taccggtcaagggcatttcc aatctgaata acatggcaat gttcagcgtt tctggtccggggatgaaagg gatggtcggc atggcggcgc gcgtctttgc agcgatgtca cgcgcccgta tttccgtggtgctgattacg caatcatctt ccgaatacag catcagtttc tgcgttccac aaagcgactg tgtgcgagctgaacgggcaa tgcaggaaga gttctacctg gaactgaaag aaggcttact ggagccgctg gcagtgacggaacggctggc cattatctcg gtggtaggtg atggtatgcg caccttgcgt gggatctcgg cgaaattctttgccgcactg gcccgcgcca atatcaacat tgtcgccatt gctcagggat cttctgaacg ctcaatctctgtcgtggtaa ataacgatga tgcgaccact ggcgtgcgcg ttactcatca gatgctgttc aataccgatcaggttatcga agtgtttgtg attggcgtcg gtggcgttgg cggtgcgctg ctggagcaac tgaagcgtcagcaaagctgg ctgaagaata aacatatcga cttacgtgtc tgcggtgttg ccaactcgaa ggctctgctcaccaatgtac atggccttaa tctggaaaac tggcaggaag aactggcgca agccaaagag ccgtttaatctcgggcgctt aattcgcctc gtgaaagaat atcatctgct gaacccggtc attgttgact gcacttccagccaggcagtg gcggatcaat atgccgactt cctgcgcgaa ggtttccacg ttgtcacgcc gaacaaaaaggccaacacct cgtcgatgga ttactaccat cagttgcgtt atgcggcgga aaaatcgcgg cgtaaattcctctatgacac caacgttggg gctggattaccggttattga gaacctgcaa aatctgctca atgcaggtgatgaattgatg aagttctccg gcattctttc tggttcgctt tcttatatct tcggcaagtt agacgaaggcatgagtttct ccgaggcgac cacgctggcg cgggaaatgg gttataccga accggacccg cgagatgatctttctggtat ggatgtggcg cgtaaactat tgattctcgc tcgtgaaacg ggacgtgaac tggagctggcggatattgaa attgaacctg tgctgcccgc agagtttaac gccgagggtg atgttgccgc ttttatggcgaatctgtcac aactcgacga tctctttgcc gcgcgcgtgg cgaaggcccg tgatgaagga aaagttttgcgctatgttgg caatattgat gaagatggcg tctgccgcgt gaagattgcc gaagtggatg gtaatgatccgctgttcaaa gtgaaaaatg gcgaaaacgc cctggccttc tatagccact attatcagcc gctgccgttggtactgcgcg gatatggtgc gggcaatgac gttacagctg ccggtgtctt tgctgatctg ctacgtaccctctcatggaa gttaggagtc tga

[0119] SEQ ID No 15 argF gene sequence

[0120] atgtccgatt tatacaaaaa acactttctg aaactgctcg actttacccc tgcacagttcacttctctgc tgacccttgc cgcacagctc aaagccgata aaaaaatgg caaggaagta cagaagcttaccggtaaaaa catcgcgctc atcttcgaaa aagactcgac tcgtacccgt tgctctttcg aagttgccgcatttgaccag ggcgcgcgcgc ttacctatt aggccgagc ggcagccaga ttgggcataa agagtcaattaaggacaccg cgcgggttct cgggcggatg tatgacggca ttcagttc cggtcacgg cagggaagtggtcgaaacgct ggcgcagtat gcggcgtgc cggtgtggaa cggggctgacc aacgagttcc acccgacccagctgctggcg gacctgatga ccatgcagga gcacctgccg ggcaaggcgt ttaacgagat gacgctggtctacgcggcg atgcgcgcaa caacatggc aactcgatgc tggaagcgg ggcgctgacc gggctggatctgcgcctgtt ggccccgaaa gcctgctggc cggagagag cctggtggcg gagtgcagcg cgctggcggagaagcacgg gggaaaatta ctctgacgga agacgtggcg gcaggcgtta agggcgcgga ctttatctataccgacgtgt gggtgtcgat gggcgaggcc aaagagaagt gggcagagcg gattgcgctg ctgcgcgggtatcaggtgaa cgcgcagatg atggcgctga ccgacaaccc gaacgtgaag ttcctgcact gtctgccggcgttccatgac gaccagacta cgctcggcaa gcagatggcg aaggagttcg atctgcacgg cgggatggaggtgacggacg aggtgtttgagtcggcggcg agcatcgtgt tcgaccaggc ggaaaaccgg atgcatacgattaaggcggt gatgatggca acgcttgggg agtga

[0121] SEQ ID No22psuK clone

[0122] atgcgcgaaa aggattatgt cgtaattata ggttcggcga atattgatgt cgccggatattcacatgaat cattaaatta tgcggattca aatccaggta aaataaaatt tacgcctggt ggagtagggcgcaatattgc acaaaacctg gcgttgctgg gtaacaaagc ctggctactg agcgccgtag gcagtgatttttatggtcaa tcgctgctaa cgcaaaccaa tcaatctggc gtttatgtcg ataaatgcct gattgtgccgggagaaaata cgtcgagtta tttatcatta ctcgataata ccggtgaaat gctggttgct ataaatgacatgaatattag caacgctatt acagctgaat atctcgcaca gcacggtgaa tttattcaga gggcaaaggtcattgtcgcg gactgtaata tcagtgaaga ggcactggca tggattctgg ataatgccgc caacgtacccgtatttgtcg atccggtttc ggcatggaaa tgtgtcaaag tgcgcgaccg tctaaatcag atccacactctcaagccaaa ccgccttgaa gcggaaaccc tgagtgggat tgcgctgtca gggcgtgaag atgtggcaaaagttgctgcc tggttccatc aacatggcct gaaccgactg gtattgagca tgggcggcga cggcgtttatcagcgata tcagcggtga aagtggctgg tctgcgccga tcaaaaccaa tgttattaat gttaccggagcgggcgatgc catgatggcg ggacttgctt cgtgttgggt agacggaatg ccgtttgccg aatctgttcgtttcgcacag ggatgttcgt caatggcgct ctcctgtgaa tacaccaata accccgattt atcgattgccaacgtttat cgtttagtggagaacgcagaa tgtctgaatt aa

