SNP markers of portunus trituberculatus in the Bohai sea and their application

Abstract

The application provides a set of SNP markers of Portunus trituberculatus original species in Bohai Sea and application thereof. The SNP markers comprise SNP3047G>A, SNP115T>G, SNP189G>A, SNP1889G>A, SNP1646C>A, SNP309G>T, SNP2167C>T, SNP606G>C, SNP755T>C, SNP1078C>T, SNP1337C>T and SNP1765G>A. The SNP markers provided by the application have the characteristics of high accuracy and high efficiency, and can be used in combination for investigation and research on the current situation of Portunus trituberculatus germplasm resources in Bohai Sea and original species marking and conservation.

Description

Technical Field

[0001] This invention relates to SNP markers and their applications, specifically to SNP markers and their applications for the original species of the swimming crab (Portunus trituberculatus) in the Bohai Sea. Background Technology

[0002] Three-spotted swimming crab ( Portunus trituberculatus The swimming crab (Portunus trituberculatus) is an important economic crab species in China's marine fisheries and mariculture industry. Widely distributed along the coasts of Southeast Asia, including China, South Korea, Japan, and other sea areas, it possesses high commercial value. The Bohai Sea, as a semi-enclosed sea area, is rich in germplasm resources. It is home to my country's only national-level breeding farm for the swimming crab (Portunus trituberculatus), playing a vital role in conserving its germplasm resources, promoting ecological and healthy aquaculture, and increasing fishermen's income. However, in recent years, overfishing and environmental pollution have led to a sharp decline in wild swimming crab resources in the Bohai Sea, as well as a decrease in the genetic diversity of certain geographical populations. This has resulted in the gradual degradation of the original breeding germplasm resources, increasing the difficulty of original species conservation.

[0003] Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms at the genomic level caused by variations in a single nucleotide. These variations include single-base deletions, insertions, transitions, and transversions. SNP variations present in coding regions and adjacent regulatory sequences can alter gene expression products or levels, thus becoming a novel tool for studying genomic polymorphisms and identifying and locating genes related to diseases, growth, and reproductive performance. Compared to other molecular marker technologies, SNP markers have the following characteristics: 1. SNPs are based on single-nucleotide mutations, with a low mutation frequency and relatively high genetic stability; 2. They are abundant and widely distributed, and SNP sites can be found in and near any known or unknown gene; 3. They exhibit high polymorphism; 4. They possess dimorphism and allele characteristics, and their allele frequencies can be estimated in any population; 5. Detection is rapid and easily automated.

[0004] Currently, SNP molecular markers are widely used in aquatic animal genetics and breeding, such as in Litopenaeus vannamei (Sinoplastrus vannamei). Litopenaeus vannamei , Yu et al, 2014), and the mud crab ( ). Scylla paramamosain (Ma Hongyu et al., 2011) and the three-spined swimming crab ( P. trituberculatus(Zhang Dening et al., 2015). However, since the economic traits of aquaculture animals are mostly quantitative traits, identifying SNPs associated with important traits remains difficult. The association analysis between SNP molecular markers and traits is still in its early stages, and the relevant research results need further verification or confirmation before they can be truly applied to the design of genetic breeding. Previous studies mainly focused on genetic diversity analysis and the construction of genetic linkage maps. The application of SNP molecular markers in *Portunus trituberculatus* was limited to other sea areas, not the Bohai Sea, and it only associated the phenotype and genotype of *Portunus trituberculatus*, without studying the germplasm resources. To date, there are no reports on SNP molecular markers in the original species of *Portunus trituberculatus*. Summary of the Invention

