High-efficiency functional microorganisms and microbial inoculants for petroleum and PAHs pollution remediation

CN116515675BActive Publication Date: 2026-09-08GUANGZHOU INSTITUTE OF GEOCHEMISTRY CHINESE ACADEMY OF SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310194426.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-02
Publication Date
2026-09-08
Estimated Expiration
2043-03-02

AI Technical Summary

Technical Problem

[0004]目前关于Pseudocercospora diplusodonii对污染物的降解研究较少,国内外也暂未有其对石油烃的降解的相关报道

Benefits of technology

[0007] A second objective of this invention is to provide a microbial agent comprising the aforementioned Pseudocercosporadiplusodonii LJD-5 as an active ingredient.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116515675B_ABST
    Figure CN116515675B_ABST
Patent Text Reader

Abstract

The application discloses efficient functional microorganisms suitable for petroleum and PAHs pollution remediation, and preparation and application of a microbial agent. The strain is Pseudocercospora diplusodonii LJD-5, and the preservation number is GDMCC No: 61905. Experiments prove that LJD-5 can utilize BaP and TPH as carbon sources, the degradation rates of BaP and TPH are 75.3% and 76.6% respectively after LJD-5 is made into a microbial agent, and the degradation rates of BaP and TPH are 90.4% and 80.61% respectively after the microbial agent is used in combination with Tween 80. It can be seen that the strain LJD-5 used in combination with Tween 80 can have a strong remediation effect on BaP and TPH. Therefore, the microbial agent has good application potential in the biological remediation of petroleum soil.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to highly efficient functional microorganisms suitable for the remediation of petroleum and PAH pollution, and the preparation and application of their inoculants. Background Technology

[0002] Oil is the lifeblood of industry and the lifeline of the world economy. However, leaks are inevitable during the extraction, transportation, and storage of oil. It is estimated that approximately 1 × 10⁻⁶ oil spills worldwide each year. 9 Petroleum and its products enter groundwater, surface water, and soil through various pathways. In my country, the rate of petroleum hydrocarbon contamination in soil reaches 23.6%. In some petrochemical areas, residual oil in the soil is more than 50 times the critical value (200 mg / kg). Petroleum pollution is an issue that urgently needs attention.

[0003] Currently, bioremediation technology has been used to remediate petroleum hydrocarbon contaminated sites. However, due to the hydrophobicity and low water solubility of petroleum hydrocarbon pollutants, their bioavailability in soil is low, making them difficult to utilize by organisms and achieve remediation goals. Adding surfactants can reduce surface and interfacial tension, facilitating the desorption of adsorbed petroleum hydrocarbon pollutants and improving the solubility of non-aqueous liquids, thereby enhancing their ability to migrate into the aqueous phase or the efficiency of microbial contact. In soil remediation, surfactants are often used as an auxiliary means to promote the migration of oil pollutants into the aqueous phase and are widely applied in the remediation of petroleum-contaminated soils. Surfactants are amphiphilic substances, either natural or synthetic, composed of both hydrophilic and hydrophobic components, including nonionic, anionic, cationic, amphoteric, gemini, and biosurfactants. Flux enhancement and solubilization are the two main mechanisms by which surfactants enhance the removal efficiency of petroleum hydrocarbon pollutants in soil and aquifers. Flux enhancement increases the migration ability of petroleum hydrocarbons in porous media; solubilization increases the apparent solubility of petroleum hydrocarbons.

[0004] Currently, there is limited research on the degradation of pollutants by Pseudocercospora diplusodonii, and there are no reports on its degradation of petroleum hydrocarbons, either domestically or internationally. Summary of the Invention

[0005] The first objective of this invention is to provide a strain of *Pseudocercospora diplusodonii* LJD-5 with the function of degrading polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons. This strain was deposited on August 31, 2021, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, 510070, China, with accession number GDMCC No. 61905.

