Antioxidant and antibacterial Staphylococcus aureus and its applications
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-05
- Publication Date
- 2026-08-14
AI Technical Summary
[0006]目前国内缺乏健康人群来源的皮肤菌以及功能菌株的筛选,更未见有关山羊葡萄球菌筛选的报道
Smart Images

Figure CN116515661B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, and in particular relates to an antioxidant and antibacterial Staphylococcus aureus strain and its application. Background Technology
[0002] The skin, the largest organ in the human body, acts as a barrier, protecting the body from external microorganisms, antigens, and toxins. A large number of microorganisms reside on the surface of the skin and in the hair follicles, forming the skin microbiota, which plays a vital role in maintaining skin health and is known as the skin's microbial barrier. The skin microbiota, the host skin, and the environment constitute the skin's micro-ecosystem, interacting and regulating each other to maintain a coordinated, physiological, and dynamic balance. A balanced skin micro-ecosystem is beneficial to skin health. In daily life, frequent use of cosmetics, excessive cleansing, excessive skincare, chemicals, medications, excessive ultraviolet radiation exposure, unhealthy lifestyles, and environmental pollution can lead to an imbalance in the skin micro-ecosystem. An imbalance in the skin micro-ecosystem weakens or damages the skin's biological barrier, affecting normal physiological functions, even leading to infection and accelerated skin aging.
[0003] During the body's own metabolic processes and due to external pollution and sun exposure, free radicals are constantly generated. Excessive free radical production can lead to various diseases and skin aging. Studies have shown that in photoaged skin, UV radiation increases intracellular ROS, induces elevated MMP levels, and causes the degradation of collagen and elastin, resulting in rough, loose, and wrinkled skin. However, bacteria such as Staphylococcus epidermidis and Propionibacterium acnes on the skin have a protective effect against UV-induced skin damage. Besides significantly reducing UV-induced ROS levels, they can also directly regulate the expression levels of MMPs in skin cells by influencing multiple signaling pathways, reducing the degradation of collagen and elastin after UV radiation and maintaining healthy skin.
[0004] Thanks to advancements in analytical techniques such as high-throughput sequencing, metagenomics, metabolomics, and bioinformatics, we have gained a deeper understanding of the composition, structure, and function of the human skin microbiome. Skin microbiota, playing a crucial role in the skin's microecology, are vital for maintaining skin health. Healthy skin harbors a large number of potential beneficial bacteria. Numerous studies have shown that coagulase-negative staphylococci, such as Staphylococcus epidermidis, secrete antimicrobial peptides and decompose sebum to produce short-chain fatty acids (SCFAs), nucleosides, and other metabolites. These bacteria possess various physiological functions, including antibacterial, anti-inflammatory, immunomodulatory, skin barrier enhancement, and anticancer effects, and are potential beneficial bacteria for the skin (Stacy A, Belkaid Y. Microbial guardians of skin health[J]. Science, 2019, 363(6424):227-228.).
[0005] Given the important role of skin microbiota in maintaining skin health, skin microbiota and their metabolites may be used in skin health care in the future. In 2015, a study isolated microorganisms from autologous skin and mixed them with gels to create novel cosmetics, significantly improving skin hydration (Yuichi Nodakea, Saki Matsumotoa, b. Pilot study on novel skin care method by augmentation with Staphylococcus epidermidis, an autologous skin microbe-A blinded randomized clinical trial[J]. Journal of Dermatological Science 79, 2015, 119-126). Therefore, finding beneficial bacteria in the skin for application in cosmetics has broad application prospects.
[0006] Currently, there is a lack of screening for skin bacteria and functional strains from healthy individuals in China, and there are no reports on the screening of Staphylococcus aureus. Isolating strains from healthy skin and screening and validating effective strains can lay the foundation for the development of beneficial skin bacteria and microecological skincare products. Summary of the Invention
[0007] To overcome the shortcomings of existing technologies, this invention provides a coagulase-negative staphylococcus strain—Staphylococcus caprae CCSM0335—and its applications. Experiments have shown that the fermentation broth supernatant of this strain exhibits good scavenging activity against DPPH free radicals, can reduce the ROS content in human keratinocytes induced by vitamin K3, and also has a strong antibacterial effect against Staphylococcus aureus. It shows promising application prospects in the development of anti-oxidative and antibacterial microecological skincare products.