[0123] SEQ ID No. 29psuT gene sequence

[0124] atggatataa tgagaagtgt tgtggggatg gtggtgttac tggcaatagc atttctgttgtcagtgaata aaaagagcat cagtttgcgc acggttggag ccgcactgct gctgcaaatc gctattggtggcatcatgct ctacttccca ccgggaaaat gggcagtaga acaggcggca ttaggcgttc ataaagtgatgtcttacagt gatgccggta gcgccttcat ttttggttcg ctggttgggc cgaaaatgga tgtcctgtttgacggtgcgg gttttatctt cgccttttcgc gtacttccgg cgattatttt cgttactgcg ctcatcagtctgctgtacta cattggcgtg atggggctgc tgattcgcat ccttggcagc attttccaga aagccctcaacatcagcaaa atcgaatctt ttgttgcggt tactactatt ttcctcgggc aaaatgagat cccggcgatcgttaaaccgt ttatcgatcg catgaatcgc aacgagttgt ttaccgcaat ttgtagcggg atggcgtccattgctggttc gatgatgatt ggttatgccg gaatgggcgt accaattgac tacctgttag cggcatcgctgatggcgatc cctggcggga ttttgtttgc acgtattctt agcccggcaa ccgagccttc gcaggtcacatttgaaaatc tgtcgttcag cgaaacgccg ccaaaaagct ttatcgaagc ggcggcgagc ggtgcgatgaccgggctaaa aatcgccgct ggtgtggcga cggtggtaat ggcgtttgtc gcaattattg cgctgatcaacggcattatc ggcggaattg gcggctggtt tggtttcgcc aatgcctctc tggaaagtat ttttggctatgtgctggcac cgctggcgtggatcatgggt gtggactgga gtgatgccaa tcttgcgggt agcctgattgggcagaaact ggcgattaac gaattcgtcg cttacctgag tttctcccca tacctgcaaa cgggcggcacgctggaagtg aaaaccattg cgattatctc ctttgcgctt tgtggttttg ctaactttgg ttctatcggtgttgtcgttg gcgcattttc ggctatttcg ccaaaacgcg cgccggaaat cgcccagctt ggtttacgggcgctggcagc agcaacgctt tccaacctga tgagtgcgac tattgccggg ttctttattg gtctggcgtaa

[0125] SEQ ID No 36 phoA gene sequence

[0126] gtgaaacaaa gcactattgc actggcactc ttaccgttac tgtttacccc tgtgacaaaagcccggacac cagaaatgcc tgttctggaa aaccgggctg ctcagggcga tattactgca cccggcggtgctcgccgttt aacgggtgat cagactgccg ctctgcgtga ttctcttagc gataaacctg caaaaaatattattttgctg attggcgatg ggatggggga ctcggaatt actgccgcac gtaattatgc cgaaggtgcggggcggctttt ttaaaggtat agatgcctta ccgcttaccg ggcaatacac tcactatgcg ctgaataaaaaaccggcaa accggactac gtcaccgact cggctgcatc agcaaccgcc tggtcaaccg gtgtcaaaacctataacggc gcgctgggcg tcgatattca cgaaaaagat cacccaacga ttctggaaat ggcaaaagccgcaggtctgg cgaccggtaa cgtttctacc gcagagttgc aggatgccac gcccgctgcg ctggtggcacatgtgacctc gcgcaaatgc tacggtccga gcgcgaccag tgaaaaatgt ccgggtaacg ctctggaaaaaggcggaaaa ggatcgatta ccgaacagct gcttaacgct cgtgccgacg ttacgcttgg cggcggcgcaaaaacctttg ctgaaacggc aaccgctggt gaatggcagg gaaaaacgct gcgtgaacag gcacaggcgcgtggttatca gttggtgagc gatgctgcct cactgaattc ggtgacgga gcgaatcagc aaaaacccctgcttggcctg tttgctgacg gcaatatgcc agtgcgctgg ctaggaccga aagcaacgta ccatggcaatatcgataagc ccgcagtcacctgtacgcca aatccgcaac gtaatgacag tgtaccaacc ctggcgcagatgaccgacaa agccattgaa ttgttgagta aaaatgagaa aggctttttc ctgcaagttg aaggtgcgtcaatcgataaa caggatcatg ctgcgaatcc ttgtgggcaa attggcgaga cggtcgatct cgatgaagccgtacaacggg cgctggaatt cgctaaaaag gagggtaaca cgctggtcat agtcaccgct gatcacgcccacgccagcca gattgttgcg ccggatacca aagctccggg cctcacccag gcgctaaata ccaaagatggcgcagtgatg gtgatgagtt acgggaactc cgaagaggat tcacaagaac ataccggcag tcagttgcgtattgcggcgt atggcccgca tgccgccaat gttgttggac tgaccgacca gaccgatctc ttctacaccatgaaagccgc tctggggctg aaataa

