Bacillus velezensis yian-sdu-015, application and reductive polysaccharide and preparation method thereof

Abstract

The present application relates to the technical field of microorganism, and particularly relates to a bacillus velezensis Yian-sdu-015, application and reducing polysaccharide and preparation method.The present application provides a bacillus velezensis Yian-sdu-015, the preservation number of the bacillus velezensis Yian-sdu-015 is CGMCC NO.20600.The reducing polysaccharide produced by the bacillus velezensis Yian-sdu-015 provided in the present application can be dissolved in water, has the effect of significantly increasing the solution viscosity, and has the free radical scavenging capacity, and has good application prospect in skin repair, solving skin problems.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a strain of Bacillus belye Yian-sdu-015, its application, reducing polysaccharide, and preparation method. Background Technology

[0002] Bacillus belesiensis ( Bacillus velezensis This strain is a type of spore-forming Gram-positive bacterium with advantages such as broad antibacterial spectrum, rapid growth, easy isolation and culture, strong stress resistance and high biosafety. As a probiotic, it has been widely studied in agriculture, food, industry, medicine, metallurgy, forestry, environmental protection and military fields. The inclusion of this strain in the catalog of feed microbial strains further illustrates its safety.

[0003] A capsule is a specialized structure on the surface of certain bacteria, a loose layer of mucus on the cell wall. The composition of the capsule varies among different bacterial species, but it is primarily a polymer of glucose and glucuronic acid; some also contain polypeptides and lipids. Capsules with indistinct boundaries are called the slime layer. The capsule plays a crucial role in bacterial survival. Bacteria not only use the capsule to defend against adverse environments and protect themselves from phagocytosis by leukocytes, but they can also selectively adhere to the surface of specific cells, exhibiting a targeted attack ability. This is specifically demonstrated in the following ways: ① Anti-phagocytic effect: Due to its hydrophilicity, positive charge, and spatial occupancy and barrier function, the capsule can effectively resist the phagocytosis of host phagocytes. It can also protect itself from the adsorption of bacteriophages. ② Adhesion effect: Capsular polysaccharides can enable bacteria to adhere to each other and to the surface of tissue cells or inanimate objects. ③ Protection against damage from harmful substances: Located on the outermost layer of bacterial cells, the capsule acts like armor, effectively protecting bacteria from or minimizing damage from various bactericidal and bacteriostatic substances, such as lysozyme, complement, antibiotics, and heavy metal ions. ④ Anti-drying effect: Capsular polysaccharides are highly hydrated molecules with a water content of over 95%, helping bacteria resist the threat of dehydration to survival.

[0004] Polysaccharides are a class of unique biomolecules produced by organisms and widely distributed in nature. They possess diverse and, in most cases, complex chemical structures, various physiological functions, and broad applications. In recent years, microbial polysaccharides, as a novel fermentation product, have demonstrated unique physicochemical properties and have been applied as emulsifiers, thickeners, stabilizers, gelling agents, suspending agents, and lubricants in various fields such as petroleum, chemical, food, pharmaceutical, environmental protection, and cosmetics. *Bacillus belyssiensis* produces abundant capsular polysaccharides during its growth, but the functions of these secreted polysaccharides have not yet been reported. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides a strain of Bacillus beleales, Yian-sdu-015, its applications, a reducing polysaccharide, and a method for its preparation. The reducing polysaccharide prepared using the Bacillus beleales strain Yian-sdu-015 described in this invention possesses antioxidant and free radical scavenging properties.

[0006] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a strain of Bacillus belye ( Bacillus velezensis The Bacillus belyssus, Yian-sdu-015, has the accession number CGMCC NO.20600.

[0007] This invention provides a synthetic culture medium for culturing Bacillus belyssaeus Yian-sdu-015 as described in the above-mentioned technical solution. The synthetic culture medium comprises the following components at the following concentrations: sodium pyruvate 2~5.0 g / L, ammonium chloride 2~20 g / L, dipotassium hydrogen phosphate 0.1~5.0 g / L, magnesium sulfate 0.1~5.0 g / L, manganese sulfate 0.1~5.0 g / L, glutamic acid 0.1~5.0 g / L, sodium malate 0.1~5.0 g / L, glycerol 0.1~5.0 g / L, thiamine 0.1~5.0 g / L, boric acid 0.1~5.0 g / L, cobalt chloride 0.001~0.01 g / L, and calcium chloride 0.001~0.01 g / L.

[0008] This invention provides the application of Bacillus belyssae Yian-sdu-015, as described in the above technical solution, in the preparation of reducing polysaccharides.

[0009] This invention provides a method for preparing reducing polysaccharides, comprising the following steps: The Bacillus berberis Yian-sdu-015 described in the above technical solution was inoculated into the synthetic culture medium described in the above technical solution and cultured to obtain a fermentation broth containing reducing polysaccharides.