[0005] The purpose of this invention is to provide a set of SNP markers for the original species of the swimming crab *Portunus trituberculatus* in the Bohai Sea and their applications.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a set of SNP markers for the original species of the swimming crab *Portunus trituberculatus* from the Bohai Sea. The SNP markers include SNP3047G>A, SNP115T>G, SNP189G>A, SNP1889G>A, SNP1646C>A, SNP309G>T, SNP2167C>T, SNP606G>C, SNP755T>C, SNP1078C>T, SNP1337C>T, and SNP1765G>A, wherein: The SNP3047G>A is located at position 131 of the nucleotide sequence shown in SEQ ID NO.1, at a position of G / A; The SNP115T>G is located at position 59 of the nucleotide sequence shown in SEQ ID NO.2, at a position of T / G; The SNP189G>A is located at position 149 of the nucleotide sequence shown in SEQ ID NO.3, at a position of G / A; The SNP1889G>A is located at position 134 of the nucleotide sequence shown in SEQ ID NO.4, at a position of G / A; The SNP1646C>A is located at position 92 of the nucleotide sequence shown in SEQ ID NO.5, at a position of C / A; The SNP309G>T is located at position 123 of the nucleotide sequence shown in SEQ ID NO.6, at a position of G / T; The SNP2167C>T is located at position 150 of the nucleotide sequence shown in SEQ ID NO.7, at a position of C / T; The SNP606G>C is located at position 37 of the nucleotide sequence shown in SEQ ID NO.8, at a position of G / C; The SNP755T>C is located at position 153 of the nucleotide sequence shown in SEQ ID NO.9, at a position of T / C; The SNP1078C>T is located at position 127 of the nucleotide sequence shown in SEQ ID NO.10, at a position of C / T; The SNP1337C>T is located at position 85 of the nucleotide sequence shown in SEQ ID NO.11, at a position of C / T; The SNP1765G>A is located at position 79 of the nucleotide sequence shown in SEQ ID NO.12, at a position of G / A.

[0007] Furthermore, preferably, SNP3047G>A, SNP1889G>A, SNP309G>T, SNP606G>C, SNP755T>C, SNP1078C>T, and SNP1337C>T are all significantly correlated with the carapace length, body height, and weight of the swimming crab *Portunus trituberculatus*; SNP115T>G is significantly correlated with the body height of the swimming crab; SNP189G>A is significantly correlated with the carapace length and body height of the swimming crab; SNP1646C>A and SNP1765G>A are both significantly correlated with the carapace length of the swimming crab; and SNP2167C>T is significantly correlated with the total carapace width, carapace length, body height, and weight of the swimming crab.

[0008] This invention also provides a set of primer pairs for detecting the SNP markers described above, comprising 12 primer pairs, namely: The first primer pair, with upstream primer F as shown in SEQ ID NO.13 and downstream primer R as shown in SEQ ID NO.14, is used to detect SNP3047G>A; The second primer pair, with upstream primer F as shown in SEQ ID NO.15 and downstream primer R as shown in SEQ ID NO.16, is used to detect SNP115T>G; The third primer pair, with upstream primer F as shown in SEQ ID NO.17 and downstream primer R as shown in SEQ ID NO.18, is used to detect SNP189G>A; The fourth primer pair, with upstream primer F as shown in SEQ ID NO.19 and downstream primer R as shown in SEQ ID NO.20, is used to detect SNP1889G>A; The fifth primer pair, with upstream primer F as shown in SEQ ID NO.21 and downstream primer R as shown in SEQ ID NO.22, is used to detect SNP1646C>A; The sixth primer pair, with upstream primer F as shown in SEQ ID NO.23 and downstream primer R as shown in SEQ ID NO.24, is used to detect SNP309G>T; The seventh primer pair, with upstream primer F as shown in SEQ ID NO.25 and downstream primer R as shown in SEQ ID NO.26, is used to detect SNP2167C>T; The eighth primer pair, with upstream primer F as shown in SEQ ID NO.27 and downstream primer R as shown in SEQ ID NO.28, is used to detect SNP606G>C; The ninth primer pair, with upstream primer F as shown in SEQ ID NO.29 and downstream primer R as shown in SEQ ID NO.30, is used to detect SNP755T>C; The tenth primer pair, with upstream primer F as shown in SEQ ID NO.31 and downstream primer R as shown in SEQ ID NO.32, is used to detect SNP1078C>T; The eleventh primer pair, with upstream primer F as shown in SEQ ID NO.33 and downstream primer R as shown in SEQ ID NO.34, is used to detect SNP1337C>T; The twelfth primer pair, with upstream primer F as shown in SEQ ID NO.35 and downstream primer R as shown in SEQ ID NO.36, is used to detect SNP1765G>A.

[0009] Specifically, the sequences of each primer pair are shown in the table below:

[0010] This invention also provides the application of the SNP marker or the primer pair of the SNP marker in the breeding of growth traits of the original species of swimming crab (Portunus trituberculatus) in the Bohai Sea.