[0127] SEQ ID No54 phoA protein sequence

[0128] Val Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr ProVal Thr Lys Ala Arg Thr Pro Glu Met Pro Val Leu Glu Asn Arg Ala Ala Gln GlyAsp Ile Thr Ala Pro Gly Gly Ala Arg Arg Leu Thr Gly Asp Gln Thr Ala Ala LeuArg Asp Ser Leu Ser Asp Lys Pro Ala Lys Asn Ile Ile Leu Leu Ile Gly Asp GlyMet Gly Asp Ser Glu Ile Thr Ala Ala Arg Asn Tyr Ala Glu Gly Ala Gly Gly PhePhe Lys Gly Ile Asp Ala Leu Pro Leu Thr Gly Gln Tyr Thr His Tyr Ala Leu AsnLys Lys Thr Gly Lys Pro Asp Tyr Val Thr Asp Ser Ala Ala Ser Ala Thr Ala TrpSer Thr Gly Val Lys Thr Tyr Asn Gly Ala Leu Gly Val Asp Ile His Glu Lys AspHis Pro Thr Ile Leu Glu Met Ala Lys Ala Ala Gly Leu Ala Thr Gly Asn Val SerThr Ala Glu Leu Gln Asp Ala Thr Pro Ala Ala Leu Val Ala His Val Thr Ser ArgLys Cys Tyr Gly Pro Ser Ala Thr Ser Glu Lys Cys Pro Gly Asn Ala Leu Glu LysGly Gly Lys Gly Ser Ile Thr Glu Gln Leu Leu Asn Ala Arg Ala Asp Val Thr LeuGly Gly Gly Ala Lys Thr Phe Ala Glu Thr Ala Thr Ala Gly Glu Trp Gln Gly LysThr Leu Arg Glu Gln Ala Gln AlaArg Gly Tyr Gln Leu Val Ser Asp Ala Ala Ser Leu Asn Ser Val Thr Glu Ala Asn Gln Gln Lys Pro Leu Leu Gly Leu Phe Ala Asp Gly Asn Met Pro Val Arg Trp Leu Gly Pro Lys Ala Thr Tyr His Gly Asn Ile Asp Lys Pro Ala Val Thr Cys Thr Pro Asn Pro Gln Arg Asn Asp Ser Val Pro Thr Leu Ala Gln Met Thr Asp Lys Ala Ile Glu Leu Leu Ser Lys Asn Glu Lys Gly Phe Phe Leu Gln Val Glu Gly Ala Ser Ile Asp Lys Gln Asp His Ala Ala Asn Pro Cys Gly Gln Ile Gly Glu Thr Val Asp Leu Asp Glu Ala Val Gln Arg Ala Leu Glu Phe Ala Lys Lys Glu Gly Asn Thr Leu Val Ile Val Thr Ala Asp His Ala His Ala Ser Gln Ile Val Ala Pro Asp Thr Lys Ala Pro Gly Leu Thr Gln Ala Leu Asn Thr Lys Asp Gly Ala Val Met Val Met Ser Tyr Gly Asn Ser Glu Glu Asp Ser Gln Glu His Thr Gly Ser Gln Leu Arg Ile Ala Ala Tyr Gly Pro His Ala Ala Asn Val Val Gly Leu Thr Asp Gln Thr Asp Leu Phe Tyr Thr Met Lys Ala Ala Leu Gly Leu Lys

[0129] SEQ ID No 39 udp gene sequence

[0130] atgtccaagt ctgatgtttt tcatctcggc ctcactaaaa acgatttaca aggggctacgcttgccatcg tccctggcga cccggatcgt gtggaaaaga tcgccgcgct gatggataag ccggttaagctggcatctca ccgcgaattc actacctggc gtgcagagct ggatggtaaa cctgttatcg tctgctctaccggtatcggc ggcccgtcta cctctattgc tgttgaagag ctggcacagc tgggcattcg caccttcctgcgtatcggta caacgggcgc tattcagccg catattaatg tgggtgatgt cctggttacc acggcgtctgtccgtctgga tggcgcgagc ctgcacttcg caccgctgga attcccggct gtcgctgatt tcgaatgtacgactgcgctg gttgaagctg cgaaatccat tggcgcgaca actcacgttg gcgtgacagc ttcttctgataccttctacc caggtcagga acgttacgat acttactctg gtcgcgtagt tcgtcacttt aaaggttctatggaagagtg gcaggcgatg ggcgtaatga actatgaaat ggaatctgca accctgctga ccatgtgtgcaagtcagggc ctgcgtgccg gtatggtagc gggtgttatc gttaaccgca cccagcaaga gatcccgaatgctgagacga tgaaacaaac cgaaagccat gcggtgaaaa tcgtggtgga agcggcgcgt cgtctgctgtaa

[0131] SEQ ID No 55 udp protein sequence

[0132] Met Ser Lys Ser Asp Val Phe His Leu Gly Leu Thr Lys Asn Asp Leu GlnGly Ala Thr Leu Ala Ile Val Pro Gly Asp Pro Asp Arg Val Glu Lys Ile Ala AlaLeu Met Asp Lys Pro Val Lys Leu Ala Ser His Arg Glu Phe Thr Thr Trp Arg AlaGlu Leu Asp Gly Lys Pro Val Ile Val Cys Ser Thr Gly Ile Gly Gly Pro Ser ThrSer Ile Ala Val Glu Glu Leu Ala Gln Leu Gly Ile Arg Thr Phe Leu Arg Ile GlyThr Thr Gly Ala Ile Gln Pro His Ile Asn Val Gly Asp Val Leu Val Thr Thr AlaSer Val Arg Leu Asp Gly Ala Ser Leu His Phe Ala Pro Leu Glu Phe Pro Ala ValAla Asp Phe Glu Cys Thr Thr Ala Leu Val Glu Ala Ala Lys Ser Ile Gly Ala ThrThr His Val Gly Val Thr Ala Ser Ser Asp Thr Phe Tyr Pro Gly Gln Glu Arg TyrAsp Thr Tyr Ser Gly Arg Val Val Arg His Phe Lys Gly Ser Met Glu Glu Trp GlnAla Met Gly Val Met Asn Tyr Glu Met Glu Ser Ala Thr Leu Leu Thr Met Cys AlaSer Gln Gly Leu Arg Ala Gly Met Val Ala Gly Val Ile Val Asn Arg Thr Gln GlnGlu Ile Pro Asn Ala Glu Thr Met Lys Gln Thr Glu Ser His Ala Val Lys Ile ValVal Glu Ala Ala Arg Arg Leu Leu

[0133] SEQ ID No. 42 psuG gene sequence from Escherichia coli

[0134] atgtctgaat taaaaatttc ccctgaatta ttacaaattt ccccggaagt gcaggacgctttaaaaaaca aaaaaccggt tgtggcgctg gaatcgacca ttattctca cgggatgccg ttcccacaaaatgcccagac cgcaattgaa gttgaagaaa ctattcgtaa acagggcgct gtacctgcca cgatcgcattattggcggc gtgatgaaag tggggttaag caaagaagaa attgaattac tgggtcgtga agggcataacgtgaccaaag ttagtcgtcg cgatttacct tttgttgttg ccgccggaaa aaatggcgca accactgtggcttcaacgat gattattgcg gcgcttgccg gaattaaagt atttgccacc gggggaattg gtggtgtgcatcgcggggcg gaacatacct tcgatatttc tgccgatttg caagaactgg caaatactaa tgtcaccgttgtttgtgccg gggcgaaatc tattctcgat ttaggattaa ccactgagta tttagaaacc ttcggtgtgccgttaattgg ctatcagact aaagcgctgc ctgcgttttt ctgccgcacc agcccgtttg acgtcagcattcgtctcgac agcgccagcg aaattgcccg tgcaatggtg gtgaaatggc aaagcggtct gaacggtggcctcgtggtag cgaacccgat cccggaacag tttgctatgc cggaacacac tatcaatgcg gcgatcgatcaggcggtagc tgaagctgaa gctcagggag tcattggtaa agaaagtacg ccattcctgc tggcgcgcgttgctgaactg accggcggtg acagcctgaa atccaacatc cagctggtgt tcaacaacgc cattctggcgagcgaaattg ccaaagaatatcagcgtctc gcgggttaa