[0008] The first objective of this invention is to provide a strain of Staphylococcus caprae CCSM0335, which was isolated from a healthy human source (on the skin of a healthy person) and deposited on June 1, 2022, at the China Center for Type Culture Collection (depository address: Wuhan University, Wuhan, China), with accession number CCTCC No: M 2022776.
[0009] The colony characteristics of the above strains are as follows: Figure 1 As shown in Figure A, strain CCSM0335 colonies on TSA blood agar plates are small and white, forming round raised areas with neat edges. The colony diameter is approximately 0.5–1 mm, the surface is smooth, moist, and opaque, and can be stretched into strings when picked up, without hemolysis zones.
[0010] The bacterial cell characteristics of the above strains are as follows: from Figure 1 B shows that it is Gram-positive. The bacteria are spherical, about 0.9-1.0 μm in diameter, arranged in a grape-like pattern, or in a single arrangement. They are non-motile, lack flagella, and do not produce spores.
[0011] The second objective of this invention is to provide a fermentation method for Staphylococcus caprae CCSM0335, characterized in that the Staphylococcus caprae CCSM0335 is inoculated into TSB liquid medium and cultured in a shaker at 30–40°C for 16–20 h, adjusting the OD of the bacterial cells. 600 The seed culture was prepared at a concentration of 0.9–1.1 g / L. Then, the seed culture was inoculated into TSB liquid medium at a volume ratio of 1–3%, and cultured at 30–40°C for 10–15 h to obtain the fermentation broth of *Staphylococcus aureus*. The fermentation broth was centrifuged to obtain the fermentation supernatant. TSB liquid medium (tryptone-soybean liquid medium): tryptone 17.0 g / L, soybean papain digest 3.0 g / L, sodium chloride 5.0 g / L, potassium dihydrogen phosphate 2.5 g / L, glucose 2.5 g / L, autoclaved at 121°C for 15 min, ready for use.
[0012] A third objective of this invention is to provide the use of Staphylococcus caprae CCSM0335 and the above-mentioned fermentation broth supernatant in skin anti-oxidation and antibacterial effects.
[0013] The fourth objective of this invention is to provide the application of Staphylococcus caprae CCSM0335 and the above-mentioned fermentation broth supernatant in combating free radical damage to the skin and preparing antioxidant and antibacterial microecological skin care products.
[0014] The aforementioned antioxidant effects include scavenging DPPH free radicals and reducing vitamin K3-induced ROS levels in human keratinocytes. The aforementioned antibacterial effects include inhibiting Staphylococcus aureus.
[0015] Currently, there are no reports on the screening of Staphylococcus aureus, a skin bacterium. This invention provides a strain of Staphylococcus aureus CCSM0335 derived from healthy human skin. Experiments have demonstrated that this strain exhibits good antioxidant and antibacterial effects, with a DPPH free radical scavenging rate of 95.60%, a ROS scavenging rate of 17.7%, and an inhibition rate against Staphylococcus aureus of 15.7% in its fermentation supernatant. Therefore, it shows promising application prospects in combating free radical damage and skin infections, and in the development of antioxidant and antibacterial microecological skincare products, filling a gap in the screening of Staphylococcus aureus for its antioxidant and antibacterial efficacy. Attached Figure Description
[0016] Figure 1 Colony morphology and microscopic images of Staphylococcus caprae CCSM0335, where A is a colony morphology image and B is a microscopic image.
[0017] Figure 2 Growth curve of Staphylococcus caprae CCSM0335;
[0018] Figure 3 Cytotoxicity of Staphylococcus caprae CCSM0335 fermentation supernatant to human skin keratinocytes;
[0019] Figure 4 The effect of Staphylococcus caprae CCSM0335 fermentation supernatant on the scavenging effect of reactive oxygen species (ROS) on human keratinocytes. Detailed Implementation
[0020] The present invention is further illustrated below by way of examples, but these examples do not limit the invention to the scope of the embodiments described. Experimental methods not specifically described in the following examples are performed according to conventional methods and conditions, or as selected according to the product instructions. It should be understood that the specific embodiments described herein are for illustrative purposes only and do not constitute a limitation thereof.
