InDel primer for distinguishing brassica varieties and application thereof

Abstract

This invention discloses an InDel primer for distinguishing cabbage varieties, belonging to the field of molecular markers in molecular biology. The method involves designing and screening five pairs of InDel primers, with nucleotide sequences shown in SEQ ID NO:1-5, to amplify the DNA of unknown cabbage varieties. By statistically analyzing the bands after gel electrophoresis, varieties with unique specific bands are identified, and a dendrogram of the distinguished varieties is established. The primers of this invention improve the stability of the InDel reaction, are simple to operate, highly efficient and accurate, and save primers. Only five PCRs are needed to easily and rapidly distinguish 36 cabbage varieties, including "QB1," at the molecular level. The resulting variety identification diagram is more intuitive than a clustering tree; that is, primers that can distinguish any two varieties can be quickly identified based on the variety identification diagram. This method can achieve early identification of cabbage seedlings and has wide applicability to other species.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a method for rapidly distinguishing cabbage varieties using InDel molecular marker technology. Background Technology

[0002] Cabbage is one of the world's most widely cultivated vegetable crops, with a long history of cultivation and abundant varietal resources. Currently, the annual planting area of ​​heading cabbage in my country exceeds 400,000 hectares, accounting for 25% to 30% of the country's total vegetable planting area. It is a major vegetable cultivated in spring, summer, and autumn in Northeast, Northwest, and North China, and is also widely cultivated in the south. In recent years, with the significant expansion of cabbage production and cultivation area in my country, more and more superior varieties have been applied to cabbage production. Therefore, establishing a rapid and reliable identification technology system for cabbage varieties is of great significance for the research and protection of cabbage genetic resources, seedling identification, variety differentiation, and even the sustainable development of the cabbage industry.

[0003] DNA molecular markers are a class of genetic markers that have emerged with the rapid development of biotechnology such as molecular cloning and recombinant DNA. Because they are established directly at the molecular level and are not affected by factors such as the external environment, crop development stage, or sampling site, the number of polymorphic sites they can detect is unlimited. Therefore, the identification results are highly reliable, highly repeatable, and have strong discriminative power.

[0004] Traditional, single-method morphological identification is no longer sufficient to effectively identify or differentiate the ever-increasing number of varieties. The application of molecular markers has brought about significant changes in crop genetics and breeding research, and has also been applied to variety identification. Unlike traditional DNA markers such as RAPD, ISSR, SRAP, and AFLP, InDel markers are a new generation of molecular marker technology developed based on whole-genome DNA sequences. InDel polymorphism is a special type of biseleural genetic marker in the genome, characterized by the insertion or deletion of small sequence fragments of different sizes. It is a co-dominant marker, and due to its good stability and polymorphism, it is now widely used in fingerprinting, genetic basis research of germplasm resources, rapid gene localization, high-density gene linkage markers, genetic diversity analysis, and variety classification research.

[0005] Existing research on the differentiation and germplasm identification of vegetable crop varieties using molecular marker technology mostly employs computer software to draw digital fingerprint maps and combines them with statistical software to generate cluster trees. However, this cluster analysis not only fails to visually display the primers that distinguish varieties, but also fails to show the identification process. It is also labor-intensive and lacks practicality. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide an InDel primer for distinguishing cabbage varieties.

[0007] Another technical problem to be solved by the present invention is to provide the application of the above primers in distinguishing cabbage varieties.

[0008] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0009] An InDel primer for differentiating cabbage varieties includes the following primers:

[0010] InDel22: F: AACACCTGAAACCCTCAC; R: TTTGAAAGTCACCCGTAA;

[0011] InDel 24: F: ACTCCTCCCAACGGTCTT; R: GAACAGGTGGCACAAGAT;

[0012] InDel 5: F: TTTTGGAAACGGTCTTGT; R: AGCGACTGAATGGCACCC;

[0013] InDel 3: F: AAGCAAATGAGCAGAATGA; R: TTTGGGCTGTTTAGGTGG;

[0014] InDel 34: F: TGGGTCAGTTGTCCAAAG; R: TCAGTACGCATATCAGCAC.

[0015] The above-mentioned InDel primers used to distinguish cabbage varieties are applied in the differentiation of cabbage varieties.