[0010] Preferably, after obtaining the fermentation broth containing reducing polysaccharides, the fermentation broth is mixed with a precipitant and subjected to separation treatment to obtain purified reducing polysaccharides.

[0011] Preferably, the precipitant includes one or more of the following: ethanol with a volume concentration of 95%~100%, methanol with a volume concentration of 95%~100%, isopropanol with a volume concentration of 95%~100%, and acetone with a volume concentration of 95%~100%.

[0012] Preferably, the volume ratio of the Bacillus berberis Yian-sdu-015 fermentation broth to the precipitant is 1:1~2.

[0013] The present invention provides a reducing polysaccharide prepared by the preparation method described above, wherein the reducing polysaccharide has an inhibition percentage of 31.0% and an SOD enzyme activity of 4.99 μ / mL.

[0014] This invention provides the application of the reducing polysaccharide described in the above technical solution in the preparation of any one of products I to III, wherein the product includes: I. Antioxidant products; II. Skin repair products; III. Products for treating fungal infections.

[0015] The present invention also provides a product for repairing skin and / or treating fungal infections, wherein the active ingredient of the product includes the reducing polysaccharide described in the above-described scheme.

[0016] Beneficial effects: This invention provides a strain of Bacillus belye ( Bacillus velezensis The *Bacillus belyss* strain described in this invention, Yian-sdu-015, has the accession number CGMCC NO: 20600. The reducing polysaccharide produced by *Bacillus belyss* Yian-sdu-015 is water-soluble, significantly increases solution viscosity, and possesses free radical scavenging capabilities, showing promising application prospects in skin repair and addressing skin problems.

[0017] Furthermore, the present invention provides a synthetic culture medium that is a sugar-free, fully synthetic culture medium free of impurity monosaccharide molecules, which facilitates subsequent purification to obtain high-purity polysaccharide fermentation products; and the polysaccharide fermentation products themselves are colorless and transparent, thus solving the problem of decolorization required in the polysaccharide fermentation process by using the synthetic culture medium provided by the present invention. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0019] Figure 1 The product after centrifugation of the fermentation broth; Figure 2 The colony morphology of strain Yian-sdu-015; Figure 3 The pH and dissolved oxygen change curves during the fermentation process of Bacillus belyss Yian-sdu-015; Figure 4 SDS protein gel electrophoresis results for Bacillus belyss Yian-sdu-015; Figure 5 The image shows the antibacterial effect of Bacillus repens Yian-sdu-015. Figure 6 The experimental results are shown in Example 7.

[0020] Biological Preservation Information Bacillus belesiensis ( Bacillus velezensis Yian-sdu-015 was deposited on September 7, 2020, at the China General Microbiological Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.20600. Detailed Implementation

[0021] This invention provides a strain of Bacillus belye ( Bacillus velezensis

[0022] This invention provides a synthetic culture medium for culturing *Bacillus belyssiensis* Yian-sdu-015 as described in the above-mentioned technical solution. The synthetic culture medium comprises the following components at the following concentrations: sodium pyruvate 2-5.0 g / L, ammonium chloride 2-20 g / L, dipotassium hydrogen phosphate 0.1-5.0 g / L, magnesium sulfate 0.1-5.0 g / L, manganese sulfate 0.1-5.0 g / L, glutamic acid 0.1-5.0 g / L, sodium malate 0.1-5.0 g / L, glycerol 0.1-5.0 g / L, thiamine 0.1-5.0 g / L, boric acid 0.1-5.0 g / L, cobalt chloride 0.001-0.01 g / L, and calcium chloride 0.001-0.01 g / L. The pH of the synthetic culture medium is preferably 7.0-9.0, more preferably 7.0-8.0, and most preferably 7.0.

[0023] The synthetic culture medium of the present invention comprises sodium pyruvate at a concentration of 2-5.0 g / L, more preferably 2-4.0 g / L, more preferably 2-3.0 g / L, and most preferably 2 g / L.

[0024] The synthetic culture medium of the present invention comprises 2-20 g / L of ammonium chloride, more preferably 3-15 g / L, more preferably 3.5-10 g / L, and most preferably 4 g / L, in terms of concentration.

[0025] In terms of concentration, the synthetic culture medium of the present invention comprises 0.1~5.0 g / L of dipotassium hydrogen phosphate, more preferably 2~5.0 g / L, more preferably 3~5.0 g / L, and most preferably 5 g / L.

[0026] In terms of concentration, the synthetic culture medium of the present invention comprises 0.1~5.0 g / L magnesium sulfate, more preferably 0.2~4 g / L, more preferably 0.3~3.5 g / L, and most preferably 0.5 g / L.

[0027] In terms of concentration, the synthetic culture medium of the present invention includes 0.1~5.0 g / L of manganese sulfate, more preferably 0.1~4 g / L, more preferably 0.1~2.5 g / L, and most preferably 0.1 g / L.

[0028] The synthetic culture medium of the present invention comprises 0.1-5.0 g / L of glutamic acid, more preferably 0.1-3.5 g / L, more preferably 0.1-2 g / L, and most preferably 0.1 g / L, in terms of concentration.