[0021] Example 1: Isolation, screening and purification of strain CCSM0335
[0022] (1) Recruiting volunteers for perfect skin
[0023] Applicants must have healthy skin, be without makeup, have smooth skin with small pores, and be free of acne, pustules, inflammation, and peeling. Those with blemishes are also welcome to participate. Applicants must not have used any ointments in the past 3 months. Applicants must be between 18 and 30 years old, and gender is not limited.
[0024] (2) Sample collection
[0025] Volunteers are required to wash their face and perform basic skincare (applying toner, lotion, etc.) the night before sampling, but not to wash their face the next morning. Sampling is generally done at noon or in the afternoon. Select an area of approximately 4cm x 4cm on the skin to be sampled. Moisten a sterile cotton swab made of polymer fiber in a wetting solution (containing 0.9% sodium chloride and 0.1% Tween-20) and rub it back and forth 50 times in the selected area (the swab should be applied with sufficient pressure). Place the sterile cotton swab into the sampling tube using sterile forceps and seal it with sealing film. Place the collected samples in an icebox for refrigeration, bring them back to the laboratory, and store them in a 4°C refrigerator for rapid bacterial isolation.
[0026] (3) Sample pretreatment
[0027] In a clean bench, use sterile scissors to cut off the sterile cotton swab tip containing the sample and place it in a 5mL centrifuge tube (EP tube). Add 5mL of sterile water to the centrifuge tube and mix thoroughly.
[0028] (4) Plate screening
[0029] Take 0.5 mL of the sample solution from step (3) and add 4.5 mL of sterile water for serial dilution. Select an appropriate dilution and spread 0.1 mL of the diluted solution onto TSA blood plates. Spread 2 plates for each dilution and place them in an incubator at 37°C for aerobic incubation for 24 h.
[0030] Tryptic soybean agar blood medium (TSA): Tryptic peptone 15.0 g / L, soybean peptone 5.0 g / L, sodium chloride 5.0 g / L, agar 15.0 g / L, autoclave at 121℃ for 15 min, cool to about 50℃, add 5% sterile defibrinated sheep blood, mix well, and pour into plates.
[0031] (5) Marking lines to distinguish purity and preservation
[0032] Based on the colony characteristics of coagulase-negative staphylococcal strains on blood agar plates, including differences in the absence of hemolytic zones, colony size, color, moisture, and luster, single colonies were picked and streaked onto TSA blood agar plates. The plates were then incubated at 37°C for 16 hours. After repeated streaking and purification, the colonies were preserved in storage tubes using a preservation medium containing skim milk powder as a protectant. After freeze-drying, the culture was stored in a -85°C cryogenic freezer.
[0033] Preservation medium: 120g skim milk powder, 880mL distilled water, autoclave at 118℃ for 15min, for later use.
[0034] The strain CCSM0335 was obtained using the above method and then subjected to microbiological identification, which was performed using the following methods.
[0035] Example 2: Microbiological identification of strain CCSM0335
[0036] (1) Colony characteristics:
[0037] Strawberry strain CCSM0335 was streaked on TSA blood agar plates and incubated at 37°C for 16 hours. The colony morphology of the strain on the plates was then observed. Results are as follows: Figure 1 As shown in A, from Figure 1 As can be seen from A, the colonies of strain CCSM0335 on TSA blood agar plates are white and small, forming round raised areas with neat edges. The colony diameter is approximately 0.5–1 mm, the surface is smooth, moist, and opaque, and can be stretched into strings when picked up, without hemolysis zones.
[0038] (2) Bacterial cell characteristics:
[0039] A small amount of strain CCSM0335 obtained in step (1) was picked and smeared on a glass slide, Gram stained, and the morphological characteristics of the bacteria were observed under a microscope. The results are shown in […]. Figure 1 As shown in B, from Figure 1 B shows that it is Gram-positive. The bacteria are spherical, about 0.9-1.0 μm in diameter, arranged in a grape-like pattern, or in a single arrangement. They are non-motile, lack flagella, and do not produce spores.