[0016] The cabbage varieties mentioned include: 'Jingfeng No. 1', 'Qingfeng', 'Zhonggan No. 11', 'Zhenlv', 'Lvqiu Huangguan', 'Junchuan Vegas', 'Qiutian No. 2', 'Xiwang', 'Qiantu', 'Zhonggan 21', 'CMS Jingfeng No. 1', 'Xiatian', 'Xiali', 'Chunfeng', 'Chunxi', 'Beifang Xiadi', 'Youxuan 8132', 'Zaoliang', 'Chaolv', 'Zhenlv 55', 'Xingshu 309', 'Sugan 55', 'Sugan 65', 'Zhonggan 26', 'Xiangan 097', 'Meihua', 'Shengxia Wang', 'Kangre Lvgan 40', 'Kangre Lvgan 60', 'Lvba 505', 'Kangre Lvgan 50', 'Jinyuanbao No. 1', 'Huachun', 'Tanchun', 'Sugan 125', and 'Chunqiu Tingmei'.

[0017] The method for identifying cabbage varieties using the five primer pairs in this invention is as follows:

[0018] (1) Extracting genomic DNA from cabbage leaves;

[0019] (2) InDel amplification was performed on the genomic DNA obtained in step (1) using primer InDel22. The PCR product was detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 400 bp but no characteristic band appeared at 280 bp, InDel amplification was performed again using primer InDel24. The PCR product was detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 280 bp but no characteristic band appeared at 450 bp, InDel amplification was performed again using primer InDel5. InDel amplification was performed, and the PCR products were detected by polyacrylamide gel electrophoresis. If characteristic bands appeared at 100bp, 150bp, and 350bp, InDel amplification was continued using InDel3 primers. The PCR products were then detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 450bp, the variety was QB2; if a characteristic band appeared at 400bp, the variety was QB28; and if a characteristic band appeared at 500bp, the variety was QB107.

[0020] When using InDel24 primer for InDel amplification, if characteristic bands appear at both 280bp and 450bp, continue with InDel amplification using InDel5 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If a characteristic band appears at 350bp, but no characteristic bands appear at 100bp and 150bp, the variety is QB1. If characteristic bands appear at 100bp, 150bp, and 350bp, continue with InDel amplification using InDel3 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If characteristic bands appear at both 300bp and 450bp, the variety is QB18. If characteristic bands appear at both 300bp and 600bp, the variety is QB111.

[0021] (3) Use InDel22 primer to perform InDel amplification on the genomic DNA obtained in step (1). If a characteristic band appears at 280bp but no characteristic band appears at 400bp, continue InDel amplification using InDel24 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If a characteristic band appears at 280bp but no characteristic band appears at 450bp, continue InDel amplification using InDel5 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If characteristic bands appear at both 100bp and 350bp, the variety is QB197; if no characteristic band appears at 350bp but a characteristic band appears at 400bp, the variety is QBQ168; if no characteristic band appears at 100bp, the variety is QB120; if characteristic bands appear at both 400bp and 350bp, the variety is QB120. The variety is QB90; if a characteristic band appears at 450bp, the variety is QB171; if characteristic bands appear at 100bp, 150bp, and 300bp, InDel amplification is continued using InDel3 primers, and the PCR product is detected by polyacrylamide gel electrophoresis; if characteristic bands appear at 300bp and 500bp, the variety is QB43; if a characteristic band appears at 480bp, the variety is QB41; if characteristic bands appear at 300bp and 400bp, the variety is QB13; if characteristic bands appear at 400bp and 450bp, InDel amplification is continued using InDel34 primers, and the PCR product is detected by polyacrylamide gel electrophoresis; if a characteristic band appears at 100bp, the variety is QB12; if no characteristic band appears at 100bp, the variety is QB103.

[0022] Using InDel22 primer, the genomic DNA obtained in step (1) was amplified using InDel. If a characteristic band appeared at 280 bp but no characteristic band appeared at 400 bp, InDel amplification was continued using InDel24 primer. The PCR product was then detected by polyacrylamide gel electrophoresis. If characteristic bands appeared at both 280 bp and 450 bp, InDel amplification was continued using InDel5 primer. The PCR product was then detected by polyacrylamide gel electrophoresis. Amide gel electrophoresis was used to detect the presence of characteristic bands at 350bp, 450bp, and 450bp. The variety was QB179; a characteristic band at 350bp indicated QB161; no characteristic band at 100bp, but characteristic bands at 150bp and 350bp indicated QB46; a characteristic band at 400bp indicated QB30; and characteristic bands at 100bp, 150bp, and 350bp were also detected. Continuing with InDel3 primers, InDel amplification was performed, and the resulting PCR products were detected by polyacrylamide gel electrophoresis. If characteristic bands appeared at both 600bp and 300bp, the variety was QB3; if characteristic bands appeared at both 480bp and 500bp, the variety was QB39; if characteristic bands appeared at both 300bp and 450bp, InDel amplification was continued using InDel34 primers, and the resulting PCR products were detected by polyacrylamide gel electrophoresis. For PCR detection, if a characteristic band appears at 400bp, the variety is QB19; if no characteristic band appears at 400bp, the variety is QB121; if no characteristic band appears at 300bp or 500bp, InDel amplification is performed using InDel34 primers. The obtained PCR products are then detected by polyacrylamide gel electrophoresis. If a characteristic band appears at 420bp, the variety is QB410; if no characteristic band appears at 420bp, the variety is QB142.

