Saccharomyces boulardii strain and application thereof in brewing of yellow rice wine

Abstract

A strain of saccharomycopsis fibuligera and its application in yellow rice wine brewing, comprising the steps of inoculating the selected saccharomycopsis fibuligera C-3 slant strain into an activated liquid medium, and then performing shaking culture in a shaking table, inoculating the obtained culture into a first seed culture medium, and then performing shaking culture in a shaking table, inoculating the obtained culture into a second seed culture medium, and then performing shaking culture to obtain a yeast seed culture; after rice is cooked, the rice is cooled, and then appropriate amounts of wine starter, water, active dry yeast and the yeast seed culture are added and uniformly mixed to perform yellow rice wine brewing. The saccharomycopsis fibuligera C-3 of the present application can produce ester aroma, has amylase activity, saccharifying enzyme activity and protease activity, and can accelerate the conversion rate of starch in raw materials and improve the flavor of yellow rice wine when added to the yellow rice wine brewing process.

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation technology, specifically relating to a strain of *Saccharomyces cerevisiae* and its application in rice wine brewing. Background Technology

[0002] Yellow wine is one of the oldest alcoholic beverages in the world. Its unique brewing techniques have made it a typical representative and model of Eastern brewing. Due to regional differences, the raw materials and brewing methods used in the production of yellow wine vary, resulting in differences in the microbial communities produced during the brewing process.

[0003] Research reports indicate that brewing rice wine using japonica rice as the raw material can lead to the following problems: Low raw material utilization. Because japonica rice contains a certain amount of amylose, which does not easily bind with water molecules, its water absorption rate is reduced. This hinders complete gelatinization during the rice cooking process, making it difficult for yeasts and molds to utilize the rice during subsequent fermentation, resulting in incomplete fermentation and low alcohol production. Furthermore, using only japonica rice for fermentation, without adding traditional brewing starter and active dry yeast, results in a poorer flavor, primarily reflected in differences in alcohol yield, amino acid content, and volatile flavor compounds. Rice wine fermented from japonica rice has a higher proportion of bitter and astringent amino acids, which, as precursors to flavor compounds, contribute to unpleasant flavors. In addition, rice wine brewed from japonica rice has a higher content of higher alcohols, which can negatively impact the taste, making it bitter and astringent, causing headaches, and leading to easy intoxication.

[0004] The brewing system of Shaoxing wine is an extremely complex ecosystem. Various microbial communities, including bacteria, yeasts, non-saccharifying yeasts, and molds, interact during fermentation to promote the metabolism of flavor compounds in Shaoxing wine. Most research focuses on brewing yeasts and molds, with very few reports on non-saccharifying yeasts.

[0005] *Saccharomyces cerevisiae*, a non-brewing yeast, is a type of yeast also known as *Saccharomyces cerevisiae* or *Saccharomyces cerevisiae*. It is widely found in various brewing koji (fermentation starters) and can produce amylase, acidic protease, and β-glucosidase, all of which exhibit high activity. In addition, *Saccharomyces cerevisiae* also possesses certain aroma and ester production capabilities. In the brewing industry, these enzyme activities enable *Saccharomyces cerevisiae* to ferment various raw materials to produce alcohol; its aroma and ester production capabilities, under different conditions, enhance the aroma and enrich the flavor of the wine. All of these factors determine that *Saccharomyces cerevisiae* has significant research value and development potential in the brewing industry. Summary of the Invention

[0006] The purpose of this invention is to provide a *Saccharomyces cerevisiae* strain and its application in rice wine brewing.

[0007] To achieve the above and other related objectives, the technical solution provided by the present invention is: a strain of Saccharomycopsis fibuligera, wherein the strain is Saccharomycopsis fibuligera C-3, which has been deposited at the China Center for Type Culture Collection (CCTCC) on December 19, 2022, with the accession number CCTCC NO:M 20221986.

[0008] To achieve the above and other related objectives, the technical solution provided by this invention is: the application of Saccharomycopsis fibuligera C-3 in rice wine brewing.

[0009] To achieve the above and other related objectives, the technical solution provided by the present invention is: a method for brewing rice wine, which uses the *Saccharomyces cerevisiae* strain described in claim 1 to ferment and produce rice wine.