[0040] (3) Characteristics of training:
[0041] The strain CCSM0335 was inoculated into TSB liquid medium and cultured at different temperatures. The results showed that the minimum growth temperature of CCSM0335 was 15℃, the maximum growth temperature was 45℃, and the optimal growth temperature was 30-40℃. When inoculated into TSB liquid medium with different pH values and cultured at 37℃, the highest growth pH of strain CCSM0335 was 9.0, the lowest growth pH was 4.0, and the optimal growth pH was 6.0.
[0042] Tryptic soybean broth (TSB): 17.0 g / L tryptic soy peptone, 3.0 g / L soybean papain digest, 5.0 g / L sodium chloride, 2.5 g / L potassium dihydrogen phosphate, 2.5 g / L glucose. Autoclave at 121°C for 15 min.
[0043] (4) Genetic characteristics (16S rDNA sequence analysis):
[0044] CCSM0335 genomic DNA extraction method: Select a purified CCSM0335 single colony and inoculate it into 10 mL of TSB liquid medium. After incubation at 37℃ for 14-16 h, centrifuge the bacterial solution (8000 r / min, 15 min) and collect the bacterial cells.
[0045] Genomic DNA was extracted using a genomic DNA extraction kit (Sangon Biotech (Shanghai) Co., Ltd.). PCR amplification was performed using two synthetic universal primers (16S 27F: GAGAGTTGATCCTGGCTCAG; 16S 1492R: CGGCTACCTTGTTACGACTT). PCR products were recovered using a column-based PCR product purification kit (Sangon Biotech (Shanghai) Co., Ltd.) and then sent to Meiji Biotechnology (Shanghai) Co., Ltd. for sequencing. The 16S rDNA nucleotide sequence of CCSM0335 is shown in SEQ NO.1, with a length of 1383 bp. The specific sequence is as follows:
[0046]
[0047] The sample was sent to GenBank for BLAST analysis. The strain with the highest homology to strain CCSM0335 was MT023404.1, with 100% homology. According to Goodfellow and O'Donnell, species with DNA G+C (mol%) ≤10%–12% and 16S rRNA sequence homology ≥95% can be classified into the same genus. Furthermore, Embey and Stackebrangdt believe that 16S rRNA sequence homology ≥97% can be considered a single species. Therefore, it can be inferred that strain CCSM0335 and Staphylococcus caprae belong to the same species.
[0048] Based on the above-mentioned microbiological characteristics such as colony and cell morphology, culture, physiological and biochemical identification, as well as its genetic characteristics and 16S rDNA, strain CCSM0335 was identified as Staphylococcus caprae. This strain was deposited at the China Center for Type Culture Collection (CCTCC) on June 1, 2022, with accession number CCTCC NO: M 2022776.
[0049] Example 3: Plotting the growth curve of Staphylococcus aureus CCSM0335
[0050] Activated Staphylococcus caprae CCSM0335 was inoculated into TSB liquid medium at a 2% (v / v) inoculum and cultured at 37°C with shaking for 24 h. The OD value of the culture medium was measured at 600 nm every 2 h. 600 The growth curve of *Staphylococcus caprae* CCSM0335 in TSB liquid medium was obtained by plotting the values against time. The results are as follows: Figure 2 As shown, from Figure 2 As can be seen, Staphylococcus caprae CCSM0335 grows rapidly in TSB liquid medium, entering the logarithmic phase in about 2 hours and the stationary phase in about 12 hours.
[0051] Example 4: Determination of DPPH free radical scavenging rate in fermentation supernatant of Staphylococcus aureus CCSM0335
[0052] (1) Preparation of fermentation supernatant of Staphylococcus caprae CCSM0335
[0053] Staphylococcus caprae strain CCSM0335 was streaked onto TSA plates and incubated at 37°C for 16–20 h, activating the bacteria twice. The activated Staphylococcus caprae CCSM0335 was then inoculated into TSB liquid medium and cultured at 37°C with shaking for 16–20 h, adjusting the bacterial OD value. 600 The seed culture was prepared in the range of 0.9–1.1. The seed culture was inoculated into 250 mL Erlenmeyer flasks containing TSB liquid medium at a volume ratio of 2%, and cultured at 37°C and 160 rpm for 12 h to obtain the fermentation broth of *Staphylococcus capsulatum*. The fermentation broth was then centrifuged at 10000 rpm for 15 min, and the resulting supernatant was used as the fermentation supernatant.