[0023] (4) Use InDel22 primer to perform InDel amplification on the genomic DNA obtained in step (1). If characteristic bands appear at both 280bp and 400bp, continue InDel amplification using InDel24 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If a characteristic band appears at 280bp but no characteristic band appears at 450bp, continue InDel amplification using InDel5 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If a characteristic band appears at 400bp, the variety is QB37; if characteristic bands appear at 100bp, 150bp, and 350bp, InDel amplification is performed using InDel3 primers. The PCR products are then detected by polyacrylamide gel electrophoresis. If a characteristic band appears at 300bp, the variety is QB10; if a characteristic band appears at 250bp, the variety is QB40; and if characteristic bands appear at both 400bp and 450bp, the variety is QBJF.

[0024] Using InDel22 primers, the genomic DNA obtained in step (1) was amplified using InDel. If characteristic bands appeared at 280bp and 400bp, InDel amplification was continued using InDel24 primers. The PCR products were then detected by polyacrylamide gel electrophoresis. If characteristic bands appeared at both 280bp and 450bp, InDel amplification was continued using InDel5 primers. The PCR products were then detected by polyacrylamide gel electrophoresis. If no characteristic band appeared at 100bp, but characteristic bands appeared at 150bp and 300bp, the product was QB100; if no characteristic band appeared at 350bp, but a characteristic band appeared at 400bp, the product was QB185; if characteristic bands appeared at 100bp, 150bp, and 350bp, the product was QB185. InDel amplification was further performed using InDel3 primers, and the resulting PCR products were detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 300 bp, the variety was QB7; if characteristic bands appeared at both 300 bp and 450 bp, the variety was QB23; if characteristic bands appeared at both 350 bp and 400 bp, InDel amplification was further performed using InDel3 primers, and the resulting PCR products were detected by polyacrylamide gel electrophoresis; if characteristic bands appeared at 250 bp, the variety was QBYSGL; if no characteristic band appeared at 250 bp, the variety was QB158.

[0025] The variety names corresponding to each number in the above steps are shown in the table below:

[0026]

[0027] In step (1), the method for extracting genomic DNA from cabbage leaves is as follows:

[0028] Take 0.1g of tender cabbage leaves, grind them in liquid nitrogen, add 500μl of CTAB lysis buffer, transfer to a 1.5ml centrifuge tube, incubate at 65℃ for 0.5-1h, then remove and cool. Add an equal volume of chloroform / isoamyl alcohol mixture and shake gently. Centrifuge at 12000r / min for 8-10min. Extract the supernatant with chloroform / isoamyl alcohol mixture 1-2 times, add pre-cooled isopropanol, and let stand at 4℃ for more than 3 hours. Collect the flocculent DNA, wash with 70% ethanol, dry, and store the flocculent DNA in TE buffer.

[0029] The CTAB lysis buffer has the following composition: 2% CTAB (volume fraction), 2 mol / L NaCl2, 20 mmol / L EDTA, 100 mmol / L Tris-HCl, pH 8.0, and 0.2% β-mercaptoethanol (volume fraction); the volume ratio of chloroform to isoamyl alcohol in the chloroform / isoamyl alcohol mixture is 24:1.

[0030] In steps (2) to (5), the InDel amplification PCR reaction system is 20 μl, which contains 1 μl of genomic DNA, 1 μl of each of the upstream and downstream primers, and 10 μl of 2xEasyTaq PCR SuperMix for PAGE.

[0031] In steps (2) to (5), the InDel amplification PCR reaction conditions are as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 50 s, 56℃ for 50 s, 72℃ extension for 60 s, 35 cycles; 72℃ extension for 10 min, and then stored at 4℃.