[0006] This study reports the strain *Pseudocercospora diplusodonii* LJD-5, isolated and identified from soil samples obtained from an oil-contaminated site in Dongying, Shandong Province. Research on the degradation of pollutants by this strain is limited, and there are currently no reports, either domestically or internationally, regarding its degradation of benzo[a]pyrene (BaP) and petroleum hydrocarbons (TPH). This study domesticated and isolated a strain, LJD-5, using BaP as a carbon source, from soil samples obtained from an oil-contaminated site in Dongying, Shandong Province, and identified its species and studied its growth characteristics. Furthermore, it was formulated into a microbial agent to explore the degradation characteristics of LJD-5 on BaP and TPH, and its application in conjunction with surfactants provides a reference for the bioremediation of oil-contaminated soils.

[0007] A second objective of this invention is to provide a microbial agent comprising the aforementioned Pseudocercosporadiplusodonii LJD-5 as an active ingredient.

[0008] Preferably, the microbial agent further comprises excipients that can prolong the activity time of the strain, or other excipients acceptable to microbial agents.

[0009] A third object of the present invention is to provide a composition comprising the above-described microbial agent and surfactant.

[0010] Preferably, the surfactant is Tween 80.

[0011] A fourth object of the present invention is to provide the application of the above-mentioned Pseudocercospora diplusodonii LJD-5, the above-mentioned microbial agent, or the above-mentioned composition in the bioremediation of environments contaminated with polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons.

[0012] Preferably, the environmental pollution caused by polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons includes soil and water bodies polluted by polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons.

[0013] Preferably, the polycyclic aromatic hydrocarbon is benzo[a]pyrene.

[0014] A fifth object of the present invention is to provide a method for degrading polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons by applying the above-mentioned Pseudocercospora diplusodonii LJD-5, the above-mentioned microbial agent, or the above-mentioned composition to an environment contaminated with polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons to degrade the polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons.

[0015] Preferably, the environment polluted by polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons includes soil and water bodies.

[0016] This invention describes the domestication and isolation of a BaP-degrading strain, LJD-5, from soil samples obtained from an oil-contaminated site in Dongying, Shandong Province. Based on morphological and physiological characteristics, ITS gene sequencing analysis, and phylogenetic analysis, the strain was identified as *Pseudocercospora diplusodonii* LJD-5. The optimal growth conditions for LJD-5 were: temperature 33℃ and pH 5.0. ITS gene sequencing analysis showed that the strain most similar to LJD-5 was *Pseudocercospora diplusodonii* (99% similarity). LJD-5 can utilize BaP as a carbon source, even at an initial BaP concentration of 25 mg / L. -1 After culturing in an inorganic salt culture medium for 14 days, the degradation rate reached 73.5%. When LJD-5 was formulated into a bacterial agent, the degradation rates for BaP and TPH were 75.3% and 76.6%, respectively. When the bacterial agent was used in combination with Tween 80, the degradation rates for BaP and TPH were 90.4% and 80.61%, respectively. This demonstrates that the strain Pseudocercospora diplusodonii LJD-5, when used in combination with Tween 80, exhibits a strong remediation effect on BaP and TPH. Therefore, this bacterial agent has good application potential in the bioremediation of petroleum soils.

[0017] Pseudocercospora diplusodonii LJD-5 was deposited on August 31, 2021, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, 510070, China, with accession number GDMCC No: 61905. Attached Figure Description

[0018] Figure 1 The left and right sides of strain LJD-5 after 72 hours of growth on PDA medium.

[0019] Figure 2 Phylogenetic relationships of strain LJD-5 and its related bacteria based on ITS gene sequences were constructed using the neighbor-joining method, with a ramp value set to 1000 replicates. The figure only shows results with ramp values ​​greater than 25%, and the scale bar of 0.005 represents the substitution rate of each nucleotide.

[0020] Figure 3 The growth of strain LJD-5 under different conditions.

[0021] Figure 4 The degradation efficiency of LJD-5 bacterial agent and its combination with Tween 80 in inorganic salt media containing BaP and TPH (initial concentrations were 25 mg·L⁻¹) was measured.-1 and 500 mg·L -1 ). Detailed Implementation

[0022] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0023] Example 1: Isolation and identification of Pseudocercospora diplusodonii LJD-5

[0024] 1. Sample Source

[0025] Soil samples were obtained from an oil-contaminated site in Dongying, Shandong Province. High-concentration BaP was used as a carbon source for long-term acclimatization. Through multiple screenings and separation and purification, highly efficient BaP-based bacteria-reducing agents were obtained.