[0010] The preferred technical solution includes the following steps:

[0011] Step 1: Inoculate the slant culture of yeast strain C-3 into activation medium and culture with shaking at 28-30℃ for 40-48h. Then, inoculate the obtained culture into the first seed culture medium and culture with shaking at 28-30℃ for 32-36h. Finally, inoculate the obtained culture into the second seed culture medium and culture with shaking at 28-30℃ for 32-36h to obtain yeast seed culture.

[0012] Step 2: After steaming the rice, add water to cool it down, then add yeast, water, active dry yeast and the yeast culture obtained in Step 1, mix well and then brew the rice wine.

[0013] The preferred technical solution is as follows: In step 2, the concentration of the seed culture is 0.5-5×10⁻⁶. 6 CFU / mL.

[0014] The preferred technical solution is: in step 2, the brewing temperature is 28-30℃ and the time is 40-48h.

[0015] The preferred technical solution is as follows: the raw material formula of the first seed culture medium includes: 100mL water, 1g yeast powder, 2g glucose, and 2g peptone; sterilized at 121℃ for 15min.

[0016] The preferred technical solution is as follows: the raw material formula of the second seed culture medium includes: 100mL water, 3g japonica rice, 0.3g yeast powder, 0.6g peptone, sterilized at 121℃ for 15min;

[0017] The preferred technical solution is as follows: After steaming the rice, add water to cool it, then add Angel active dry yeast and rice wine brewing koji activated for 30 minutes, and finally add yeast seed culture, stir evenly and start fermentation; the pre-fermentation period is 0-5 days, which requires stirring once every 4-5 hours, and the temperature is controlled at 25-32℃; the post-fermentation stage is 6-18 days, and the temperature is controlled at 18-25℃.

[0018] The preferred technical solution is to add yeast seed culture at the same time as adding active dry yeast and rice wine brewing koji.

[0019] Due to the application of the above technical solution, the advantages of this invention compared with the prior art are:

[0020] 1. The capsule-coated yeast C-3 of the present invention has amylase activity, saccharifying enzyme activity and protease activity, which is beneficial to the decomposition and utilization of raw materials in the process of rice wine brewing.

[0021] 2. The capsule-coated yeast C-3 of the present invention, as a non-brewing yeast, has aroma-producing and ester-producing characteristics. Its application in the fermentation process of rice wine is beneficial to improving the flavor and quality of rice wine. Attached Figure Description

[0022] Figure 1 Microscopic images of strain C-3 and observation of colony morphology on YPD medium.

[0023] Figure 2 Characterization of amylase and protease activity in strain C-3. Detailed Implementation

[0024] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in these embodiments.

[0025] Please see Figure 1-2 It should be noted that the structures, proportions, sizes, etc., illustrated in the accompanying drawings are merely for illustrative purposes to aid those skilled in the art and to provide a clear understanding of the invention. They are not intended to limit the scope of the invention and therefore have no substantial technical significance. Any modifications to the structure, changes in proportions, or adjustments to the size are not permitted. The following embodiments are provided to better understand the invention, but are not intended to limit it. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores.

[0026] Preservation of biological materials:

[0027] Saccharomycopsis fibuligera C-3 was deposited at the China Center for Type Culture Collection (CCTCC) on December 19, 2022, with accession number CCTCC NO:M 20221986. The address of CCTCC is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0028] Unless otherwise specified, all reagents or materials described in the following examples are commercially available.

[0029] Example 1: A strain of cladomycin and its application in rice wine brewing

[0030] Screening process:

[0031] 1. Weigh 10g of the wine sample, grind it into powder using a mortar and pestle, dissolve and dilute it with sterile water, shake it evenly with a shaker, and then inoculate it onto Bengal Red agar medium using the streak plate method and the dilution spread method respectively. Incubate in a constant temperature incubator at 28℃ for 48h to 72h. Select typical colonies and isolate and purify typical single colonies several times on new potato broth medium and YPD agar medium until a pure primary screening strain is obtained.