[0032] The annealing temperature of InDel22 primer is 46.7℃, that of InDel24 is 47.1℃, that of InDel5 is 48.4℃, that of InDel3 is 46.5℃, and that of InDel34 is 49.1℃.

[0033] Beneficial effects:

[0034] The primers of this invention improve the stability of the InDel reaction, are simple to operate, highly efficient and accurate, and save primers. With only 5 PCRs, 36 cabbage varieties, including "QB1", can be easily and quickly distinguished at the molecular level. The resulting variety identification map is more intuitive than the clustering tree. That is, the primers that can distinguish any two varieties can be quickly found based on the variety identification map. This method can realize early identification of cabbage seedlings and has wide applicability to other species. Attached Figure Description

[0035] Figure 1 Comparison chart of varieties and numbers of this invention.

[0036] Figure 2 This invention identifies a tree diagram.

[0037] Figure 3 This invention identifies a tree diagram.

[0038] Figure 4 This invention identifies a tree diagram.

[0039] Figure 5 This invention identifies a tree diagram.

[0040] Figure 6 This invention identifies a tree diagram.

[0041] Figure 7 This invention identifies a tree diagram.

[0042] Figure 8 Image of PCR products obtained using InDel22 primers via polyacrylamide gel electrophoresis.

[0043] Figure 9 Image of PCR products obtained using InDel24 primers via polyacrylamide gel electrophoresis.

[0044] Figure 10 Image of PCR products obtained using InDel5 primers via polyacrylamide gel electrophoresis.

[0045] Figure 11 Image of PCR products obtained using InDel3 primers via polyacrylamide gel electrophoresis.

[0046] Figure 12 Image of PCR products obtained using InDel34 primers via polyacrylamide gel electrophoresis. Detailed Implementation

[0047] Example 1: The method for obtaining genomic DNA from cabbage leaves is as follows:

[0048] Take 0.1g of tender cabbage leaves, grind them in liquid nitrogen, add 500μl of CTAB lysis buffer, transfer to a 1.5ml centrifuge tube, incubate at 65℃ for 0.5-1h, then remove and cool. Add an equal volume of chloroform / isoamyl alcohol mixture and shake gently. Centrifuge at 12000r / min for 8-10min. Extract the supernatant with chloroform / isoamyl alcohol mixture 1-2 times, add pre-cooled isopropanol, and let stand at 4℃ for more than 3 hours. Collect the flocculent DNA, wash with 70% ethanol, dry, and store the flocculent DNA in TE buffer.

[0049] The CTAB lysis buffer has the following composition: 2% CTAB, 2 mol / L NaCl2, 20 mmol / L EDTA, 100 mmol / L Tris-HCl, pH 8.0, and 0.2% β-mercaptoethanol; the volume ratio of chloroform to isoamyl alcohol in the chloroform / isoamyl alcohol mixture is 24:1.

[0050] The InDel amplification described in steps (2) to (5) consists of a PCR reaction system of 20 μl, which contains 1 μl of genomic DNA, 1 μl each of upstream and downstream primers, and 10 μl of 2xEasyTaq PCR SuperMix for PAGE.

[0051] The InDel amplification described in steps (2) to (5) is performed under the following PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 50 s, 56℃ for 50 s, 72℃ extension for 60 s, for 35 cycles; 72℃ extension for 10 min, and then stored at 4℃.

[0052] The annealing temperature for InDel22 primer is 46.7℃, for InDel24 it is 47.1℃, for InDel5 it is 48.4℃, and for InDel13 it is 46.5℃.

[0053] Example 2:

[0054] The cabbage varieties that can be distinguished by this invention include: 'Jingfeng No. 1', 'Qingfeng', 'Zhonggan No. 11', 'Zhenlv', 'Lvqiu Huangguan', 'Junchuan Vegas', 'Qiutian No. 2', 'Xiwang', 'Qiantu', 'Zhonggan 21', 'CMS Jingfeng No. 1', 'Xiatian', 'Xiali', 'Chunfeng', 'Chunxi', 'Beifang Xiadi', 'Youxuan 8132', 'Zaoliang', 'Chaolv', 'Zhenlv 55', 'Xingshu 309', 'Sugan 55', 'Sugan 65', 'Zhonggan 26', 'Xiangan 097', 'Meihua', 'Shengxia Wang', 'Kangre Lvgan 40', 'Kangre Lvgan 60', 'Lvba 505', 'Kangre Lvgan 50', 'Jinyuanbao No. 1', 'Huachun', 'Tanchun', 'Sugan 125', and 'Chunqiu Tingmei'.