[0026] 2. Culture medium

[0027] 2.1 Inorganic Salt Culture Medium

[0028] Inorganic salt culture medium is used for the enrichment culture of microorganisms in samples, pure bacterial culture, and BaP degradation experiments under inoculum conditions. The formulation of this culture medium is shown in Table 1. It is prepared by adding each component to water, stirring to mix thoroughly, and then sterilizing.

[0029] Table 1. Inorganic Salt Culture Medium Formulation

[0030]

[0031]

[0032] 2.2 Nutrient Culture Medium

[0033] Nutrient media are used for the isolation, purification, preservation, and activation of fungi and other routine microbial cultures. The types and components of the liquid nutrient media used in this experiment are shown in Table 2. If a solid medium is required, simply add 1.5-2% agar powder to the existing medium formula. Unless otherwise specified, the pH of the medium should be adjusted to 6. The preparation method involves adding all components to water, stirring to mix thoroughly, and then sterilizing.

[0034] Table 2. Composition of Potato-Dextrose Broth Medium (PDA)

[0035]

[0036] 3. Domestication, screening, and isolation of bacterial strains

[0037] The collected contaminated soil was added to an enrichment medium, and streptomycin sulfate and penicillin (both at a final concentration of 100 μg / mL) were added to inhibit bacterial growth at a concentration of 100 mg·L⁻¹. -1 BaP was used as a substrate for degradation, and the culture was carried out in a 28°C incubator in the dark with shaking. The strain was acclimatized using an inorganic salt medium with BaP as the carbon source, with each acclimatization cycle lasting 7 days. A 10% (v / v) inoculum was then transferred to a fresh enrichment medium with the same culture system, and the enrichment process was repeated three times.

[0038] The fourth-generation enriched culture samples obtained above were separated by dilution plating using a nutrient medium. The plated samples were incubated at the original culture temperature. After approximately 48 hours, distinct single colonies formed on the surface of the medium. Several single colonies with different characteristics were selected based on their morphology, size, color, and hyphae, and then streaked onto nutrient medium plates for purification. If single colonies with different characteristics were still observed on the purified plates, they were streaked again until only single colonies with the same characteristics were observed on the same plate. A strain, LJD-5, with highly efficient BaP degradation capabilities was screened in the experiment. The purified single colonies were then cultured in appropriate solid test tubes containing nutrient medium, sealed with sterilized liquid paraffin, and stored at 4°C for long-term preservation.

[0039] 4. Strain identification

[0040] The strain was preliminarily identified based on its morphological characteristics, physiological characteristics, and hyphae.

[0041] 4.1 Morphological characteristics

[0042] LJD-5 is a fungus isolated from a soil sample obtained from an oil-contaminated site in Dongying. After activation, it can form dark gray, round colonies with a diameter of 4.6 mm after growing on PDA plates for 72 hours under aerobic conditions at 28°C. Figure 1 This bacterium is an obligate aerobic bacterium.

[0043] 4.2 Molecular biological characteristics

[0044] Molecular biological characterization mainly includes sequencing and phylogenetic tree construction. Before sequencing and constructing the phylogenetic tree, fungal DNA needs to be extracted (the rapid fungal genomic DNA extraction kit used in the experiment is from Sangon Biotech (Shanghai) Co., Ltd.). For taxonomic studies of fungi, it is usually necessary to amplify the ITS gene and construct a phylogenetic tree. The amplified gene is a segment of DNA encoded by rRNA in eukaryotes. Due to its high conservation, specificity, and suitable sequence length, it is commonly used for the detection and identification of fungi.