[0032] 2. Strain screening and colony morphology observation

[0033] The strains obtained from the initial screening were inoculated onto potato broth. After preliminary physiological and biochemical tests to determine their basic properties, including ester production, alcohol production, gas production, alcohol tolerance, and sugar tolerance, a superior yeast strain was finally selected. This strain was inoculated onto YPD agar medium, and its basic colony morphology was observed. DNA was extracted from this strain, and its 28S DNA sequence (SEQ NO. 1) was determined and compared with the NCBI database. Combined with its physiological and biochemical properties, this strain was identified as *Saccharomycopsis fibuligera*. *Saccharomycopsis fibuligera* C-3 was deposited on December 19, 2022, at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 20221986. The address of CCTCC is 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0034] 3. Enzyme production activity test of the strain on agar plates

[0035] (1) Plate amylase activity assay

[0036] The modified Czapek's medium formula is as follows: 3g sodium nitrate, 1g dipotassium hydrogen phosphate, 0.5g magnesium sulfate (heptahydrate), 0.5g potassium chloride, 0.01g ferrous sulfate, 20g soluble starch, 20g agar powder, bring the volume to 1L, pH 7.0-7.2, and autoclave at 121℃ for 20min.

[0037] If the bacterial strain being tested can utilize soluble starch as its sole carbon source, the starch surrounding the strain will be consumed, resulting in a clear zone around the colony when iodine solution is added to the plate. This is used to determine whether the strain has the ability to produce amylase.

[0038] (2) Plate protease activity assay

[0039] Casein culture medium formula (g / L): 4g casein, 0.36g potassium dihydrogen phosphate, 1.07g dipotassium hydrogen phosphate, 0.014g zinc chloride, 0.002g potassium chloride, 0.5g magnesium sulfate (heptahydrate), 0.16g sodium chloride, 20g agar powder, bring to a final volume of 1L, pH 6.5-7.0, autoclave at 121℃ for 20min.

[0040] 4. Tests on the strain's resistance to sugar, acid, and alcohol.

[0041] (1) Sugar tolerance test

[0042] Different masses of glucose were added to sterilized YPD liquid medium to make the sugar concentration of the medium 0, 5, 10, 15, 20 and 25%. Each tube was inoculated with the same concentration of yeast strain, and each group was made in triplicate. The culture was carried out at 28℃ for 48 h, and the turbidity was measured at OD540 to determine the sugar tolerance of the yeast.

[0043] (2) Acid resistance test

[0044] The pH of sterilized YPD liquid culture medium was adjusted to 3, 4, 5, 6 and 7 using a pH meter. Each tube was inoculated with the same concentration of yeast strain, and three replicates were made for each group. The culture was carried out at 28℃ for 48 h, and the turbidity was measured at OD540 to determine the acid tolerance of the yeast.

[0045] (3) Alcohol resistance test

[0046] Different volumes of anhydrous ethanol were added to sterilized YPD liquid culture medium to make the ethanol volume fraction in the medium 0, 5, 8, 10 and 15%, respectively. Each tube was inoculated with the same concentration of yeast strain, and each group was made in triplicate. The culture was carried out at 28℃ for 48 h, and the turbidity was measured at OD540 to determine the alcohol tolerance of the yeast.

[0047] 5. Determination of enzyme activity of the strain in fermentation broth using the food tasting method.

[0048] Weigh 40g of japonica rice, soak it for a certain period of time, add 60g of water, place it in a high-pressure steam sterilizer, keep it at 110℃ for 15 minutes, let the cooked rice cool naturally to room temperature, and then add 40mL of sterile water (1mL concentration is 10). 7 The yeast suspension of CFU / mL was placed in a constant temperature incubator at 28℃. According to the fermentation process of rice mash, 5g of rice sample was taken into Erlenmeyer flasks every once in a while, 45g of distilled water was added and soaked for 30min. After centrifugation at 8000r / min for 15min, the supernatant was collected for use in determining amylase activity, saccharifying enzyme activity and acidic protease activity.

[0049] 6. Application of *Saccharomyces cerevisiae* in Shaoxing wine brewing

[0050] 6.1 Scale-up culture of strain C-3

[0051] One loopful of strain C-3 slant culture was inoculated into an 18*180 test tube containing 10 mL of activated liquid culture medium and incubated statically at 28°C for 48 h. After incubation, the culture in the test tube was gently shaken to mix well, and 0.1 mL was added to a test tube containing 10 mL of culture medium using a sterile pipette. After shaking well, the culture was incubated at 28°C for 24-36 h. Then, 10 mL of the culture was inoculated into a 1 L Erlenmeyer flask containing 800 mL of seed culture medium 1 and incubated at 28°C for 24 h. Finally, the culture was inoculated into a fermenter containing 10 L of seed culture medium 2 and incubated at 28°C for 24 h to obtain the yeast seed culture.