[0055] (1) Extracting genomic DNA from cabbage leaves;

[0056] (2) InDel amplification was performed on the genomic DNA obtained in step (1) using primer InDel22. The PCR product was detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 400 bp but no characteristic band appeared at 280 bp, InDel amplification was performed again using primer InDel24. The PCR product was detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 280 bp but no characteristic band appeared at 450 bp, InDel amplification was performed again using primer InDel5. InDel amplification was performed, and the PCR products were detected by polyacrylamide gel electrophoresis. If characteristic bands appeared at 100bp, 150bp, and 350bp, InDel amplification was continued using InDel3 primers. The PCR products were then detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 450bp, the variety was QB2; if a characteristic band appeared at 400bp, the variety was QB28; and if a characteristic band appeared at 500bp, the variety was QB107.

[0057] When using InDel24 primer for InDel amplification, if characteristic bands appear at both 280bp and 450bp, continue with InDel amplification using InDel5 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If a characteristic band appears at 350bp, but no characteristic bands appear at 100bp and 150bp, the variety is QB1. If characteristic bands appear at 100bp, 150bp, and 350bp, continue with InDel amplification using InDel3 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If characteristic bands appear at both 300bp and 450bp, the variety is QB18. If characteristic bands appear at both 300bp and 600bp, the variety is QB111.

[0058] (3) Use InDel22 primer to perform InDel amplification on the genomic DNA obtained in step (1). If a characteristic band appears at 280bp but no characteristic band appears at 400bp, continue InDel amplification using InDel24 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If a characteristic band appears at 280bp but no characteristic band appears at 450bp, continue InDel amplification using InDel5 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If characteristic bands appear at both 100bp and 350bp, the variety is QB197; if no characteristic band appears at 350bp but a characteristic band appears at 400bp, the variety is QBQ168; if no characteristic band appears at 100bp, the variety is QB120; if characteristic bands appear at both 400bp and 350bp, the variety is QB120. The variety is QB90; if a characteristic band appears at 450bp, the variety is QB171; if characteristic bands appear at 100bp, 150bp, and 300bp, InDel amplification is continued using InDel3 primers, and the PCR product is detected by polyacrylamide gel electrophoresis; if characteristic bands appear at 300bp and 500bp, the variety is QB43; if a characteristic band appears at 480bp, the variety is QB41; if characteristic bands appear at 300bp and 400bp, the variety is QB13; if characteristic bands appear at 400bp and 450bp, InDel amplification is continued using InDel34 primers, and the PCR product is detected by polyacrylamide gel electrophoresis; if a characteristic band appears at 100bp, the variety is QB12; if no characteristic band appears at 100bp, the variety is QB103.

[0059] Using InDel22 primer, the genomic DNA obtained in step (1) was amplified using InDel. If a characteristic band appeared at 280 bp but no characteristic band appeared at 400 bp, InDel amplification was continued using InDel24 primer. The PCR product was then detected by polyacrylamide gel electrophoresis. If characteristic bands appeared at both 280 bp and 450 bp, InDel amplification was continued using InDel5 primer. The PCR product was then detected by polyacrylamide gel electrophoresis. Amide gel electrophoresis was used to detect the presence of characteristic bands at 350bp, 450bp, and 450bp. The variety was QB179; a characteristic band at 350bp indicated QB161; no characteristic band at 100bp, but characteristic bands at 150bp and 350bp indicated QB46; a characteristic band at 400bp indicated QB30; and characteristic bands at 100bp, 150bp, and 350bp were also detected. Continuing with InDel3 primers, InDel amplification was performed, and the resulting PCR products were detected by polyacrylamide gel electrophoresis. If characteristic bands appeared at both 600bp and 300bp, the variety was QB3; if characteristic bands appeared at both 480bp and 500bp, the variety was QB39; if characteristic bands appeared at both 300bp and 450bp, InDel amplification was continued using InDel34 primers, and the resulting PCR products were detected by polyacrylamide gel electrophoresis. For PCR detection, if a characteristic band appears at 400bp, the variety is QB19; if no characteristic band appears at 400bp, the variety is QB121; if no characteristic band appears at 300bp or 500bp, InDel amplification is performed using InDel34 primers. The obtained PCR products are then detected by polyacrylamide gel electrophoresis. If a characteristic band appears at 420bp, the variety is QB410; if no characteristic band appears at 420bp, the variety is QB142.