[0045] Polymerase chain reaction (PCR) is mainly used to amplify different gene fragments. PCR requires different primers (ITS1: 5'-TCCGTAGGTGAACCTGCGG-3'; ITS4: 5'-TCCTCCGCTTATTGATATGC-3'). The PCR amplification reaction system consists of: 10× buffer 2.5μL, Mg... 2+ 1.5 μL of 25 mmol / L primer, 0.3 μL of dNTP (25 mmol / L), 0.5 μL of forward primer (10 mmol / L), 0.5 μL of reverse primer (10 mmol / L), 0.25 μL of Taq polymerase, 0.1 μL of DNA template, and 19.35 μL of deionized water. PCR amplification conditions: 95℃ pre-denaturation for 3 min, 95℃ for 45 s, 56℃ annealing for 30 s, 72℃ extension for 45 s, 30 cycles. Final extension at 72℃ for 10 min. Store at 4℃ after the reaction. After amplifying the desired gene, a gel block was prepared using 0.75-1% agarose and the nucleic acid staining agent GelRed. The PCR product and DNA markers containing fragments of various lengths were added to the gel block, which was then placed in an electrophoresis apparatus filled with TBE (Tris borate) buffer. The apparatus was run at a specific voltage for 20 minutes, then removed and observed under a 300nm UV lamp to confirm successful PCR amplification. The successfully amplified PCR product was then sent to BGI Genomics Co., Ltd. for sequencing, using the same primers as the amplification primers.

[0046] The fungal ITS gene sequence obtained from sequencing is uploaded to NCBI. This website compares the submitted sequence with the ITS gene sequences of typical strains of recognized species to obtain sequence similarity information. Based on the sequence alignment results, the corresponding typical strain can be selected as the model strain for this experiment. Simultaneously, the ITS gene sequence of the model strain can be obtained, and a phylogenetic analysis can be constructed to demonstrate the differences between the model strain and the experimentally isolated strain, thereby identifying the isolated strain. The phylogenetic tree is constructed using the MEGA 5.05 program, typically employing the neighbor-joining method, minimum evolution method, and maximum parsimony method. The neighbor-joining method is the most commonly used, with the bootstrap value usually set to 1000 iterations.

[0047] ITS gene comparison revealed that this strain shares 99% genetic similarity with *Pseudocercospora diplusodonii*. Based on these results, the fungus LJD-5 isolated in this experiment can be identified as *Pseudocercospora diplusodonii*.

[0048] A phylogenetic tree was constructed using the ITS gene sequence of LJD-5 (as shown in SEQ ID NO.1) and highly similar ITS gene sequences to obtain the homology results between the ITS gene of LJD-5 and its highly similar ITS genes. The phylogenetic tree constructed using the adjacent-joining method is shown below. Figure 2 .

[0049] The ITS gene sequence of LJD-5 is shown in SEQ ID NO.1, specifically:

[0050] TACTGAGTGAGGGCTCCGCCCGACCTCCACCCTTTGTGAACCAAACTTGTTGCTTCGG

[0051] GGGCGACCCTGCCGACGACTTCGTCGCCGGGCGCCCCCGGAGGTCTTCTAAACACTG

[0052] CATCTTTGCGTCGGAGTTTAAACAAATTAAACAAAACTTTCAACAACGGATCTCTTGG

[0053] TTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTC

[0054] AGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCC

[0055] TGTTCGAGCGTCATTTCACCACTCAAGCCTGGCTTGGTATTGGGCGTCGCGGTTTTCCG

[0056] CGCGCCTTAAAGTCTTCCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGGATTTTTCAATT

[0057] CGCTTCGGAGTGCGGGTGGCCGCGGCCGTTAAATCTTTATTCAAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAAGCCGGAGGAA.

[0058] The above results indicate that the strain LJD-5 isolated in this invention belongs to the species *Pseudocercospora diplusodonii*, and is named *Pseudocercospora diplusodonii* LJD-5. It was deposited on August 31, 2021, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, 510070, China, with accession number GDMCC No. 61905.

[0059] Example 2: Growth conditions of Pseudocercospora diplusodonii LJD-5

[0060] 1. Determination of growth temperature: Prepare the liquid nutrient medium required for the growth of the strain (formula shown in Table 2), and sterilize it in an autoclave after preparation. Inoculate the activated strain LJB-5 into the medium (experimental group), and use the uninoculated medium as a control (control group). Incubate the medium at different temperatures for 7 days. There are three replicates for the control group and the experimental group corresponding to each temperature. The growth of bacteria should be observed every day. After 7 days, pour the medium into a weighing centrifuge tube, centrifuge at 2500 rpm for 30 min, discard the supernatant, and dry it in a 60℃ oven until constant weight. Weigh and calculate the dry weight of the fungal mycelium. The test temperatures are as follows: 18℃, 23℃, 28℃, 33℃, and 38℃.