[0135] SEQ ID No. 56 psuG protein sequence from E. coli

[0136] Met Ser Glu Leu Lys Ile Ser Pro Glu Leu Leu Gln Ile Ser Pro Glu ValGln Asp Ala Leu Lys Asn Lys Lys Pro Val Val Ala Leu Glu Ser Thr Ile Ile SerHis Gly Met Pro Phe Pro Gln Asn Ala Gln Thr Ala Ile Glu Val Glu Glu Thr IleArg Lys Gln Gly Ala Val Pro Ala Thr Ile Ala Ile Ile Gly Gly Val Met Lys ValGly Leu Ser Lys Glu Glu Ile Glu Leu Leu Gly Arg Glu Gly His Asn Val Thr LysVal Ser Arg Arg Asp Leu Pro Phe Val Val Ala Ala Gly Lys Asn Gly Ala Thr ThrVal Ala Ser Thr Met Ile Ile Ala Ala Leu Ala Gly Ile Lys Val Phe Ala Thr GlyGly Ile Gly Gly Val His Arg Gly Ala Glu His Thr Phe Asp Ile Ser Ala Asp LeuGln Glu Leu Ala Asn Thr Asn Val Thr Val Val Cys Ala Gly Ala Lys Ser Ile LeuAsp Leu Gly Leu Thr Thr Glu Tyr Leu Glu Thr Phe Gly Val Pro Leu Ile Gly TyrGln Thr Lys Ala Leu Pro Ala Phe Phe Cys Arg Thr Ser Pro Phe Asp Val Ser IleArg Leu Asp Ser Ala Ser Glu Ile Ala Arg Ala Met Val Val Lys Trp Gln Ser GlyLeu Asn Gly Gly Leu Val Val Ala Asn Pro Ile Pro Glu Gln Phe Ala Met Pro GluHis Thr Ile Asn Ala Ala Ile AspGln Ala Val Ala Glu Ala Glu Ala Gln Gly Val Ile Gly Lys Glu Ser Thr Pro Phe Leu Leu Ala Arg Val Ala Glu Leu Thr Gly Gly Asp Ser Leu Lys Ser Asn Ile Gln Leu Val Phe Asn Asn Ala Ile Leu Ala Ser Glu Ile Ala Lys Glu Tyr Gln Arg Leu Ala Gly

[0137] SEQ ID No 45 psuG gene sequence of Klebsiella spallanzanii

[0138] atgagtgaat taaatatatc ttcagagcta cttcaggttt cagcggaggt gcagcaagcgttgaagaaca accagccggt cgttgcactg gagagcacca ttatctccca cggcatgcca tttccggaaaatgcacagac cgcgctggaa gttgaagaga cgattcgtcg tcagggtgcg gtgccggcga ctattgcgatcatccatggc gtgaatgaatcgaatcgaatgaatcgaatgaatgaatgaatgaatgaat tgggtcgtga gggtcacaacgtgacgaaag tgtctcgccg cgatctccct ttcgtggtcg ccgcaggctt gaacggtgcg acgacagttgcgagcaccat gattatcgcg gctatggctg gcatcaaggt gtttgctacg ggtggcatcg gcggcgttcatcgtggtgct gagcacacct tcgatatttc tgcggatttg caagagttgg cgaacaccaa tgttaccgtggtctgtgcag gcgcgaaatc gatcctggat ctgggcctga ccaccgaata cctggaacc ttcggcgttccgctgatcgg ctaccagacc tccgctttgc cggcgtttt ctgccgtacc agccgttcg acgtaagcatccgcctgaat agcgcgaagg acattgctaa ggcaatggcg gttaaatggc agtccggtct aaagggtggttgtgg ctaatccgat tccggaacaa tttgccatgc cggaagcaaa gattaacagc gcgatcgaccaagcggtgcg tgaggcggaa gagcaaggtg tggtgggtaa agagtctact ccgttcctgc tggcgcgtgttgccgaatta accggtggcg acagcctgaa aagtaatatt cagctggtt ttaacaacgc catcctggcctgcgagatcg ccaaagaatatcaacagatt gcctga

[0139] The psuG protein sequence of SEQ ID No57 Klebsiella spallanzanii

[0140] Met Ser Glu Leu Asn Ile Ser Ser Glu Leu Leu Gln Val Ser Ala Glu ValGln Gln Ala Leu Lys Asn Asn Gln Pro Val Val Ala Leu Glu Ser Thr Ile Ile SerHis Gly Met Pro Phe Pro Glu Asn Ala Gln Thr Ala Leu Glu Val Glu Glu Thr IleArg Arg Gln Gly Ala Val Pro Ala Thr Ile Ala Ile Ile His Gly Val Met Lys ValGly Leu Ser Arg Glu Glu Ile Glu Leu Leu Gly Arg Glu Gly His Asn Val Thr LysVal Ser Arg Arg Asp Leu Pro Phe Val Val Ala Ala Gly Leu Asn Gly Ala Thr ThrVal Ala Ser Thr Met Ile Ile Ala Ala Met Ala Gly Ile Lys Val Phe Ala Thr GlyGly Ile Gly Gly Val His Arg Gly Ala Glu His Thr Phe Asp Ile Ser Ala Asp LeuGln Glu Leu Ala Asn Thr Asn Val Thr Val Val Cys Ala Gly Ala Lys Ser Ile LeuAsp Leu Gly Leu Thr Thr Glu Tyr Leu Glu Thr Phe Gly Val Pro Leu Ile Gly TyrGln Thr Ser Ala Leu Pro Ala Phe Phe Cys Arg Thr Ser Pro Phe Asp Val Ser IleArg Leu Asn Ser Ala Lys Asp Ile Ala Lys Ala Met Ala Val Lys Trp Gln Ser GlyLeu Lys Gly Gly Met Val Val Ala Asn Pro Ile Pro Glu Gln Phe Ala Met Pro GluAla Lys Ile Asn Ser Ala Ile AspGln Ala Val Arg Glu Ala Glu Glu Gln Gly Val Val Gly Lys Glu Ser Thr Pro Phe Leu Leu Ala Arg Val Ala Glu Leu Thr Gly Gly Asp Ser Leu Lys Ser Asn Ile Gln Leu Val Phe Asn Asn Ala Ile Leu Ala Cys Glu Ile Ala Lys Glu Tyr Gln Gln Ile Ala