[0029] In terms of concentration, the synthetic culture medium of the present invention includes sodium malate at 0.1~5.0 g / L, more preferably 0.1~4.5 g / L, more preferably 0.1~2.5 g / L, and most preferably 0.1 g / L.

[0030] The synthetic culture medium of the present invention comprises 0.1-5.0 g / L of glycerol, more preferably 2-5.0 g / L, more preferably 3.5-5.0 g / L, and most preferably 5.0 g / L.

[0031] In terms of concentration, the synthetic culture medium of the present invention includes 0.1~5.0 g / L of thiamine, more preferably 0.1~3 g / L, more preferably 0.1~2 g / L, and most preferably 0.1 g / L.

[0032] In terms of concentration, the synthetic culture medium of the present invention includes 0.1~5.0 g / L of boric acid, more preferably 0.1~3.5 g / L, more preferably 0.1~1.5 g / L, and most preferably 0.1 g / L.

[0033] In terms of concentration, the synthetic culture medium of the present invention includes 0.001~0.01 g / L of cobalt chloride, more preferably 0.001~0.008 g / L, more preferably 0.001~0.005 g / L, and most preferably 0.001 g / L.

[0034] In terms of concentration, the synthetic culture medium of the present invention includes 0.001~0.01 g / L of calcium chloride, more preferably 0.005~0.01 g / L, more preferably 0.008~0.01 g / L, and most preferably 0.01 g / L.

[0035] In the synthetic culture medium described in this invention, sodium pyruvate, magnesium sulfate, and sodium malate serve as osmotic protectants; ammonium chloride provides a nitrogen source for the strain; dipotassium hydrogen phosphate acts as a pH buffer; manganese sulfate provides the trace element manganese; glutamic acid provides amino acids; glycerol provides carbon and energy; thiamine provides vitamins; boric acid provides the trace element boron; cobalt chloride provides the trace element cobalt; and calcium chloride provides the trace element calcium. The combined use of these components further ensures the growth of the strain. Furthermore, this synthetic culture medium is a sugar-free, fully synthetic medium, free of impurity monosaccharide molecules, facilitating subsequent purification to obtain high-purity polysaccharide fermentation products. Moreover, the synthetic culture medium provided by this invention is itself colorless and transparent, lacking substances commonly used in fermentation processes such as glucose and peptone that produce color. Therefore, the synthetic culture medium described in this invention will not produce pigments after sterilization. Thus, the synthetic culture medium provided by this invention also solves the problem of decolorization required in polysaccharide fermentation processes.

[0036] Based on the advantages of *Bacillus belyceae* Yian-sdu-015 described in the above technical solution, this invention provides the application of *Bacillus belyceae* Yian-sdu-015 described in the above technical solution, or *Bacillus belyceae* Yian-sdu-015 cultured using the culture method described in the above technical solution, in the preparation of reducing polysaccharides. The *Bacillus belyceae* Yian-sdu-015 of this invention exhibits a high extracellular polysaccharide yield under sufficient oxygen conditions, reaching up to 10 g / L after fermentation.

[0037] This invention provides a method for preparing reducing polysaccharides, comprising the following steps: The Bacillus berberis Yian-sdu-015 described in the above technical solution was inoculated into the synthetic culture medium described in the above technical solution and cultured to obtain a fermentation broth containing reducing polysaccharides.

[0038] In this invention, the seed culture of *Bacillus belyssiensis* Yian-sdu-015 described in the above-described technical solution is preferably inoculated into the synthetic culture medium described in the above-described technical solution for cultivation, to obtain a fermentation broth containing reducing polysaccharides. During cultivation, the inoculation amount of the *Bacillus belyssiensis* Yian-sdu-015 seed culture is preferably 0.2% to 10% of the volume of the synthetic culture medium, more preferably 0.5% to 9%, even more preferably 1% to 8%, and more preferably 2% to 7%. In specific embodiments of this invention, the inoculation amount of *Bacillus belyssiensis* Yian-sdu-015 is preferably 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%. The synthetic culture medium is preferably a synthetic culture medium obtained after sterilization at 121°C for 20 minutes; the components and concentrations of the synthetic culture medium have been discussed in detail above, and therefore will not be repeated here. The culture temperature described in this invention is preferably 25~37℃, more preferably 28~35℃, even more preferably 30~32℃, and most preferably 30℃; the culture time is preferably 20~24h, even more preferably 24h; the rotation speed is preferably 200~500rpm, even more preferably 350rpm; and the aeration rate is preferably 0.3~0.7VVM, even more preferably 0.5VVM.