[0052] 6.2 Application of bacterial strains in the fermentation process of rice wine

[0053] Weigh 1000g of japonica rice and add 1500ml of tap water (meeting the national standard for drinking water GB 5749-2022). Soak the rice at room temperature for 48 hours, then drain. Steam the soaked rice for 15 minutes at 110℃. After steaming, add water to cool the rice to about 40℃. Then add 0.25% of the raw material weight of yeast starter, 0.02% of the raw material weight of active dry yeast, and 10% of the raw material weight of rice. 7 Mix CFU / mL of Saccharomyces cerevisiae thoroughly and place at 25-32℃ for 5 days of pre-fermentation, stirring every 4-5 hours. Then, control the temperature at 18-25℃ for 6-18 days of post-fermentation.

[0054] Table 1 Comparison of alcohol resistance of strain C-3

[0055] 0 0.577±0.081 5％ 0.390±0.018 8％ 0.402±0.026 10％ 0.431±0.047 15％ 0.314±0.01

[0056] Table 2 Comparison of acid resistance of strain C-3

[0057] 3 0.525±0.018 4 0.702±0.016 5 1.068±0.070 6 0.880±0.076 7 0.636±0.062

[0058] Table 3 Comparison of sugar tolerance of strain C-3

[0059] 0 0 5％ 0.676±0.062 10％ 0.935±0.071 15％ 0.574±0.057 20％ 0.451±0.043

[0060] Table 1 shows that the inhibition of strain C-3's growth significantly increases with increasing alcohol content in the fermentation broth. When the alcohol content is 15%, the turbidity (OD540) of the fermentation broth is below 0.3, indicating that this strain has strong alcohol tolerance. Table 2 shows the acid tolerance test for strain C-3. It can be seen that yeast growth initially promotes growth and then inhibits it as pH increases; when the pH is above 5, yeast growth is inhibited. Table 3 shows the sugar tolerance test for strain C-3. Similar to the acid tolerance test, the growth of the strain initially promotes growth and then inhibits it as sugar content increases. The pH of the rice wine fermentation broth is around 3-7.5, and the alcohol content is greater than 8% and not exceeding 15%. Therefore, based on comprehensive analysis, this strain is suitable for rice wine fermentation systems.

[0061] Table 4. Enzyme activity of the strains in the fermentation broth determined by the rice tasting method.

[0062] 1 19.303±2.814 10.570±1.791 1.850±0.596 2 28.755±1.407 23.545±1.343 9.139±2.286 3 42.436±3.166 28.609±2.238 19.442±2.000 4 29.252±3.518 18.482±3.133 10.958±2.571 5 23.282±2.111 15.950±1.343 3.685±1.429 7 15.323±5.628 8.355±1.028 2.473±0.857

[0063] To further determine the enzyme activity changes of strain C-3 in the rice wine fermentation broth, the amylase, saccharifying enzyme, and protease activities were measured on days 1, 2, 3, 5, and 7 of fermentation. The three figures show that the enzyme activity of this strain in the rice wine fermentation broth reached its highest value on the third day, and then showed a downward trend. It is hypothesized that the early increase in enzyme activity may be due to the active microbial growth in the early stages of fermentation, when the fermentation system is suitable for yeast growth and metabolism. The later decrease in enzyme activity may be due to the consumption of nutrients in the raw materials by the microbial growth and metabolism.

[0064] Table 5. Determination of total sugar content during the fermentation of Shaoxing wine.

[0065] 1 182.398±8.168 163.697±3.501 2 143.344±6.612 136.744±7.390 3 124.367±25.671 124.917±27.226 5 54.076±2.256 47.943±0.506 7 31.084±2.207 31.359±3.189

[0066] Table 6. Determination of reducing sugar content during the fermentation of Shaoxing wine.

[0067] 1 75.908±2.439 109.132±4.236 2 72.004±4.365 90.704±2.311 3 75.363±1.155 84.350±3.081 5 32.607±1.541 36.147±2.182 7 28.976±3.595 29.521±2.311

[0068] Table 7. Determination of amino nitrogen content during rice wine fermentation.

[0069]

[0070]

[0071] Table 8. Determination of alcohol content during the fermentation process of Shaoxing wine (alcohol content is not high).