[0060] (4) Use InDel22 primer to perform InDel amplification on the genomic DNA obtained in step (1). If characteristic bands appear at both 280bp and 400bp, continue InDel amplification using InDel24 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If a characteristic band appears at 280bp but no characteristic band appears at 450bp, continue InDel amplification using InDel5 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If a characteristic band appears at 400bp, the variety is QB37; if characteristic bands appear at 100bp, 150bp, and 350bp, InDel amplification is performed using InDel3 primers. The PCR products are then detected by polyacrylamide gel electrophoresis. If a characteristic band appears at 300bp, the variety is QB10; if a characteristic band appears at 250bp, the variety is QB40; and if characteristic bands appear at both 400bp and 450bp, the variety is QBJF.

[0061] Using InDel22 primers, the genomic DNA obtained in step (1) was amplified using InDel. If characteristic bands appeared at 280bp and 400bp, InDel amplification was continued using InDel24 primers. The PCR products were then detected by polyacrylamide gel electrophoresis. If characteristic bands appeared at both 280bp and 450bp, InDel amplification was continued using InDel5 primers. The PCR products were then detected by polyacrylamide gel electrophoresis. If no characteristic band appeared at 100bp, but characteristic bands appeared at 150bp and 300bp, the product was QB100; if no characteristic band appeared at 350bp, but a characteristic band appeared at 400bp, the product was QB185; if characteristic bands appeared at 100bp, 150bp, and 350bp, the product was QB185. InDel amplification was further performed using InDel3 primers, and the resulting PCR products were detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 300 bp, the variety was QB7; if characteristic bands appeared at both 300 bp and 450 bp, the variety was QB23; if characteristic bands appeared at both 350 bp and 400 bp, InDel amplification was further performed using InDel3 primers, and the resulting PCR products were detected by polyacrylamide gel electrophoresis; if characteristic bands appeared at 250 bp, the variety was QBYSGL; if no characteristic band appeared at 250 bp, the variety was QB158. sequence list <110> Jiangsu Academy of Agricultural Sciences <120> An InDel primer for differentiating cabbage varieties and its application <160> 10 <170> SIPOSequenceListing 1.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <400> 1 aacacctgaa accctcac 18 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <400> 2 tttgaaagtc acccgtaa 18 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <400> 3 actcctccca acggtctt 18 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <400> 4 gaacaggtgg cacaagat 18 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <400> 5 ttttggaaac ggtcttgt 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <400> 6 agcgactgaa tggcaccc 18 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <400> 7 aagcaaatga gcagaatga 19 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <400> 8 tttgggctgt ttaggtgg 18 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <400> 9 tgggtcagtt gtccaaag 18 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <400> 10 tcagtacgca tatcagcac 19