[0039] Before the cultivation, the present invention preferably prepares a seed culture medium of *Bacillus belyssiensis* Yian-sdu-015. The preparation method of the *Bacillus belyssiensis* Yian-sdu-015 seed culture medium preferably includes the following steps: inoculating the *Bacillus belyssiensis* Yian-sdu-015 into the synthetic culture medium and culturing it on a shaker to obtain the *Bacillus belyssiensis* Yian-sdu-015 seed culture medium. The synthetic culture medium of the present invention is preferably a synthetic culture medium obtained after sterilization at 121°C for 20 min. The components and concentrations of the synthetic culture medium have been discussed in detail above, and therefore will not be repeated here. The shaking culture temperature of the present invention is preferably 25~37°C, more preferably 28~35°C, more preferably 30~32°C, and most preferably 30°C; the time is preferably 20~24 h, more preferably 21~23 h; the rotation speed is preferably 180~220 rpm, more preferably 190~210 rpm. The preferred inoculation amount of Bacillus belye Yian-sdu-015 in this invention is 1% to 5% of the volume of the synthetic culture medium, more preferably 2% to 4%.

[0040] After obtaining the fermentation broth containing reducing polysaccharides, the present invention preferably mixes the fermentation broth of *Bacillus beryl* Yian-sdu-015 with a precipitant and performs separation treatment to obtain the reducing polysaccharides. The mixing time is preferably 5-10 min, more preferably 6-8 min, and the volume ratio of the *Bacillus beryl* Yian-sdu-015 fermentation broth to the precipitant is preferably 1:1-2, more preferably 1:1. The present invention does not impose any requirements on the mixing method; any method well known to those skilled in the art can be used. The separation treatment includes filtering or centrifuging the fermentation supernatant obtained after mixing the fermentation broth of *Bacillus beryl* Yian-sdu-015 with the precipitant; the centrifugation speed is preferably 8000 rpm, and the centrifugation time is preferably 30 min; the filtration is preferably performed using a 0.2-micron microporous membrane.

[0041] Before obtaining solid crude polysaccharide after the separation process, the present invention preferably dries the liquid obtained from the separation process, and the drying time is preferably 2 hours and the temperature is preferably 60°C.

[0042] The precipitant of the present invention preferably includes one or more of the following: ethanol with a volume concentration of 95%~100%, methanol with a volume concentration of 95%~100%, isopropanol with a volume concentration of 95%~100%, and acetone with a volume concentration of 95%~100%. More preferably, it includes one or more of the following: ethanol with a volume concentration of 95%~100%, methanol with a volume concentration of 95%~100%, isopropanol with a volume concentration of 95%~100%, and acetone with a volume concentration of 95%~100%.

[0043] When the precipitant comprises four components, the volume ratio of ethanol, methanol, isopropanol and acetone in the precipitant is preferably 1.0~1.2:1.0~1.4:1.0~1.3:1.0~1.5, more preferably 1.0~1.1:1.0~1.2:1.0~1.1:1.0~1.2; When the precipitant comprises three components, the precipitant comprises ethanol, methanol, and isopropanol; ethanol, methanol, and acetone; ethanol, isopropanol, and acetone; or methanol, isopropanol, and acetone. When the precipitant comprises ethanol, methanol, and isopropanol, the volume ratio of ethanol, methanol, and isopropanol is preferably 1.0~1.2:1.0~1.4:1.0~1.3, more preferably 1.0~1.1:1.0~1.2:1.0~1.1. When the precipitant comprises ethanol, methanol, and acetone, the volume ratio of ethanol, methanol, and acetone is preferably 1.0~1.2:1.0~1.4; 1.0~1. 4, more preferably 1.0~1.1:1.0~1.2:1.0~1.1; when the precipitant includes ethanol, isopropanol and acetone, the volume ratio of ethanol, isopropanol and acetone is preferably 1.0~1.2:1.0~1.4; 1.0~1.4, more preferably 1.0~1.2:1.0~1.1:1.0~1.2; when the precipitant includes methanol, isopropanol and acetone, the volume ratio of methanol, isopropanol and acetone is preferably 1.0~1.2:1.0~1.4; 1.0~1.2, more preferably 1.0~1.2:1.0~1.1:1.0~1.1; When the precipitant comprises two components, the precipitant comprises ethanol and methanol, or methanol and isopropanol, or isopropanol and acetone, or ethanol and isopropanol, or ethanol and acetone, or methanol and acetone; when the precipitant comprises ethanol and methanol, the volume ratio of ethanol to methanol is preferably 1.0~1.4; 1.0~1.5, more preferably 1.0~1.2:1.0~1.1; when the precipitant comprises methanol and isopropanol, the volume ratio of methanol to isopropanol is preferably 1.0~1.2; 1.0~1.4, more preferably 1.0~1.2:1.0~1.1; when the precipitant comprises isopropanol and acetone, the volume ratio of isopropanol to acetone is preferably... The volume ratio of ethanol to isopropanol is preferably 1.0~1.4; 1.0~1.5, more preferably 1.0~1.2:1.0~1.1; when the precipitant includes ethanol and isopropanol, the volume ratio of ethanol to isopropanol is preferably 1.0~1.4; 1.0~1.2, more preferably 1.0~1.1:1.1~1.2; when the precipitant includes ethanol and acetone, the volume ratio of ethanol to acetone is preferably 1.0~1.4; 1.0~1.2, more preferably 1.0~1.2:1.0~1.1; when the precipitant includes methanol and acetone, the volume ratio of methanol to acetone is preferably 1.0~1.2; 1.0~1.4, more preferably 1.0~1.2:1.0~1.1.