[0072] 1 2.170±0.212 2.875±0.205 2 3.415±0.573 4.790±0.453 3 5.400±0.552 7.525±0.474 5 8.740±0.113 9.100±0.042 7 9.155±0.177 9.185±0.092

[0073] The four tables above reflect the changes in total sugar, reducing sugar, amino nitrogen, and alcohol content during the fermentation of rice wine in the control and fermentation groups. The graph of total sugar content shows that the total sugar content in the control group was higher than that in the fermentation group during the first three days of fermentation. However, the reducing sugar content in the fermentation group was higher than that in the control group during the first three days of fermentation. This trend may be due to the amylase and saccharifying enzyme activities of strain C-3, which allows it to decompose starch and convert it into polysaccharides and reducing sugars. In the later stages of fermentation, due to the metabolic utilization of microorganisms in the fermentation system, yeast converts sugars into alcohol, thus the sugar content shows a decreasing trend. Amino nitrogen content can roughly reflect the changes in amino acid content during rice wine fermentation. The graph shows that throughout the entire rice wine process, the amino nitrogen content in the control group was consistently higher than that in the fermentation group. This may be because the addition of strain C-3 enhanced the synergistic effect between microorganisms, leading to the decomposition of proteins in the raw materials into amino acids, which were then converted into other flavor substances. The changes in alcohol content showed the opposite trend to those of reducing sugar content. In the early stages, the alcohol content in the fermentation group was always higher than that in the control group. In the later stages, due to yeast growth and metabolism and sugar consumption, the alcohol content in the two groups tended to be equal.

[0074] Table 9. Effects of adding strain C-3 on the amino acid content and types in Shaoxing wine fermentation.

[0075]

[0076]

[0077] Amino acids are a crucial factor influencing the sensory evaluation of brewed wines, particularly affecting their body and taste. Regarding body, the amino acid content influences the color of the wine. Generally, higher amino acid content results in a deeper color, while lower content leads to a lighter color. In terms of taste, amino acids typically exhibit sweet, umami, sour, bitter, and astringent flavors. Their flavor characteristics significantly impact the taste of brewed wines; in fact, a major difference between Chinese rice wine and other types of wine is the "amino acid flavor." Table 1 shows that the total amino acid content decreased overall after adding *Saccharomyces cerevisiae* during rice wine fermentation. This was mainly due to a decrease in the content of bitter amino acids. The bitter amino acid content in the control group was 504.057 mg / L, while the bitter amino acid content in rice wine fermented with *Saccharomyces cerevisiae* was only 377.824 mg / L. The decreases were most pronounced in histidine, leucine, arginine, and phenylalanine, decreasing by 21.4%, 30.1%, 28.5%, and 34.0%, respectively. The significantly reduced proportion of bitter amino acids also decreased their impact on flavor. The content of astringent amino acids, represented by tyrosine, also decreased significantly, from 39.010 mg / L to 24.290 mg / L. Meanwhile, the content of umami amino acids, represented by aspartic acid, and sweet amino acids, represented by methionine, significantly increased in the rice wine fermented with *Saccharomyces cerevisiae*. Notably, glycine was only detected in the rice wine fermented with *Saccharomyces cerevisiae*. Therefore, adding *Saccharomyces cerevisiae* to rice wine fermentation can effectively improve the flavor and taste of rice wine.

[0078] Table 10. Effects of adding strain C-3 on the types and contents of volatile flavor compounds.

[0079]

[0080]

[0081] Forty-five volatile compounds were detected during the fermentation of two types of Shaoxing wine. The addition of *Saccharomyces cerevisiae* significantly affected the types and contents of aroma compounds in the Shaoxing wine. Shaoxing wine fermentation mainly utilizes the enzymes produced by microorganisms to hydrolyze raw materials, combined with the fermentation action of yeast. The aroma and flavor of Shaoxing wine are related to various microbial metabolites produced during fermentation. The flavor of Shaoxing wine is the result of a delicate balance among various types of volatile flavor compounds, rather than being determined by a single flavor compound or class of compounds.