[0141] SEQ ID No 46 psuG gene sequence of Streptomyces platensis

[0142] atgcaccaat tattgaggct atcagatgaa gtggaacaag cgttggagga aggtctgccagtggtagcac ttgaaacaac cgcgatcaac cacggtccgc cttacccggg taacctggag tgggctctggctatctgccg tgctgtacgc gaaggtggcg cgtctccggc actgaccggt atcgccgacg gtcactttgttgttggcatg agcgagagcg atctcgagcg ttttgcggcg acggcgcata tcccgaaagc atccacccgtgacctgggcc tggttttggc ttctggtggt ctcggcgcga cgaccgttgc ttccagcctg ctgattgcacacctggcagg catcccggtg ctgagcgcgg ggggcattgg cggcgttcac cgtaatgcat cggcgacgttcgatgtgtcc gcggatttaa tggaattgac ccgtcatcag gtcgcggtgg tctgcgcggg agccaagagcattctggatg ttggtctgac cctggaatac ctggagactc tgggtgtgcc ggtgatcggt tatcgctgcgctgacttccc ggcatatcat tgtaccagct ctggttttcc caacccgcag cgtgttgatg aattgactgcgctggcggct gcggttgact tacattggac cgcgggtgct acgggttcag tcgtggttac cagcccgattggcgcggagc acgccctgga cggcgatcgt attgaacaag cggtgcaggg tgcggttcgt caagctggccgcgacggcgt gcacggcgcg gccattaccc cgtacttgtt ggaggcagtg tccgccgcca caggcggtcgtagcgcggcg gcaagccgca gcgttctgat cagcaccgcg aagctggctg gtcaggtggc gggcgcgttcgcagaccgtc aaaccgccgagcgcggtgcg ggtcgcgcgc cgcgtccggg tcgccaggct ggcagagccgacgatgtttg gaaacgtgtc agacgttga

[0143] SEQ ID No58 PsuG protein sequence of Streptomyces platensis

[0144] Met His Gln Leu Leu Arg Leu Ser Asp Glu Val Glu Gln Ala Leu Glu GluGly Leu Pro Val Val Ala Leu Glu Thr Thr Ala Ile Asn His Gly Pro Pro Tyr ProGly Asn Leu Glu Trp Ala Leu Ala Ile Cys Arg Ala Val Arg Glu Gly Gly Ala SerPro Ala Leu Thr Gly Ile Ala Asp Gly His Phe Val Val Gly Met Ser Glu Ser AspLeu Glu Arg Phe Ala Ala Thr Ala His Ile Pro Lys Ala Ser Thr Arg Asp Leu GlyLeu Val Leu Ala Ser Gly Gly Leu Gly Ala Thr Thr Val Ala Ser Ser Leu Leu IleAla His Leu Ala Gly Ile Pro Val Leu Ser Ala Gly Gly Ile Gly Gly Val His ArgAsn Ala Ser Ala Thr Phe Asp Val Ser Ala Asp Leu Met Glu Leu Thr Arg His GlnVal Ala Val Val Cys Ala Gly Ala Lys Ser Ile Leu Asp Val Gly Leu Thr Leu GluTyr Leu Glu Thr Leu Gly Val Pro Val Ile Gly Tyr Arg Cys Ala Asp Phe Pro AlaTyr His Cys Thr Ser Ser Gly Phe Pro Asn Pro Gln Arg Val Asp Glu Leu Thr AlaLeu Ala Ala Ala Val Asp Leu His Trp Thr Ala Gly Ala Thr Gly Ser Val Val ValThr Ser Pro Ile Gly Ala Glu His Ala Leu Asp Gly Asp Arg Ile Glu Gln Ala ValGln Gly Ala Val Arg Gln Ala GlyArg Asp Gly Val His Gly Ala Ala Ile Thr ProTyr Leu Leu Glu Ala Val Ser Ala Ala Thr Gly Gly Arg Ser Ala Ala Ala Ser ArgSer Val Leu Ile Ser Thr Ala Lys Leu Ala Gly Gln Val Ala Gly Ala Phe Ala AspArg Gln Thr Ala Glu Arg Gly Ala Gly Arg Ala Pro Arg Pro Gly Arg Gln Ala GlyArg Ala Asp Asp Val Trp Lys Arg Val Arg Arg

[0145] SEQ ID No47 psuG gene sequence of Rhizobium sp. CF142

[0146] atgacaaaac cattttcacc cctattacct attagctaca gcaaagaagt agctgctgcgaagcaacgtg gcgcaccgat tgtggccctg gagtctacca tcattaccca cggcatgccg tacccgggtaatattgagat ggcacgttcc gtagaatcga tcatccgcga ccagggtgcg gtgccggcga cgattgcgggggatccacggc accctgcata ttgggctgga accggggag ttggagcaac tggctaaggc gaaggatgttatgaaggtga gccgtgcgga catcgcgttc agcatcgcc agcgccgtac cggggcgacg accgttgcggctacgatgat tgcggcagcg aggctggta ttaaagttt tgcaactggt ggcattggcg gtgttcatcgtggtgcggag gaaaccttcg acatctctgc ggacctggaa gagctcgctc gcaccggcgt catcgtggtctgcgcaggtg cgaaggcaat cctggatatc ccgaaaacct tggaagtgct ggaaactcgt ggtgtccctgttgttaccta tgaatccgat gaatttccgg ccttctggag ccgtagcagc ggtatcagat ccccgctgacgttgaattcg ccggcggcga ttgctaactt tcagaccacc cgtgaacaat tgggcattga tggcggtatgttaattgcga acccggttcc agaagctgac gagatcgcc gtgaggagat ggaaatctat atcgagcgcgcattagacag cgcagagcgc gacgagatca ccggtaaagc cgtgactccg tacctgctgt ctaccatcttcgatctcaca gatggccaga gcctgaaaac caatatagcg ttggttgaga acaacgcacg tctggccgcggagatcgcgg tggcgctgggtgaatga