[0044] The preferred volume ratio of the Bacillus vesiculosus Yian-sdu-015 fermentation broth to the precipitant in this invention is 1:1, that is, the Bacillus vesiculosus Yian-sdu-015 fermentation broth and the precipitant are mixed in equal volumes.

[0045] After obtaining the solid crude polysaccharide, the present invention preferably further purifies the solid polysaccharide. The specific steps of the purification process of the present invention are as follows: mixing the solid crude polysaccharide with water to obtain a crude polysaccharide solution; in the present invention, the mass ratio of the solid crude polysaccharide to water is preferably 1.0~1.2:1.0~1.5, more preferably 1.0~1.1:1.0~1.4; After mixing the crude polysaccharide solution with the treatment liquid, the mixture is shaken and separated to obtain an organic phase and an aqueous phase. The volume ratio of the crude polysaccharide solution to the treatment liquid is preferably 1:(1~3), more preferably 1:1, 1:2, or 1:3. The treatment liquid includes chloroform and isoamyl alcohol. The volume ratio of chloroform to isoamyl alcohol is preferably 2.0~25.0:1.0~2.0, more preferably 25:1. The shaking method is preferably vigorous shaking. This invention does not limit the specific method of vigorous shaking; any method well known to those skilled in the art can be used. The separation process preferably includes standing or centrifugation. The standing time is preferably 10 min~40 min, more preferably 20 min~30 min. The temperature is preferably 4℃~8℃, more preferably 5℃~7℃. The centrifugation time is preferably 20 min~40 min, more preferably 20 min~30 min, and the centrifugation speed is preferably 6000 rpm~8000 rpm, more preferably 6500 rpm~7500 rpm.

[0046] After mixing the aqueous phase and the treatment liquid, the mixture is shaken and separated to obtain reduced polysaccharides, i.e., purified polysaccharides. In this invention, the volume ratio of the aqueous phase to the treatment liquid is preferably 1.0~2.0:1.0~4.0, more preferably 1.0~1.5:2.0~3.0. The treatment liquid of this invention has been described in detail above and will not be repeated here. The shaking method is preferably vigorous shaking. This invention does not limit the specific method of vigorous shaking, and any method known to those skilled in the art can be used. The separation treatment of this invention preferably includes standing or centrifugation. The standing time is preferably 24h~48h, more preferably 28h~46h, more preferably 30~40h. The temperature is preferably 4℃~8℃, more preferably 5℃~7℃. The centrifugation time is preferably 20min~40min, more preferably 20min~30min, and the rotation speed is preferably 6000rpm~8000rpm, more preferably 6500rpm~7500rpm.

[0047] This invention provides a reducing polysaccharide prepared by the preparation method described above, wherein the reducing polysaccharide is prepared from Bacillus belye Yian-sdu-015.

[0048] This invention provides the application of the reducing polysaccharides described in the above-mentioned technical solutions in the preparation of any one of products I to III, wherein the products include: I, antioxidant products; II, skin repair products; III, products for treating fungal infections. Preferably, the products of this invention include pharmaceuticals. Preferably, the fungi of this invention include one or more of *Candida utilis*, *Saccharomyces cerevisiae*, and *Pichia pastoris*.

[0049] This invention also provides a product for repairing skin and / or treating fungal infections, wherein the active ingredient of the product is a reducing polysaccharide prepared by the above-described technical solution. The product of this invention preferably comprises a drug. When the product of this invention is a drug, the concentration of the reducing polysaccharide in the drug is preferably 1.0% to 5.0%, more preferably 1.0% to 1.2%; the dosage of the drug is preferably 0.5 mL to 5 mL, more preferably 1 mL; the frequency of use of the drug is preferably once / day to three times / day, more preferably twice / day. The course of treatment of the drug is preferably 3 days to 30 days, more preferably 7 days to 14 days.