[0061] 2. Determination of growth pH: Prepare the liquid nutrient medium required for the growth of the strain (formula shown in Table 2). Adjust the pH of the culture medium with the following buffer system: pH 4.0-5.0, 0.1 mol / L sodium citrate and 0.1 mol / L citric acid; pH 6.0-8.0, 0.1 mol / L NaOH and 0.1 mol / L KH2PO4; pH 9.0, 0.1 mol / L NaHCO3 and 0.1 mol / L Na2CO3. Inoculate the activated strain LJB-5 into the culture medium, with three replicates for each pH. Use uninoculated medium as a control. Incubate the medium at the optimal temperature for strain growth for 7 days, observing the fungal growth daily. After 7 days, pour the medium into a weighing centrifuge tube, centrifuge at 2500 rpm for 30 min, discard the supernatant, and dry in a 60℃ oven until constant weight. Weigh and calculate the dry weight of the fungal mycelium. The pH values ​​tested were as follows: 4.0, 5.0, 6.0, 7.0, 8.0, and 9.0.

[0062] The results are as follows Figure 3As shown, LJD-5 can grow in nutrient medium at temperatures ranging from 18 to 38°C, with the optimal growth temperature being the enrichment temperature of 33°C; the bacterium can also grow at pH values ​​ranging from 4.0 to 9.0, with the optimal growth pH being 5.0.

[0063] Example 3: Degradation experiments of BaP and TPH

[0064] 1. Preparation of microbial agents

[0065] (1) After heating corn and water to a mass ratio of 1:5 to form a paste, add sawdust (passed through a 200-mesh sieve), wheat bran and sodium lignin sulfonate at a mass ratio of 125:100:10:1, and knead into a ball. Place the ball-shaped culture medium mixture into a pelletizing machine to obtain spherical culture medium with a diameter of 8 mm, sterilize and dry for later use.

[0066] (2) Prepare a bacterial solution with a mycelial content of 10 g / L from the cultured LJD-5 fungus.

[0067] (3) Add the bacterial solution to a 3% sodium alginate solution at a volume ratio of 1:10, mix the above spherical culture medium with this solution, add a sterile calcium chloride solution with a final concentration of 4% by mass, and harden for 20 minutes to obtain spherical encapsulated fungi.

[0068] (4) Pack the sealed fungal pellets into a sterile culture bag and incubate them in a 28°C incubator for 3-7 days. Once the surface is covered with white mycelium, it is LJD-5 fungal agent.

[0069] 2. Based on the experimental results of Example 2, the optimal growth conditions for strain LJD-5 were determined to be a temperature of 33℃ and a pH of 5.0. Degradation experiments of LJD-5 bacterial inoculum and LJD-5 bacterial inoculum supplemented with 0.1% Tween 80 in high concentrations of BaP and TPH were conducted under these conditions. LJD-5 bacterial inoculum cultured for 7 days and LJD-5 bacterial inoculum supplemented with Tween 80 were inoculated at a mass ratio of 10% into a solution containing an initial concentration of 25 mg·L⁻¹. -1 BaP and 500 mg·L -1 The cells were cultured in TPH inorganic salt medium with shaking for 14 days, with three replicates for each treatment. The treatment without added bacterial agent served as the control.