[0147] The psuG protein sequence of SEQ ID No. 59*Rhizobium sp.*CF142

[0148] Met Thr Lys Pro Phe Ser Pro Leu Leu Pro Ile Ser Tyr Ser Lys Glu ValAla Ala Ala Lys Gln Arg Gly Ala Pro Ile Val Ala Leu Glu Ser Thr Ile Ile ThrHis Gly Met Pro Tyr Pro Gly Asn Ile Glu Met Ala Arg Ser Val Glu Ser Ile IleArg Asp Gln Gly Ala Val Pro Ala Thr Ile Ala Val Ile His Gly Thr Leu His IleGly Leu Glu Pro Ala Glu Leu Glu Gln Leu Ala Lys Ala Lys Asp Val Met Lys ValSer Arg Ala Asp Ile Ala Phe Ser Ile Ala Glu Arg Arg Thr Gly Ala Thr Thr ValAla Ala Thr Met Ile Ala Ala Ala Arg Ala Gly Ile Lys Val Phe Ala Thr Gly GlyIle Gly Gly Val His Arg Gly Ala Glu Glu Thr Phe Asp Ile Ser Ala Asp Leu GluGlu Leu Ala Arg Thr Gly Val Ile Val Val Cys Ala Gly Ala Lys Ala Ile Leu AspIle Pro Lys Thr Leu Glu Val Leu Glu Thr Arg Gly Val Pro Val Val Thr Tyr GluSer Asp Glu Phe Pro Ala Phe Trp Ser Arg Ser Ser Gly Ile Arg Ser Pro Leu ThrLeu Asn Ser Pro Ala Ala Ile Ala Asn Phe Gln Thr Thr Arg Glu Gln Leu Gly IleAsp Gly Gly Met Leu Ile Ala Asn Pro Val Pro Glu Ala Asp Glu Ile Ala Arg GluGlu Met Glu Ile Tyr Ile Glu ArgAla Leu Asp Ser Ala Glu Arg Asp Glu Ile Thr Gly Lys Ala Val Thr Pro Tyr Leu Leu Ser Thr Ile Phe Asp Leu Thr Asp Gly Gln Ser Leu Lys Thr Asn Ile Ala Leu Val Glu Asn Asn Ala Arg Leu Ala Ala Glu Ile Ala Val Ala Leu Gly Glu

[0149] SEQ ID No50 pumD gene sequence

[0150] atgactggaa cagttttatt tgatctattc ggcgttatcg cccgtcacca gagcaccgag ggtaaaaacc gtttgacgcg tactgccggc gtcgccggtc cggcattctg ggatgcgtac tgggaattgc gccctccgta tgatcgcggt gaagttaatg gcccaggtta ttggcgtcaa gttgccgacg caattggcgt ccgttttgat gatcatcgta tcgcagacct ggtggaagcg gacatcgctt cttggagcgc ggttgacgac accatggttg cgctgattga agagttgacg gcgaccggtc gtcacatggg cctgctgagc aacattccgg aggagcttgc ttcccattac gaggcgcatc acgcgtggct gaagcacttt ccggtgcgtg cgttcagctg ccgtatgggc cacgctaaac cggaacgtgc tgcgtacgag tggtgtcagc atgcgctgcg taccgaaccg gatcgcatcc tgttcgtgga tgaccgggct gacaacgtga gagcggcgga agagttaggt atgcagggtc acctgtttac caccccggat cgcctccgcc aagcactgtc gcaatggacc taa

[0151] SEQ ID No60 pumD protein sequence

[0152] Met Thr Gly Thr Val Leu Phe Asp Leu Phe Gly Val Ile Ala Arg His GlnSer Thr Glu Gly Lys Asn Arg Leu Thr Arg Thr Ala Gly Val Ala Gly Pro Ala PheTrp Asp Ala Tyr Trp Glu Leu Arg Pro Pro Tyr Asp Arg Gly Glu Val Asn Gly ProGly Tyr Trp Arg Gln Val Ala Asp Ala Ile Gly Val Arg Phe Asp Asp His Arg IleAla Asp Leu Val Glu Ala Asp Ile Ala Ser Trp Ser Ala Val Asp Asp Thr Met ValAla Leu Ile Glu Glu Leu Thr Ala Thr Gly Arg His Met Gly Leu Leu Ser Asn IlePro Glu Glu Leu Ala Ser His Tyr Glu Ala His His Ala Trp Leu Lys His Phe ProVal Arg Ala Phe Ser Cys Arg Met Gly His Ala Lys Pro Glu Arg Ala Ala Tyr GluTrp Cys Gln His Ala Leu Arg Thr Glu Pro Asp Arg Ile Leu Phe Val Asp Asp ArgAla Asp Asn Val Arg Ala Ala Glu Glu Leu Gly Met Gln Gly His Leu Phe Thr ThrPro Asp Arg Leu Arg Gln Ala Leu Ser Gln Trp Thr

[0153] SEQ ID No 51 PHM8 gene sequence

[0154] atgactatcg ctaaagatta cagacaatt tatagaaacc aaatcaaaa gcagatacgactaatcagg agcattgca aagctgaca catctaggct cacaatca ttcgaggtg gatcccaaattaccga tccgatacct gctcgaaag tatttttgat aaca tgattagtactc ciettgctca tgcaacaatc attatcaat ttctcaaat acgaattggg gtttgacgacgatgaggcag aacgcctaat cgaatcgtat tatcaagaat atggattatc cgtgaaaggt ttataagaataacaat tgatgacgtc ctacaata atacattcat accgattgattg tggaagttaa gggagctgct gatcaattta agaaaaga agctcggcaa atttgacaactatggctgt ttacaactc gtacaaaat catgccatca gatgtgttaa atattaggt attgctctatttgacgg catacctat tgccactacg acagaccac ttgaccattacgagagaca gaaacagcta aattgcaag tgggttgtcg agctttgcaa atgcctggtt tattgatgacaacgaaagca atgtgcggag cgcgttgagc atggggatgg gccatgttat ccattgata gaggattaccaatatgagtc agaaaatatt gcaagagattattattaaccattacc taccagtacc accaaaatatt ccattgataa tggacgttga agtttaccgt ccatcctcta ttgccataaa ggaatggaagagttggaag aggaagggaagcagtcaac tggtcaaatc aacagatcaa tgttcagtca tcatga