[0054] TSB liquid medium (tryptone-soybean liquid medium): tryptone 17.0 g / L, soybean papain digest 3.0 g / L, sodium chloride 5.0 g / L, potassium dihydrogen phosphate 2.5 g / L, glucose 2.5 g / L, autoclave at 121℃ for 15 min, ready for use.
[0055] (2) The DPPH free radical scavenging rate in the metabolites of Staphylococcus caprae CCSM0335 was determined by the DPPH free radical scavenging method. The steps are as follows:
[0056] ① Prepare a DPPH stock solution (DPPH solution) with anhydrous ethanol and store it in the dark at low temperature.
[0057] Add 100 μL of sample solution and 100 μL of DPPH solution to a 96-well plate, and record the result as solution s;
[0058] Take 100 μL of sample solution and 100 μL of anhydrous ethanol solution and place them in a 96-well plate, denoted as solution b;
[0059] Take 100 μL of 50% ethanol solution and 100 μL of DPPH solution and place them in a 96-well plate, and denote it as solution c;
[0060] Mix well and react at a constant temperature of 37°C in the dark for 30 minutes.
[0061] ② Measure the OD values of the reaction solutions obtained in the As, Ab, and Ac wells at 517 nm using a microplate reader. Each reaction solution should be tested in at least three replicates, and the average value should be taken. Calculate the DPPH free radical scavenging rate using the formula:
[0062] Clearance rate = 100% × [A] c -(A s-A b )] / Ac
[0063] The DPPH free radical scavenging rate of the fermentation supernatant of Staphylococcus caprae CCSM0335 was calculated to be 95.60 ± 4.8%.
[0064] Example 5: ROS determination of human keratinocytes cleared by fermentation supernatant of Staphylococcus aureus CCSM0335
[0065] (1) Preparation of fermentation supernatant of Staphylococcus caprae CCSM0335
[0066] The preparation method is the same as step (1) in Example 4. The fermentation supernatant of Staphylococcus caprae CCSM0335 is obtained. The fermentation supernatant is concentrated to 1 / 4 of the original volume, which is the concentrated fermentation supernatant of Staphylococcus caprae.
[0067] (2) Cell Culture
[0068] Human primary keratinocytes (NEKs) were isolated from normal skin tissue and routinely cultured in Promocell complete medium (Keratinocyte Growth Medium 2, C-20011) at 37°C and 5% CO2. When the cells grew to a near-confluence state, they were passaged by trypsin digestion and passaged once every 5 days.
[0069] (3) Cell viability detection
[0070] NEKs cells in optimal growth condition were collected, treated routinely, and the cell suspension density was adjusted to 8 × 10⁻⁶. 4 -1×10 5 Cells were seeded at a density of 100 μL / well in 96-well plates and incubated at 37°C in a 5% CO2 incubator. Cells were then cultured for 24 h with concentrated fermentation supernatant of 0.1%, 0.5%, 1%, 5%, and 10% CCSM0335, respectively. A control group was included, and each experimental group had three parallel wells. After 24 h of culture, 10 μL of CCK-8 reagent (Dōnin CK-04, Japan) was added to each well, and the plates were incubated for 2 h as usual. The absorbance was measured at 450 nm using a microplate reader, with a reference wavelength of 600 nm or higher.
[0071] (4) ROS detection
[0072] NEKs cells in optimal growth condition were cultured in Promocell medium, and the density of the normal cell suspension was adjusted to 8 × 10⁻⁶. 4 -1×105 Cells were seeded at a density of 100 μL / mL in 96-well plates and incubated at 37°C in a 5% CO2 incubator. 10 μmol / L vitamin K3 was added to each well, while the experimental group received 5% CCSM0335 fermentation supernatant concentrate. 200 μmol / L vitamin E was used as a positive control. After 24 h of incubation, 1 μL of ROS fluorescent reagent (CellRox, Thermo) was added to each well, and the plates were incubated for another 4 h using standard methods. Fluorescence values were measured using a microplate reader with an excitation wavelength of 485 nm and an emission wavelength of 520 nm.