Claims

1. The application of InDel primers in differentiating cabbage varieties, characterized in that, The InDel primers are as follows: InDel22: F: AACACCTGAAACCCTCAC; R: TTTGAAAGTCACCCGTAA; InDel24: F: ACTCCTCCCAACGGTCTT; R: GAACAGGTGGCACAAGAT; InDel5: F: TTTTGGAAACGGTCTTGT; R: AGCGACTGAATGGCACCC; InDel3: F: AAGCAAATGAGCAGAATGA; R: TTTGGGCTGTTTAGGTGG; InDel34:F:TGGGTCAGTTGTCAAAG; R: TCAGTTACGCATATCAGCAC; The cabbage varieties mentioned include: "Jingfeng No. 1", "Qingfeng", "Zhonggan No. 11", "Zhenlv", "Lvqiu Huangguan", "Junchuan Vegas", "Qiutian No. 2", "Xiwang", "Qiantu", "Zhonggan 21", "CMS Jingfeng No. 1", "Xiatian", "Xiali", "Chunfeng", "Chunxi", "Beifang Xiadi", "Youxuan 8132", "Zaoliang", "Chaolv", "Zhenlv 55", "Xingshu 309", "Sugan 55", "Sugan 65", "Zhonggan 26", "Xiangan 097", "Meihua", "Shengxiawang", "Kangre Lvgan 40", "Kangre Lvgan 60", "Lvba 505", "Kangre Lvgan 50", "Jinyuanbao No. 1", "Huachun", "Tanchun", "Sugan 125", and "Chunqiu Tingmei". The application includes the following steps: (1) Extracting genomic DNA from cabbage leaves; (2) InDel amplification was performed on the genomic DNA obtained in step (1) using primer InDel22. The PCR product was detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 400 bp, but no characteristic band appeared at 280 bp, InDel amplification was performed again using primer InDel24. The PCR product was detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 280 bp, but no characteristic band appeared at 450 bp, InDel amplification was performed again using primer InDel5. The PCR product was detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 100 bp, 150 bp, and 350 bp, InDel amplification was performed again using primer InDel3. The PCR product was detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 450 bp, the variety was "Qingfeng". If a characteristic band appeared at 400 bp, the variety was "Qingfeng". If a characteristic band appears at 500bp, the variety is "CMS Jingfeng No. 1". If a characteristic band appears at 500bp, the variety is "Sugan 55". When using InDel primer 24 for InDel amplification, if characteristic bands appear at both 280bp and 450bp, and InDel amplification is continued using InDel primer 5, the PCR product is detected by polyacrylamide gel electrophoresis. If a characteristic band appears at 350bp, but no characteristic bands appear at 100bp and 150bp, the variety is "Jingfeng No. 1". If characteristic bands appear at 100bp, 150bp, and 350bp, and InDel amplification is continued using InDel primer 3, the PCR product is detected by polyacrylamide gel electrophoresis. If characteristic bands appear at 300bp and 450bp, the variety is "Xiwang". If characteristic bands appear at 300bp and 600bp, the variety is "Sugan 65". (3) Use InDel22 primer to perform InDel amplification on the genomic DNA obtained in step (1). If a characteristic band appears at 280bp but no characteristic band appears at 400bp, continue InDel amplification using InDel24 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If a characteristic band appears at 280bp but no characteristic band appears at 450bp, continue InDel amplification using InDel5 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If characteristic bands appear at both 100bp and 350bp, the variety is "Chunqiu Tingmei"; if no characteristic band appears at 350bp but a characteristic band appears at 400bp, the variety is "Meihua"; if no characteristic band appears at 100bp, the variety is "Zhonggan 26"; if characteristic bands appear at both 400bp and 350bp, the variety is "Chaolv". If a characteristic band appears at 450bp, the variety is "Shengxia Wang"; if characteristic bands appear at 100bp, 150bp, and 300bp, continue InDel amplification using InDel3 primers, and detect the PCR product using polyacrylamide gel electrophoresis; if characteristic bands appear at 300bp and 500bp, the variety is "Youxuan 8132"; if a characteristic band appears at 480bp, the variety is "Beifang". If characteristic bands appear at both 300bp and 400bp, the variety is "Qiutian No. 2"; if characteristic bands appear at both 400bp and 450bp, InDel amplification is continued using InDel34 primers, and the obtained PCR product is detected by polyacrylamide gel electrophoresis. If a characteristic band appears at 100bp, the variety is "Junchuan Vegas"; if no characteristic band appears at 100bp, the variety is "Xingshu 309". Using InDel22 primer, the genomic DNA obtained in step (1) was amplified using InDel. If a characteristic band appeared at 280 bp but no characteristic band appeared at 400 bp, InDel amplification was continued using InDel24 primer. The PCR product was then detected by polyacrylamide gel electrophoresis. If characteristic bands appeared at both 280 bp and 450 bp, InDel amplification was continued using InDel5 primer. The PCR product was then detected by polyacrylamide gel electrophoresis. Gel electrophoresis analysis revealed the following results: if characteristic bands appeared at both 350bp and 450bp, the variety was "Tanchun"; if a characteristic band appeared at 350bp, the variety was "Huachun"; if no characteristic band appeared at 100bp, but characteristic bands appeared at 150bp and 350bp, the variety was "Zaoliang"; if a characteristic band appeared at 400bp, the variety was "Xiatian"; if characteristic bands appeared at 100bp, 150bp, and 350bp, further analysis using InDe... The InDel amplification was continued using primer l3, and the resulting PCR products were detected by polyacrylamide gel electrophoresis. If characteristic bands appeared at both 600bp and 300bp, the variety was "Zhonggan No. 11"; if characteristic bands appeared at both 480bp and 500bp, the variety was "Chunfeng"; if characteristic bands appeared at both 300bp and 450bp, InDel amplification was continued using primer InDel34, and the resulting PCR products were detected by polyacrylamide gel electrophoresis. If a characteristic band appears at 400bp, the variety is "Qiantu"; if no characteristic band appears at 400bp, the variety is "Xiangan 097"; if no characteristic band appears at 300bp or 500bp, InDel amplification is performed using InDel34 primers. The obtained PCR product is detected by polyacrylamide gel electrophoresis. If a characteristic band appears at 420bp, the variety is "Kangre Lvgan 60"; if no characteristic band appears at 420bp, the variety is "Jinyuanbao No. 1". (4) Use InDel22 primer to perform InDel amplification on the genomic DNA obtained in step (1). If characteristic bands appear at both 280bp and 400bp, continue InDel amplification using InDel24 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If a characteristic band appears at 280bp but no characteristic band appears at 450bp, continue InDel amplification using InDel5 primer. Detect the PCR product using polyacrylamide gel electrophoresis. If a characteristic band appears at 400bp, the variety is "Xia Li"; if characteristic bands appear at 100bp, 150bp, and 350bp, the variety is "Xia Li". InDel amplification was continued using primer InDel3. The PCR products were then detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 300 bp, the variety was "Green Crown"; if a characteristic band appeared at 250 bp, the variety was "Spring Joy"; if characteristic bands appeared at both 400 bp and 450 bp, the variety was "Green King 505". InDel amplification was performed on the genomic DNA obtained in step (1) using primer InDel22. If characteristic bands appeared at 280 bp and 400 bp, the PCR products were then detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 280 bp, the PCR products were then detected by polyacrylamide gel electrophoresis. Characteristic bands appeared at 100bp and 450bp. InDel amplification was continued using primer InDel5, and the PCR products were detected by polyacrylamide gel electrophoresis. If no characteristic band appeared at 100bp, but characteristic bands appeared at 150bp and 300bp, the variety was "Zhenlv 55"; if no characteristic band appeared at 350bp, but a characteristic band appeared at 400bp, the variety was "Kangre Lvgan 40"; if characteristic bands appeared at 100bp, 150bp, and 350bp, InDel amplification was continued using primer InDel3, and the PCR products were detected by polyacrylamide gel electrophoresis. If a characteristic band appeared at 300bp... If a characteristic band appears at both 300bp and 450bp, the variety is "Zhonggan 21". If a characteristic band appears at both 350bp and 400bp, InDel amplification is performed using InDel3 primers, and the PCR product is detected by polyacrylamide gel electrophoresis. If a characteristic band appears at 250bp, the variety is "Kangre Lvgan 50". If no characteristic band appears at 250bp, the variety is "Sugan 125".