[0155] SEQ ID No. 61 PHM8 protein sequence

[0156] Met Thr Ile Ala Lys Asp Tyr Arg Thr Ile Tyr Arg Asn Gln Ile LysGln Ile Arg Leu Asn Gln Glu His Leu Gln Ser Leu Thr His Leu Gly Ser Gln IleAsn Phe Glu Val Asp Pro I Ala Asp Pro I Lys Leu P Arg Pro Asp Pro Asp Thr Leu Tyr Arg Lys Ser Thr Lys Val Gln Leu Leu MetGln Gln Ser Leu Ser Asn Phe Phe Lys Tyr Glu Leu Gly Phe Asp Asp Glu AlaGlu Arg Leu Ile Glu Ser Tyr Leu Gln Glu Tyr Gly Leu Ser Val Lys Gl Lys Lys Valle As Leu I Gln Tyr Asn Thr Phe Ile Asp Ser LeuPro Leu Gln Asp Tyr Leu Lys Pro Asp Trp Lys Leu Arg Glu Leu Leu Ile Asn LeuLys Lys Lys Leu Gly Lys Phe Asp Lys Leu Trp Leu Phe Thr Alas Ser I Tyr Le Cys Arl LysAsn Asp Leu Phe Asp Gly IleThr Tyr Cys His Tyr Asp Arg Pro Ile Glu Glu Glu Phe Ile Cys Pro Asp ProLys Phe Phe Glu Thr Ala Lys Leu Gln Ser Gly Leu Ser Phe Ala Asn Ala TrpPhe Ile Asp I G Serg Ser G Ser Ala MeV Asn Val His Leu Glue Asp TyrGln Tyr Glu Ser Glu Asn Ile Val Thr Lys Asp His Lys Asn Lys Gln Gln Phe Ser Ile Leu Lys Asp Ile Leu Glu Ile Pro Leu Ile Met Asp Val Glu Val Tyr Arg Pro Ser Ser Ile Ala Ile Lys Glu Met Glu Glu Leu Glu Glu Glu Gly Glu Ala Val Asn Trp Ser Asn Gln Gln Ile Asn Val Gln Ser Ser

[0157] SEQ ID No 52 STD1 gene sequence

[0158] atgactgttg aatatactgc atccgatttg gcaacctatc agaatgaggt gaacgaaaaattgccaaga ataaagcaca tcttgaatca ttgactcatc caggttcgaa agtgacattt ccgatcgatcaagatatttc tgctacacct caaaacccga acttaaaagt ttcttttgacattacactctatctatctat acgagaattc acgatcttat gcaacaatct atactgaggt tctttcaaac acacttgaaactatcacctg aagatgctca cgttttgaat aactcttact acaaagagta tggacttgcc ataaggggacttgtaatgtt ccacaaagtg aacgcactgg aataaccg gcacaatct cactactactactactactac cctgatatac cattaaggaa tatgctgttg agattgagac aatcgggaaa gattgataaattgtggcttt tcaccaacgc ttataaaaac cacgcaatac gttgcctgag attgttgggt atagcggatttatttgatgg attgacatat tgtgactact ctaggacaga tacgcttgcac tcacca atgttaaagcatttgaaaaa gccatgaagg aaagcgggtt ggcaagatac gagaatgctt attttataga tgacagtgggaaaacatcg agacaggtat caaattgggc atgaaaacat gtattcattt agttgagaat gaagtaaatgaaattttggg gcaacaccaccatagcatctagcttacttacgtcg acgtgtgtccgacctgttc taa

[0159] SEQ ID No62STD1

[0160] Met Thr Val Glu Tyr Thr Ala Ser Asp Leu Ala Thr Tyr Gln Asn Glu ValAsn Glu Gln Ile Ala Lys Asn Lys Ala His Leu Glu Ser Leu Thr His Pro Gly SerLys Val Thr Phe Pro Ile Asp Gln Asp Ile Ser Ala Thr Pro Gln Phe Phe PLhe Val Asn Cys Leu Tyr Lys Ser Ser Thr Arg Ile HisAsp Leu Met Gln Gln Ser Ile Leu Arg Phe Phe Gln Thr His Leu Lys Leu Ser ProGlu Asp Ala His Val Leu Asn Ser Tyr Tyr Lys Le Tyr Gly Ala Ile Arg Val Gly Asn His Val Leu Val Asp AspSer Leu Pro Leu Gln Asp Ile Leu Lys Pro Asp Ile Pro Leu Arg Asn Met Leu LeuArg Leu Arg Gln Ser Gly Lys Ile Asp Lys Leu Trp Leu Phe Thr Asn Ala Tyr LysAsn His Ala Ile Arg Ile Phe Leu Cys Alap Gly Asu Arg LeuThr Tyr Cys Asp Tyr Ser Arg Thr Asp Thr Leu Val Cys Pro His Val Lys AlaPhe Glu Lys Ala Met Lys Glu Ser Gly Ala Arg Tyr Glu Asn Ala Tyr Phe IleAsp Asp Ser Gly Lys Le Asn Ile Glu Thr Gly Ile Valle Met Lys Leu Gly AsnGlu Ile Leu Gly Gln Thr Pro Glu Gly Ala IleVal Ile Ser Asp Ile Leu Glu Leu Pro His Val Val Ser Asp Leu Phe