[0050] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0051] Example 1 Isolation and identification of Bacillus belye Yian-sdu-015 The Bacillus belye of this invention, Yian-sdu-015, was isolated from sandy soil used for coastal vegetable cultivation in Jimo, Qingdao. The isolation method was as follows: 1. Strain Screening: Soil samples were added to prepared phosphate buffer and incubated in a constant temperature shaking incubator at 30℃ for 1 hour with shaking. Then, bacterial suspension was taken from the conical flask and serially diluted 10-fold. 10... -4 ~10 -6 The diluted solution was spread onto nutrient agar plates and incubated at 30°C. The nutrient agar medium formula was as follows: per liter of nutrient agar medium, the components were 10g peptone, 3g beef extract powder, 5g sodium chloride, 15g agar, and the remainder water; the pH was 7.3±0.2. 2. Strain purification: Incubate the prepared nutrient agar plates at 30°C. After colonies grow, select a single colony based on its morphological characteristics and streak it onto a new nutrient agar plate. Incubate at 30°C. After colonies grow, select a single colony and streak it again. Repeat this process until all colonies growing on the petri dish are of a single morphology, thus ensuring complete strain purification. Colonies exhibiting colorless or translucent, viscous characteristics characteristic of extracellular polysaccharide production were selected, numbered, and inoculated into liquid culture medium. The medium was cultured at 30°C for 24 hours. The liquid culture medium consisted of the following components at the following concentrations: 10 g / L peptone, 5 g / L yeast extract, 1 g / L sodium chloride, and 10 g / L glycerol. If the fermentation broth became viscous, the extracellular fermentation product was identified as a polysaccharide; if it did not become viscous, the culture was abandoned. After identification, a strain with the highest fermentation polysaccharide content, exhibiting the highest sensory viscosity, was found. This strain was the extracellular polysaccharide-producing strain required for this invention and was named Yian-sdu-015.

[0052] 3. Identification of the strain: Morphological characteristics were observed after culturing the Yian-sdu-015 strain on LB agar solid medium at 30℃ for 1 day. The results are as follows: Figure 2 As shown, the colonies of this strain are round, white, opaque, and dry on the surface, with a mucus layer inside, and are easily picked up. The strain is rod-shaped and secretes large amounts of extracellular polysaccharides.

[0053] Add 1% carbon source by volume of LB liquid medium to LB liquid medium. The carbon source is one of starch, sorbitol, lactose, glycerol, peptone, and glucose. The LB liquid medium contains 10 g / L peptone, 5 g / L yeast extract, and 1 g / L sodium chloride. The Yian-sdu-015 strain was inoculated into LB liquid medium containing different carbon sources and fermented at 180-200 rpm and 30℃ for 24 h to obtain the fermentation broth of the Yian-sdu-015 strain. The inoculation amount was 2-4% of the volume of LB liquid medium containing different carbon sources. The fermentation broth of the Yian-sdu-015 strain was observed. Observation revealed the following physiological and biochemical characteristics of the strain: Gram-positive, aerobic, with poor growth when glucose was used as the carbon source, but good growth when sorbitol was present in the medium. The strain can utilize starch, sorbitol, and lactose as carbon sources. Its glucose utilization ability is weak; the strain grows best when sorbitol is used as the carbon source, followed by glycerol; and it grows well in organic nitrogen-based protein sources.

[0054] The fermentation broth of strain Yian-sdu-015 was mixed with ethanol to precipitate the product, and then the precipitate was dried to obtain extracellular polysaccharides. The volume ratio of the fermentation broth to ethanol was 1:1, and the ethanol was 95% by volume. The drying conditions were 2 hours and 60°C. The yield of extracellular polysaccharides was investigated. The results showed that, based on the difference in the effect of liquid volume on the viscosity of the product, it was inferred that a smaller liquid volume resulted in a higher viscosity, thus requiring more oxygen. Therefore, the yield of extracellular polysaccharides was higher under sufficient oxygen conditions, reaching up to 10 g / L after fermentation. High concentrations of glucose inhibited the growth of the strain and reduced the yield of extracellular polysaccharides; the strain did not secrete pigments.

[0055] 4. Molecular biological analysis Using the genome of strain Yian-sdu-015 as a template, amplification was performed using universal primers: 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID No. 2); 1492R: GGTTACCTTGTTACGACTT (SEQ ID No. 3). The nucleotide sequence of the strain's 16SRNA is shown in SEQ ID No. 1. Online homology comparison between the strain's gene sequence and sequences in the NCBI database showed a 91% sequence similarity to *Bacillus belyssiensis*.

[0056] Based on morphological, physiological and biochemical tests and molecular biological analysis, the strain was identified as Bacillus belesii and named Bacillus belesii Yian-sdu-015.

[0057] Example 2: Fermentation of Bacillus belye Yian-sdu-015 to produce extracellular polysaccharides The *Bacillus belyss* Yian-sdu-015 obtained in Example 1 was inoculated into a synthetic culture medium and cultured on a shaker to obtain a *Bacillus belyss* Yian-sdu-015 seed culture solution. The synthetic culture medium consisted of the following components at the following concentrations: sodium pyruvate 2 g / L, ammonium chloride 4 g / L, dipotassium hydrogen phosphate 5 g / L, magnesium sulfate 0.5 g / L, manganese sulfate 0.1 g / L, glutamic acid 0.1 g / L, sodium malate 0.1 g / L, glycerol 5.0 g / L, thiamine 0.1 g / L, boric acid 0.1 g / L, cobalt chloride 0.001 g / L, and calcium chloride 0.01 g / L, dissolved in deionized water, with a pH of 7.0. The synthetic culture medium was obtained after sterilization at 121°C for 20 min. The shaker culture conditions were preferably 30°C, 24 h, and 180 rpm. The inoculation amount of *Bacillus belyss* Yian-sdu-015 was 2% of the volume of the synthetic culture medium.