[0011] This invention also provides the application of the SNP marker or the primer pair of the SNP marker in the original species marker identification and conservation of the swimming crab (Portunus trituberculatus) in the Bohai Sea.

[0012] The specific steps of the analytical method used in this invention include: (a) extracting genomic DNA from the three-spined swimming crab to be tested; (b) using the genomic DNA of the three-spined swimming crab to be tested as a template, and performing genotyping using the primer pairs marked with the SNPs; and (c) performing growth trait association analysis based on the genotyping results.

[0013] If the primer pair SNP3047G>A can amplify the AA, AG and GG genotypes when amplifying the sample, it indicates that the sample is the original species of the swimming crab from the Bohai Sea, whose carapace length, body height and weight are significantly related to the genotypes AA, AG and GG. If primer pairs labeled with SNP115T>G can amplify the GG, TG, and TT genotypes, it indicates that the sample to be tested is the original species of the Bohai three-spined swimming crab whose body height is significantly related to the genotypes GG, TG, and TT. If primer pairs labeled with SNP189G>A can amplify AA, AG, and GG genotypes, it indicates that the sample to be tested is the original species of the Bohai three-spined swimming crab, whose carapace length and body height are significantly correlated with genotypes AA, AG, and GG. If primer pairs labeled with SNP1889G>A can amplify AA, AG, and GG genotypes, it indicates that the sample to be tested is the original species of the Bohai three-spined swimming crab whose carapace length, body height, and weight traits are significantly related to genotypes AA, AG, and GG. If primer pairs labeled with SNP1646C>A can amplify AA, AC, and CC genotypes, it indicates that the sample to be tested is the original species of the Bohai three-spined swimming crab, whose carapace length trait is significantly associated with genotypes AA, AC, and CC. If primer pairs labeled with SNP309G>T can amplify the GG, TG, and TT genotypes, it indicates that the sample to be tested is the original species of the swimming crab from the Bohai Sea, whose carapace length, body height, and weight traits are significantly associated with the genotypes GG, TG, and TT. If the primer pair labeled SNP2167C>T can amplify the CC, TC and TT genotypes, it indicates that the sample to be tested is the original species of the swimming crab from the Bohai Sea, whose carapace length, body height and weight traits are significantly related to the genotypes CC, TC and TT. If primer pairs labeled with SNP606G>C can amplify the CC, CG, and GG genotypes, it indicates that the sample to be tested is the original species of the Bohai three-spined swimming crab whose carapace length, body height, and weight traits are significantly related to the genotypes CC, CG, and GG. If the primer pair labeled SNP755T>C can amplify the CC, TC and TT genotypes, it indicates that the sample to be tested is the original species of the swimming crab from the Bohai Sea, whose carapace length, body height and weight traits are significantly related to the genotypes CC, TC and TT. If the primer pair labeled SNP1078C>T can amplify the CC, TC and TT genotypes, it indicates that the sample to be tested is the original species of the Bohai three-spined swimming crab whose carapace length, body height and weight traits are significantly related to the genotypes CC, TC and TT. If the primer pair labeled SNP1337C>T can amplify the CC, TC and TT genotypes, it indicates that the sample to be tested is the original species of the swimming crab from the Bohai Sea, whose carapace length, body height and weight traits are significantly related to the genotypes CC, TC and TT. If primer pairs labeled with SNP1765G>A can amplify the AA, AG, and GG genotypes, it indicates that the sample to be tested is the original species of the Bohai three-spined swimming crab, whose carapace length trait is significantly associated with the genotypes AA, AG, and GG.

[0014] The SNP markers provided by this invention are significantly correlated with the growth traits of the original species of *Portunus trituberculatus* from the Bohai Sea. They exhibit high specificity and sensitivity, are unaffected by environmental conditions, and provide accurate, repeatable, and stable results. The 12 SNP markers can be used in combination; subsequent genotyping of the SNP loci in the test sample and selection of the corresponding genotype can identify whether the sample is from the original species of *Portunus trituberculatus* from the Bohai Sea. This has potential application value for investigating the current status of *Portunus trituberculatus* germplasm resources in the Bohai Sea, as well as for original species markers and conservation. Detailed Implementation

[0015] The present invention will be further described below with reference to the embodiments. The processes and methods not described in detail in the following embodiments are conventional methods known in the art. Unless otherwise stated, the raw materials or reagents used in the embodiments are commercial products that can be purchased through commercial channels.