[0161] SEQ ID No53YKL033W-A

[0162] atgacacatc ctgtagcagt gaaggcatgt ctatttgaca tggatggtct tctcatcaacacagaggata tttatactga aactttaaat gaaactctcg cagaatttgg taagggacct ttaacttgggatgtgaagat taaattgcaa gggcttccgg gaccggaagc aggaaaaaggc acgacgaaag aaatgttgca ttgcaatctc ttaaatgggg tacttgcgaatttcttcccg gtgcattgaa tttgttgaaa tacttaaagt taaagaacat tcctattgca ttatgtacgtcttcgaacaa gactaaattt cgcggcaaaa caagtcatttc gatgatccaa gaattgcaaa aggtaggggt aagcctttcc cggacatttg gcagttgggtttaaaggaat tgaatgagaa gtttcatacc gatattaagc ccgatgagtg tatagtgttc gaagatggtattccaggcgt aaaatcagcc aaggcatttg gtgcacacgtcc cttcatc gacacagaag cttttgttagc cggtaaaggt gaactattgt cttctttgga aaaactggaaatgtccaaat atggactgtg a

[0163] SEQ ID No 63 YKL033W-A protein sequence

[0164] Met Thr His Pro Val Ala Val Lys Ala Cys Leu Phe Asp Met Asp Gly Leu Leu Ile Asn Thr Glu Asp Ile Tyr Thr Glu Thr Leu Asn Glu Thr Leu Ala Glu Phe Gly Lys Gly Pro Leu Thr Trp Asp Val Lys Ile Lys Leu Gln Gly Leu Pro Gly Pro Glu Ala Gly Lys Arg Val Ile Glu His Tyr Lys Leu Pro Ile Thr Leu Asp Glu Tyr Asp Glu Arg Asn Val Ala Leu Gln Ser Leu Lys Trp Gly Thr Cys Glu Phe Leu Pro Gly Ala Leu Asn Leu Leu Lys Tyr Leu Lys Leu Lys Asn Ile Pro Ile Ala Leu Cys Thr Ser Ser Asn Lys Thr Lys Phe Arg Gly Lys Thr Ser His Leu Glu Glu Gly Phe Asp Leu Phe Asp Thr Ile Val Thr Gly Asp Asp Pro Arg Ile Ala Lys Gly Arg Gly Lys Pro Phe Pro Asp Ile Trp Gln Leu Gly Leu Lys Glu Leu Asn Glu Lys Phe His Thr Asp Ile Lys Pro Asp Glu Cys Ile Val Phe Glu Asp Gly Ile Pro Gly Val Lys Ser Ala Lys Ala Phe Gly Ala His Val Ile Trp Val Pro His Pro Glu Ala His Ala Val Leu Gly Asp Thr Glu Ala Leu Leu Ala Gly Lys Gly Glu Leu Leu Ser Ser Leu Glu Lys Leu Glu Met Ser Lys Tyr Gly Leu

Claims

1. A pseudouridine-producing engineered bacterium, characterized in that: The genes involved in the pyrimidine biosynthesis pathway knocked out are: pepA, thrA, and argF genes, wherein the pepA gene sequence is SEQ ID No. 1, the thrA gene sequence is SEQ ID No. 8, and the argF gene sequence is SEQ ID No. 15; the pseudouridine nucleoside kinase gene psuK is knocked out, wherein the psuK gene sequence is SEQ ID No. 22; the psuT gene is knocked out, wherein the psuT gene sequence is SEQ ID No. 29; the genes involved in the overexpression of pseudouridine nucleoside synthesis are UDP, psuG, and phosphatase genes; wherein the UDP gene sequence is SEQ ID No. 39 and the protein sequence is SEQ ID No. 55; the psuG gene sequence is SEQ ID No. 46 and the protein sequence is SEQ ID No. 58; and the phosphatase gene sequence is SEQ ID No. 52 and the protein sequence is SEQ ID No. 62; the host bacterium is *Escherichia coli*.

2. The application of the engineered Escherichia coli strain that produces pseudouridine as described in claim 1 in the production of pseudouridine.

3. A method for producing pseudouridine, characterized in that: A single colony of the engineered *Escherichia coli* strain of claim 1 was inoculated into a test tube containing LB broth, to which kanamycin sulfate was added to a final concentration of 50 μg / ml. The mixture was incubated overnight at 30°C and 220 rpm. Then, 1% of the culture was inoculated into a shake flask containing 20 ml of fermentation broth. After incubation at 37°C and 220 rpm for four hours, IPTG was added to a final concentration of 50 μg / ml. The shake flask was then placed in a fermentation culture at 30°C and 220 rpm to produce pseudouridine.

4. A method for producing pseudouridine according to claim 3, characterized in that: The LB culture medium consists of: 0.5% yeast extract, 1.0% tryptone, and 1.0% sodium chloride; the fermentation medium consists of: 1.0% tryptone, 0.5% yeast extract, 2.0% glycerol, 0.1mM manganese sulfate, 0.231% KH2PO4, 1.254% K2HPO4, and pH 7.

0.

5. A method for producing pseudouridine, characterized in that: A single colony of the engineered *Escherichia coli* strain of claim 1 was inoculated into a seed culture medium and cultured at 36°C and 250 rpm for 15 h to obtain a seed solution. Then, at an inoculation rate of 10%, 1 unit volume of the seed solution was added to the fermentation culture medium, resulting in a total culture medium volume of 10 units. The fermentation culture medium formulation (g / L) was as follows: glucose 15, KH₂PO₄ 4, yeast extract 6; ammonium sulfate 8, MgSO₄·7H₂O 4; other components (mg / L) in the culture medium were: FeSO₄·7H₂O 150, MnSO₄·7H₂O 20, cobalt chloride 3.5, zinc sulfate 3.5, calcium chloride 8. Additionally, 50 mg / L of kanamycin was added to the culture medium.

6. A method for producing pseudouridine according to claim 5, characterized in that: During fermentation, the pH of the culture medium was adjusted to 7.0 using ammonia water containing 13 mol / L ammonia. The fermentation temperature was maintained at 37℃ from 0 to 3 hours. IPTG was added at the 3rd hour of fermentation to a final concentration of 50 μg / ml, while the fermentation temperature was adjusted to 30℃. Glucose was fed in at a final concentration of 0.1%. Aeration was set to 1.0 vvm during fermentation. Dissolved oxygen was controlled at 30%-40% by linking the stirring speed and dissolved oxygen. The fermentation cycle was 72 hours.

Images