2. The application according to claim 1, characterized in that, The method for extracting genomic DNA from cabbage leaves in step (1) is as follows: Take 0.1g of tender cabbage leaves, grind them in liquid nitrogen, add 500μl of CTAB lysis buffer, transfer to a 1.5ml centrifuge tube, incubate at 65℃ for 0.5-1h, then remove and cool. Add an equal volume of chloroform / isoamyl alcohol mixture and shake gently. Centrifuge at 12000r / min for 8-10min. Extract the supernatant with chloroform / isoamyl alcohol mixture 1-2 times, add pre-cooled isopropanol, and let stand at 4℃ for more than 3 hours. Collect the flocculent DNA, wash with 70% ethanol, dry, and store the flocculent DNA in TE buffer. The CTAB lysis buffer has the following composition: 2% CTAB, 2 mol / L NaCl, 20 mmol / L EDTA, 100 mmol / L Tris-HCl, pH 8.0, and 0.2% β-mercaptoethanol; the volume ratio of chloroform to isoamyl alcohol in the chloroform / isoamyl alcohol mixture is 24:

1.

3. The application according to claim 1, characterized in that, The InDel amplification described in steps (2) to (4) uses a PCR reaction system of 20 μl, which contains 1 μl of genomic DNA, 1 μl each of upstream and downstream primers, and 10 μl of 2xEasyTaq PCR SuperMix for PAGE.

4. The application according to claim 1, characterized in that, The InDel amplification described in steps (2) to (4) is performed under the following PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 50 s, 56℃ for 50 s, 72℃ extension for 60 s, for 35 cycles; 72℃ extension for 10 min, and then stored at 4℃. The annealing temperature of InDel22 primer is 46.7℃, that of InDel24 is 47.1℃, that of InDel5 is 48.4℃, that of InDel3 is 46.5℃, and that of InDel34 is 49.1℃.

Images