[0073] from Figure 3 It can be seen that, compared with the control group NT, the concentration of CCSM0335 fermentation supernatant at levels below 5% did not show cytotoxicity and significantly promoted the growth of human primary skin keratinocytes. Therefore, a 5% concentration of CCSM0335 fermentation supernatant was selected for ROS experiments. The experimental results showed that ( Figure 4 After treatment with vitamin K3-induced group, keratinocytes secreted a large amount of ROS. The addition of CCSM00335 fermentation supernatant concentrate significantly reduced the amount of ROS, with a ROS scavenging rate of 17.7%. It can be seen that the fermentation supernatant of Staphylococcus aureus CCSM0335 can significantly reduce the expression of ROS induced by vitamin K3, showing a good antioxidant effect.
[0074] Example 6: Determination of the antibacterial effect of Staphylococcus aureus CCSM0335 fermentation supernatant on Staphylococcus aureus
[0075] (1) Preparation of fermentation supernatant of Staphylococcus caprae CCSM0335
[0076] The same method for preparing the fermentation supernatant of Staphylococcus caprae CCSM0335 as in step (1) of Example 4.
[0077] (2) Activation of indicator bacteria Staphylococcus aureus:
[0078] Staphylococcus aureus was streaked onto TSA blood agar plates and incubated at 37°C for 18–24 h, activated twice, and then diluted with TSB liquid medium to adjust OD. 660 Between 0.08 and 0.1.
[0079] (3) Antibacterial test
[0080] Add 200 μL of sterile water to the outer ring of a 96-well plate; add 100 μL of TSB liquid medium and 100 μL of sterile water to the second column as a blank control; add 100 μL of TSB liquid medium, 50 μL of sterile water, and 50 μL of Staphylococcus aureus culture to the third column as a positive control. Add 100 μL of TSB liquid medium, 50 μL of Staphylococcus aureus culture, and 50 μL of CCSM0335 fermentation supernatant to the fourth column and mix well. Perform four replicates for each sample and incubate at 37°C for 16 h. Measure the OD after incubation. 660 According to the antibacterial rate = ((OD) 阳 -OD 空白 )-(OD 样 -OD 空白 )) / (OD 阳 -OD 空白 The antibacterial rate of the sample is calculated using this method.
[0081] Calculations showed that co-culturing the fermentation supernatant of CCSM0335 with Staphylococcus aureus resulted in an inhibition rate of 15.7% against Staphylococcus aureus, demonstrating a strong antibacterial effect.
Claims
1. A strain of Staphylococcus caprae CCSM0335, with accession number CCTCC No: M2022776.
2. The fermentation method of Staphylococcus caprae CCSM0335 according to claim 1, characterized in that, Fermentation was carried out using TSB liquid medium; the fermentation broth was centrifuged to obtain the fermentation supernatant.
3. The fermentation method as described in claim 2, characterized in that, Staphylococcus caprineis CCSM0335 was inoculated into TSB liquid medium and cultured in a shaker at 30-40℃ for 16-20 h. The OD600 of the cells was adjusted to 0.9-1.1 to serve as the seed culture. Then, the seed culture was inoculated into TSB liquid medium at a volume ratio of 1-3% and cultured at 30-40℃ for 10-15 h to obtain the fermentation broth of Staphylococcus caprineis. Centrifuge the fermentation broth to obtain the fermentation supernatant.
4. The fermentation broth supernatant prepared by the fermentation method according to claim 2 or 3.
5. The application of Staphylococcus caprae CCSM0335 as described in claim 1 or the fermentation broth supernatant as described in claim 4 in the preparation of antioxidant and antibacterial microecological skin care products; The antioxidants mentioned refer to scavenging DPPH free radicals and reducing the ROS content in human keratinocytes induced by vitamin K3. The antibacterial effect is to inhibit Staphylococcus aureus.
Citation Information
Patent Citations
Staphylococcus caprae with good antioxidant and anti-inflammatory effects and application of staphylococcus caprae
CN115725434A