[0058] Prepare 30L of fermentation medium: sodium pyruvate 2g / L, ammonium chloride 4g / L, dipotassium hydrogen phosphate 5g / L, magnesium sulfate 0.5 g / L, manganese sulfate 0.1g / L, glutamic acid 0.1g / L, sodium malate 0.1g / L, glycerol 5.0g / L, thiamine 0.1g / L, boric acid 0.1g / L, cobalt chloride 0.001g / L, and calcium chloride 0.01g / L, dissolved in deionized water, with a pH of 7.0.

[0059] The above culture medium was added to a 50L fermenter. The culture conditions were: temperature 30℃, culture period 24h, stirring speed 350rpm, aeration rate 0.5VVM, and the inoculation amount of Bacillus belyssus Yian-sdu-015 seed culture was 2% of the fermentation medium volume. After the culture was completed, the fermentation broth was obtained. The extracellular polysaccharides were roughly measured by the ethanol precipitation method, and it was found that the strain secreted a large amount of extracellular polysaccharides.

[0060] The fermentation broth was centrifuged at 8000 rpm for 20 min to remove bacterial cells. An equal volume of anhydrous ethanol was then added to the supernatant, followed by filtration. The precipitate was collected and dried at 60℃ for 2 h to obtain crude polysaccharide. The crude polysaccharide content in the fermentation broth was measured to be 10.5 g / L. The pH and dissolved oxygen changes during the fermentation process are shown in the curves below. Figure 3 As shown. By Figure 3 It can be seen that the strain consumed a large amount of oxygen in the later stages of growth, causing the dissolved oxygen level to drop to zero.

[0061] Example 3 The fermentation broth prepared in Example 2 was centrifuged at 8000 rpm for 30 min. The resulting product image is shown below. Figure 1 As shown, after removing the bacterial cells and collecting the supernatant, a cell-free fermentation broth was obtained. Utilizing the characteristic of protein denaturation in organic solvents such as trichloroethane, the Sevage method was employed. The cell-free fermentation broth was mixed with Sevage reagent at a volume ratio of 5:1, where Sevage reagent is a mixture of chloroform and n-butanol at a volume ratio of 5:1. The mixture was shaken and centrifuged at 6000 rpm for 10 min to obtain the treated cell-free fermentation broth. The denatured proteins were located at the interface between the cell-free fermentation broth and the Sevage reagent. The viscosity of the fermentation broth did not change significantly, and no precipitation occurred, indicating that the high-viscosity supernatant had a low protein content.

[0062] The cell-free fermentation broth after treatment was subjected to SDS protein gel electrophoresis, and the results are as follows: Figure 4 As shown, there is a weak band near 70 kDa. This indicates that the cell-free fermentation broth contains trace amounts of protein.

[0063] Example 4: Application of extracellular polysaccharides in scavenging free radicals The free radical scavenging capacity of the supernatant obtained in Example 2 was determined using the Solarbio DPPH free radical scavenging capacity test kit. The specific steps were as follows: preheat the spectrophotometer for more than 30 minutes, adjust the wavelength to 515 nm, and zero the instrument with anhydrous ethanol. Preparation of positive control: Prepare a 0.3 mg / mL vitamin C solution from a 10 mg / mL vitamin C solution using the extraction buffer; After vortexing the groups in Table 1, follow the steps outlined below: Incubate at room temperature in the dark for 30 minutes, and record the absorbance at 515 nm as A blank, A assay, A control, and A positive control, respectively. Each assay tube should include a control tube. A blank is used to calibrate the zero point of the photometer, and A control is used to calibrate the measured data. The positive control standard curve and blank tube only need to be measured 1-2 times. Reagents 1, 3, the extraction solution, and the working solution are all reagents from the kit. The kit is Solarbio DPPH Free Radical Scavenging Ability Assay Kit, catalog number BC4750. Refer to the kit's instructions for specific steps.

[0064] Table 1 Components of different groups

[0065] Formula for calculating the free radical scavenging rate of the positive control: DPPH free radical scavenging rate Dvc% = [(A blank - A positive control) ÷ A blank] × 100%; The formula for calculating the free radical scavenging rate of a sample is: DPPH free radical scavenging rate D% = [[A blank - (A assay - A control)] ÷ A blank] × 100%; The free radical scavenging data of the positive control VC solution were measured as follows: Blank A was 1.141, and Positive Control A was 0.055. Substituting the data of Blank A and Positive Control A into the formula, the free radical scavenging rate of the positive control was (1.141-0.055) / 1.141×100%=95.2%. The free radical scavenging data of the fermentation supernatant of Bacillus belyss Yian-sdu-015 were measured: A was 0.685, and A control was 0.033; therefore, the free radical scavenging rate of the supernatant was: [1.141 - (0.685 - 0.033)] / 1.141 × 100% = 42.9%. This shows that the free radical scavenging rate of the fermentation broth supernatant described in this invention is 42.9%, indicating that it is effective and significantly effective in scavenging free radicals.