[0016] Example 1: Obtaining SNP molecular markers (1) Sample source and measurement of growth traits of swimming crabs (Portunus trituberculatus) Seventy crabs were collected from each of three wild populations: one from the Bohai Sea (National Swimming Crab Breeding Farm, Huanghua City, Hebei Province), one from the Yellow Sea (New Oriental International Container Terminal, Lianyungang, Jiangsu Province), and one from the East China Sea (China Zhoushan International Aquatic Products City, Ningbo City, Zhejiang Province). Growth traits of all collected crabs were measured, including four measurable traits: carapace width, carapace length, body height, and body weight.

[0017] (2) Extraction of total DNA from muscle tissue of swimming crab (Portunus trituberculatus) samples DNA was extracted from the muscle tissue of 210 swimming crabs using a marine animal genome extraction kit (Tiangen, Beijing). The specific operation steps were followed according to the kit instructions. The concentration of DNA from each individual was determined using a NanoDrop 2000 nucleic acid analyzer, and the quality and integrity of the DNA were detected by 1% agarose gel electrophoresis. The DNA from all individuals was diluted to 50 ng / µl for later use.

[0018] (3) Development of SNP markers and genotyping DNA samples from 210 individuals were sent to Hangzhou Lianchuan Biotechnology Co., Ltd. Simplified whole-genome sequencing was performed on all individuals using the GBS method, and the results were compared with the reference genome of *Portunus trituberculatus* (ASM1759143v1 version) for SNP discovery. Data was filtered based on minimum allele frequency (MAF) > 0.05 and call rate > 70%, resulting in 76 candidate SNP markers.

[0019] DNA samples from 210 swimming crabs (Portunus trituberculatus) and information on 76 candidate SNP markers were sent to Shanghai Yihe Applied Biotechnology Co., Ltd. for specific primer design, high-throughput sequencing, and genotyping. The specific steps included: using the DNA from the test samples as templates, adding appropriate PCR amplification primer pairs and single-base extension primers for PCR amplification; after three rounds of PCR amplification, high-throughput sequencing of the amplicon was performed. The sequencing results were then subjected to multiplex PCR agarose gel electrophoresis, quantitative real-time PCR quality control, and sequencing quality control to distinguish different samples, ultimately obtaining mutation information for each locus in each sample.

[0020] (4) Association analysis between SNP markers and growth traits of swimming crab (Portunus trituberculatus) Using the general linear model (GLM) in Tassel 2.1 software, with the population structure matrix (Q) value as a covariate, association analysis was performed on the growth traits of 76 candidate SNP markers with samples of swimming crabs from the Bohai Sea, Yellow Sea, and East China Sea, and the markers were tested for significance at the P<0.05 level.

[0021] In the association analysis of growth traits, 12 SNP markers were found to be significantly associated only with the growth traits of *Portunus trituberculatus* in the Bohai Sea, but not significantly associated with the growth traits of *Portunus trituberculatus* in the Yellow Sea and East China Sea (Table 1). Therefore, these 12 SNP markers can be used as original species markers for *Portunus trituberculatus* in the Bohai Sea.

[0022] As shown in Table 1, SNP3047G>A, SNP1889G>A, SNP309G>T, SNP606G>C, SNP755T>C, SNP1078C>T, and SNP1337C>T are all significantly correlated with the carapace length, body height, and weight of the swimming crab *Portunus trituberculatus*; SNP115T>G is significantly correlated with the body height of the swimming crab; SNP189G>A is significantly correlated with the carapace length and body height of the swimming crab; SNP1646C>A and SNP1765G>A are significantly correlated with the carapace length of the swimming crab; and SNP2167C>T is significantly correlated with the total carapace width, carapace length, body height, and weight of the swimming crab.

[0023] Table 1. Associations between 12 SNP markers and various growth traits of the swimming crab *Portunus trituberculatus* in the Bohai Sea.