[0070] The samples were used for chemical analysis. The specific steps are as follows: (1) Sample pretreatment: Dichloromethane was added to each culture sample for extraction. At the same time, 5 μL of 200 mg / L recovery indicator (BaP-d10) was added. After shaking, the sample was transferred to a separatory funnel and allowed to stand. After separation, the organic phase was collected. The lower liquid was returned to the shake flask and extracted again with an equal volume of dichloromethane. The extracts were combined and transferred to a flat-bottomed flask containing an appropriate amount of activated copper sheet for rotary evaporation. The solution was concentrated to about 2 mL. A small amount of n-hexane (about 5 mL) was added and the solution was rotary evaporated to 2 mL. The washing was repeated three times to replace the organic solvent with n-hexane. The concentrated solution after replacement was purified with a glass packed column (about 9 mm in diameter). The column packing from bottom to top consisted of 3 cm of 3% deactivated neutral alumina, 3 cm of 3% deactivated silica gel, and 1 cm of anhydrous sodium sulfate. The column was activated with an appropriate amount of n-hexane, and the packed column was rinsed with a 15 mL mixture of n-hexane / dichloromethane (volume ratio 1:1). Approximately 15 mL of eluent was collected in a brown reagent bottle and concentrated to approximately 0.5 mL by nitrogen blowing. The eluent was then transferred to a 1.5 mL cell culture flask and frozen. Before analysis, 5 μL of hexamethylbenzene (200 mg / L) was added as an internal standard. (2) Instrumental analysis: The PAH content in each treated sample was determined using an Agilent 7890 gas chromatograph coupled with a 5975 mass spectrometer. The chromatographic column used was an Agilent DB 5-MS capillary column (30 m long, 0.25 mm inner diameter, 0.25 μm membrane thickness). The PAH content was determined using an Agilent 7890 gas chromatograph coupled with a 5975 mass spectrometer. Separation and analysis were performed using an Agilent DB 5-MS capillary column (30 μm column length, 0.25 mm inner diameter, 0.25 μm membrane thickness). Data were processed using an Agilent chromatography workstation. BaP quantification was performed using a 6-point calibration curve and the internal standard method. Microbial cell concentrations were determined by the drying and weighing method.

[0071] Petroleum hydrocarbons (TPH) were extracted and analyzed according to the method of national standard HJ 894-2017.

[0072] GC and GC-MS measurements and analyses showed that LJD-5 bacterial agent and LJD-5 combined with Tween 80 could degrade BaP and TPH, and both were effectively degraded at concentrations of 25 mg / L. -1 BaP and 500 mg·L -1 After culturing in TPH inorganic salt medium for 14 days, the degradation rate can reach over 75%. Figure 4 The LJD-5 bacterial agent showed degradation rates of 75.3% and 76.6% for BaP and TPH, respectively. When combined with Tween 80, the degradation rates reached 90.4% and 80.61%, respectively. This indicates that LJD-5 is a potent bacterium capable of degrading BaP and TPH, and its degradation efficiency is further enhanced when combined with Tween 80.

[0073] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Pseudocercospora diplusodonii LJD-5, accession number: GDMCC No: 61905.

2. A microbial agent, characterized in that, Includes the claims 1 Pseudocercospora diplusodonii LJD-5 is the active ingredient.

3. The microbial agent according to claim 2, characterized in that, The bacterial agent also includes excipients that can prolong the activity time of the bacterial strain, or other excipients acceptable to bacterial agents.

4. A composition, characterized in that, It comprises the microbial agent and surfactant as described in claim 2.

5. The composition according to claim 4, characterized in that, The surfactant mentioned is Tween 80.

6. The claim 1 Pseudocercospora diplusodonii The application of LJD-5, the microbial agent of claim 2, or the composition of claim 4 in the bioremediation of environments contaminated with polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons, wherein the polycyclic aromatic hydrocarbon is benzo[a]pyrene.

7. The application according to claim 6, characterized in that, The aforementioned environmental pollution by polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons includes soil and water bodies polluted by polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons.

8. A method for degrading polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons, characterized in that, The claim 1 Pseudocercospora diplusodonii LJD-5, the microbial agent of claim 2, or the composition of claim 4, is applied to an environment contaminated with polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons to degrade polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons, wherein the polycyclic aromatic hydrocarbon is benzo[a]pyrene.

9. The method according to claim 8, characterized in that, The environments polluted by polycyclic aromatic hydrocarbons and / or petroleum hydrocarbons include soil and water bodies.

Citation Information

Patent Citations

  • Polycyclic aromatic hydrocarbon degradation strain P.domesticum LJD-1 as well as microbial agent and application thereof

    CN113755338A

  • Efficient degrading bacterium suitable for repairing pollution of petroleum and benzo (a) pyrene and combined application of efficient degrading bacterium and nitrogen fertilizer

    CN114989988A