[0082] Alcohols were the most abundant flavor components in this rice wine fermentation. The total alcohol content of the control group fermented rice wine was 35.223 mg / L, while the total alcohol content of the rice wine fermented with strain C-3 was 74.700 mg / L, accounting for 91% and 79% of the total alcohol content in the control group and the fermentation group with added strain, respectively. The main alcohols in rice wine are isobutanol, isoamyl alcohol, isopropanol, and phenylethanol. Among them, isobutanol, isoamyl alcohol, and isopropanol are the main higher alcohol components, and their flavor is mainly pungent. Excessive content can easily cause headaches. As can be seen from the table, the content of higher alcohols in rice wine fermented with strain C-3 was significantly reduced. Phenylethanol is the main characteristic flavor substance of rice wine, with a mellow, pleasant, and long-lasting rose aroma. Compared with the control group, the phenylethanol content in rice wine fermented with strain C-3 increased by more than 5 times. Esters were the second most abundant flavor components after alcohols in both the control group and the rice wine fermented with strain C-3. Esters have a good aromatic flavor and are also one of the main factors affecting the flavor of rice wine. The rice wine fermented with added strain C-3 had a higher ester content (13.234 mg / L), approximately six times that of the control group. This was mainly due to higher levels of phenethyl acetate, ethyl acetate, and ethyl octanoate. Acids were present in lower amounts in this fermentation. Although the acid content in the rice wine fermented with added strain C-3 was higher than the control group, acids have a good neutralizing effect, significantly mitigating the high levels of higher alcohols and polyols in the fermented rice wine, reducing the formation of harsh flavors, and improving the overall flavor of the rice wine.

[0083] SEQ NO.1:

[0084] AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGTTATTTGTTTTTAGACCTGCGCTTAACTGCGCGGTTTAATAAACTCTTATACACAGTGTTTTTGTTTGCGAATTTGGTTTAGTTTGTTGGTTTTCATTCGAAAGGATGA AGATTGATTGCTAAATCTTATTCAGCTTTTAAACTCAGATCTCTTTTTAAGAGAAATGTATTTTTTTAATTACAACTAGTCGATTTTACAAACTAAAAGTTTAAAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGAT AAGTAATGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTATAGTATTCTATAGAGCATGCCTGTTTGAGCGTCATTTCTCTCTTAAACCTTTGGGTTTAGTATTGAAGGTTGTGTTAGCTTCTGCTAACTCCTTTGAAATGAC TTGGCAATTGATTGAGTTTTCCATATATTTGCTTAAGGATTTAATATTAGGTTCTACCAACTTATTAAATACCCTTTTGCGAAGGACTTACTCGTGTATCAAGGCCTTATAACTTTGTCATTAATTTTGACCTCAAATCAGGTAAGGATACCCGCTGAACTTAA

[0085] The above description is merely a preferred embodiment for explaining the present invention and is not intended to limit the present invention in any way. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included within the scope of protection intended by the present invention.

Claims

1. A method for brewing rice wine, characterized in that: Yellow rice wine is produced by fermentation using a yeast strain with a cystic membrane. The *Saccharomyces cerevisiae* strain is a *Saccharomyces cerevisiae* strain (… Saccharomycopsis fibuligera C-3, has been deposited at the China Center for Type Culture Collection (CCTCC) on December 19, 2022, with the strain accession number CCTCC NO:M 20221986; the method for brewing rice wine includes the following steps: Step 1: Inoculate the slant culture of yeast strain C-3 into activation medium and culture with shaking at 28-30℃ for 40-48h. Then, inoculate the obtained culture into the first seed culture medium and culture with shaking at 28-30℃ for 32-36h. Finally, inoculate the obtained culture into the second seed culture medium and culture with shaking at 28-30℃ for 32-36h to obtain yeast seed culture. Step 2: After steaming the rice, cool it to room temperature, add water at a 1:1 (w / v) ratio, then add 0.02% Angel active dry yeast (activated for 30 minutes) and 0.25% Shaoxing rice wine starter (activated for 30 minutes). Finally, add the yeast seed culture, stir well, and start fermentation. The pre-fermentation period is 5 days, requiring stirring every 4-5 hours, with the temperature controlled at 25-32℃. The post-fermentation stage is 6-18 days, with the temperature controlled at 18-25℃. The yeast seed culture concentration is 10... 7 CFU / mL, then added to the rice wine fermentation system at a 1% inoculum.

2. The method for brewing rice wine according to claim 1, characterized in that: In step 2, the brewing temperature is 28-30℃ and the time is 40-48 hours.

3. The method for brewing rice wine according to claim 1, characterized in that: The raw material formula of the second seed culture medium includes: 100mL water, 3g japonica rice, 0.3g yeast powder, 0.6g peptone, sterilized at 121℃ for 15min.

4. The method for brewing rice wine according to claim 1, characterized in that: Active dry yeast and rice wine brewing koji are added along with the C-3 seed culture of *Saccharomyces cerevisiae*.

Images