[0024] (5) SNP marker alleles and their distribution The genotypes and allele frequencies of 12 SNP markers that were significantly associated with the growth traits of the original species of Swimming Crab (Portunus trituberculatus) in the Bohai Sea are shown in Table 2.

[0025] Table 2. Genotype information of 12 SNP markers significantly associated with growth traits of the original species of *Portunus trituberculatus* from the Bohai Sea.

[0026] Example 2: Application of the SNP marker SNP3047G>A in the identification of the original species of *Portunus trituberculatus* from the Bohai Sea. (1) Source of the sample to be tested Sixty wild populations of *Portunus trituberculatus* were collected from six Bohai Sea populations (Dalian, Huludao, Qinhuangdao, Huanghua, Dongying, and Penglai), one wild population from the Yellow Sea (Lianyungang), and one wild population from the East China Sea (Ningbo), with 60 individuals collected from each population. Growth traits of all collected *Portunus trituberculatus* were measured, including four measurable traits: carapace width, carapace length, body height, and body weight.

[0027] (2) Extraction of genomic DNA DNA was extracted from the muscle tissue of 480 individuals of the swimming crab *Portunus trituberculatus* using a marine animal genome extraction kit (Tiangen, Beijing). Specific procedures were followed according to the kit instructions. The concentration of DNA from each individual was determined using a NanoDrop 2000 nucleic acid analyzer, and the quality and integrity of the DNA were assessed by 1% agarose gel electrophoresis. All DNA samples were diluted to 50 ng / µl for later use.

[0028] (3) Marker typing of SNP3047G>A The target sequence was amplified using amplification primers SNP3047G>AF: GCAAAACTCAACCCTCTGTATATG and SNP3047G>AR: CACATTGCTTTCTGACCTCATAG. High-throughput sequencing of the amplified product was then performed using SNP3047G>AF as the sequencing primer to obtain the SNP genotyping result for SNP3047G>A. The genotype of the target SNP locus was determined based on the sequencing peak profile. If there was only one A base peak at that position, the genotype was AA; if there was only one G base peak, the genotype was GG; and if there were both A and G base peaks at that position, the genotype was AG.

[0029] (4) Results of breeding of the original species of swimming crab in the Bohai Sea Based on the genotypes of 480 individuals, individuals were selected and retained. Those three-spined swimming crabs that could amplify the AA, AG, and GG genotypes using primers with the SNP marker SNP3047G>A were selected and retained. These were the original species of Bohai three-spined swimming crabs whose carapace length, body height, and weight traits were significantly associated with the AA, AG, and GG genotypes.

[0030] This embodiment uses the SNP locus SNP3047G>A as an example to illustrate the use of the marker related to the original species of the Bohai three-spined swimming crab in this patent. The usage of other loci is similar to that of this marker.

[0031] Although the present invention has been described in detail above through specific embodiments and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A set of primer pairs for detecting SNP markers, characterized in that, The SNP markers include: SNP3047G>A, SNP115T>G, SNP189G>A, SNP1889G>A, SNP1646C>A, SNP309G>T, SNP2167C>T, SNP606G>C, SNP755T>C, SNP1078C>T, SNP1337C>T, and SNP1765G>A, wherein: The SNP3047G>A is located at position 131 of the nucleotide sequence shown in SEQ ID NO.1, at a position of G / A; The SNP115T>G is located at position 59 of the nucleotide sequence shown in SEQ ID NO.2, at a position of T / G; The SNP189G>A is located at position 149 of the nucleotide sequence shown in SEQ ID NO.3, at a position of G / A; The SNP1889G>A is located at position 134 of the nucleotide sequence shown in SEQ ID NO.4, at a position of G / A; The SNP1646C>A is located at position 92 of the nucleotide sequence shown in SEQ ID NO.5, at a position of C / A; The SNP309G>T is located at position 123 of the nucleotide sequence shown in SEQ ID NO.6, at a position of G / T; The SNP2167C>T is located at position 150 of the nucleotide sequence shown in SEQ ID NO.7, at a position of C / T; The SNP606G>C is located at position 37 of the nucleotide sequence shown in SEQ ID NO.8, at a position of G / C; The SNP755T>C is located at position 153 of the nucleotide sequence shown in SEQ ID NO.9, at a position of T / C; The SNP1078C>T is located at position 127 of the nucleotide sequence shown in SEQ ID NO.10, at a position of C / T; The SNP1337C>T is located at position 85 of the nucleotide sequence shown in SEQ ID NO.11, at a position of C / T; The SNP1765G>A is located at position 79 of the nucleotide sequence shown in SEQ ID NO.12, at a position of G / A; The primer pairs used to detect SNP markers include: The first primer pair, with upstream primer F as shown in SEQ ID NO.13 and downstream primer R as shown in SEQ ID NO.14, is used to detect SNP3047G>A; The second primer pair, with upstream primer F as shown in SEQ ID NO.15 and downstream primer R as shown in SEQ ID NO.16, is used to detect SNP115T>G; The third primer pair, with upstream primer F as shown in SEQ ID NO.17 and downstream primer R as shown in SEQ ID NO.18, is used to detect SNP189G>A; The fourth primer pair, with upstream primer F as shown in SEQ ID NO.19 and downstream primer R as shown in SEQ ID NO.20, is used to detect SNP1889G>A; The fifth primer pair, with upstream primer F as shown in SEQ ID NO.21 and downstream primer R as shown in SEQ ID NO.22, is used to detect SNP1646C>A; The sixth primer pair, with upstream primer F as shown in SEQ ID NO.23 and downstream primer R as shown in SEQ ID NO.24, is used to detect SNP309G>T; The seventh primer pair, with upstream primer F as shown in SEQ ID NO.25 and downstream primer R as shown in SEQ ID NO.26, is used to detect SNP2167C>T; The eighth primer pair, with upstream primer F as shown in SEQ ID NO.27 and downstream primer R as shown in SEQ ID NO.28, is used to detect SNP606G>C; The ninth primer pair, with upstream primer F as shown in SEQ ID NO.29 and downstream primer R as shown in SEQ ID NO.30, is used to detect SNP755T>C; The tenth primer pair, with upstream primer F as shown in SEQ ID NO.31 and downstream primer R as shown in SEQ ID NO.32, is used to detect SNP1078C>T; The eleventh primer pair, with upstream primer F as shown in SEQ ID NO.33 and downstream primer R as shown in SEQ ID NO.34, is used to detect SNP1337C>T; The twelfth primer pair, with upstream primer F as shown in SEQ ID NO.35 and downstream primer R as shown in SEQ ID NO.36, is used to detect SNP1765G>A.

2. The application of the SNP marker or the primer pair of the SNP marker as described in claim 1 in the breeding of growth traits of the original species of *Portunus trituberculatus* from the Bohai Sea, characterized in that... The growth traits referred to are carapace width, carapace length, body height, and body weight. SNP3047G>A, SNP1889G>A, SNP309G>T, SNP606G>C, SNP755T>C, SNP1078C>T, and SNP1337C>T are all significantly correlated with carapace length, body height, and body weight of *Portunus trituberculatus*. SNP115T>G is significantly correlated with body height of *Portunus trituberculatus*. SNP189G>A is significantly correlated with carapace length and body height of *Portunus trituberculatus*. SNP1646C>A and SNP1765G>A are both significantly correlated with carapace length of *Portunus trituberculatus*. SNP2167C>T is significantly correlated with carapace width, carapace length, body height, and body weight of *Portunus trituberculatus*.

3. The application of the SNP marker or the primer pair of the SNP marker as described in claim 1 in the original species marker identification and conservation of the swimming crab *Portunus trituberculatus* in the Bohai Sea, characterized in that... The original species marker identification and conservation involved traits such as carapace width, carapace length, body height, and weight. SNP3047G>A, SNP1889G>A, SNP309G>T, SNP606G>C, SNP755T>C, SNP1078C>T, and SNP1337C>T were all significantly correlated with carapace length, body height, and weight of *Portunus trituberculatus*. SNP115T>G was significantly correlated with body height of *Portunus trituberculatus*. SNP189G>A was significantly correlated with carapace length and body height of *Portunus trituberculatus*. SNP1646C>A and SNP1765G>A were both significantly correlated with carapace length of *Portunus trituberculatus*. SNP2167C>T was significantly correlated with carapace width, carapace length, body height, and weight of *Portunus trituberculatus*.

Images