[0066] Example 5: Detection of Superoxide Dismutase (SOD) Activity in Fermentation Broth The free radical scavenging ability of the cell-free fermentation broth prepared in Example 3 was determined using the Solarbio superoxide dismutase (SOD) activity assay kit and recorded as a sample.

[0067] Measurement steps: 1. Preheat the spectrophotometer for at least 30 minutes, adjust the wavelength to 560nm, and zero the instrument with distilled water; 2. Before the test, incubate reagents 1, 3, and 4 in a water bath at 25°C for at least 5 minutes; 3. Add the reagents listed in Table 2 to the EP tubes and label them as test tube, control tube, blank tube 1, and blank tube 3, respectively. Reagent 1, Reagent 2, Reagent 3, and Reagent 4 are all reagents from the kit. The kit is Solarbio Superoxide Dismutase (SOD) Activity Assay Kit, catalog number BC0170. Refer to the kit's instructions for specific steps. Table 2. Specific reagent information (μL)

[0068] 4. Thoroughly mix the samples obtained according to Table 2, incubate in a 37℃ water bath for 30 min, and then measure the absorbance at 560 nm in a 1 mL glass cuvette. Record the results as Ameasurement, Acontrol, A1 blank, and A2 blank, respectively. The results are: Ameasurement = 0.656, Acontrol = 0.012, A1 blank = 1.014, and A2 blank = 0.080. Calculate ΔAmeasurement = Ameasurement - Acontrol, ΔAblank = A1 blank - A2 blank. If there is sediment at the bottom, mix thoroughly before measurement. Only 1-2 blank tubes and 1 control tube are needed for blank tubes 1 and 2. Calculation of inhibition percentage: Inhibition percentage = (Δblank - ΔA determination) / ΔA blank × 100%. Substituting Δblank and Δ determination into the formula, we obtain the inhibition percentage of the fermentation broth prepared in Example 2: (0.934 - 0.644) / 0.934 × 100% = 31.0%. Aim for an inhibition percentage of 30-70%, with a closer reading to 50% being more accurate. If the calculated inhibition percentage is less than 30% or greater than 70%, the sample volume needs to be adjusted and the measurement repeated. If the measured inhibition percentage is too high, the sample needs to be diluted appropriately; if the measured inhibition percentage is too low, a higher concentration sample needs to be prepared or the sample volume in the operating table needs to be increased, while reducing the volume of the same amount of distilled water.

[0069] SOD enzyme activity unit: When the inhibition percentage is 50% in the above xanthine oxidase coupling reaction system, the SOD activity in the reaction system is defined as 1 pre-activity unit.

[0070] SOD enzyme activity calculation: SOD activity (U / mL) = [Inhibition percentage ÷ (1 - Inhibition percentage) × Vtotal] ÷ Vsample × F, where F is the dilution factor 1.0; Vtotal is the total volume of the reaction system; and Vsample is the sample volume. Substituting the inhibition percentage of the cell-free fermentation broth prepared in Example 3 into the formula, the SOD enzyme activity of the fermentation broth prepared in Example 2 is obtained: 11.11 × inhibition percentage ÷ (1 - inhibition percentage) × F = 11.11 * 0.31 ÷ 0.69 × 1 = 4.99 μ / mL. The inhibition rate of the cell-free fermentation broth described in this example is higher than that of other strains.

[0071] Example 6: Skin repair effect of the fermentation broth prepared in Example 2 In vitro experiments confirmed that *Bacillus belyssiensis* Yian-sdu-015 has an inhibitory effect on fungi. Specifically, *Candida utilis* was selected as the substrate bacteria, and the inhibitory effects of wild-type *Pseudomonas fluorescens*, mutant *Pseudomonas fluorescens* ret gene, *Bacillus polymyxa*, *Bacillus belyssiensis* Yian-sdu-015, *Bacillus tekirae*, and *Candida utilis* on *Candida utilis* were determined using the filter paper disc method. Among these, *Bacillus belyssiensis* Yian-sdu-015 was cultured to 10... 7 Cell-free fermentation broth prepared at the CFU / ml level was used in a volume of 10 μL, and the results were as follows: Figure 5 As shown: Figure 5 In the study, Pw represents wild-type *Pseudomonas fluorescens*, p△ represents mutant *Pseudomonas fluorescens* with the ret gene, and most are *Bacillus polymyxa*. "Bei" represents *Bacillus belye* Yian-sdu-015, "Te" represents *Bacillus tegira*, and "Yeast" represents *Candida utilis*. It was found that only *Bacillus belye* Yian-sdu-015 and *Bacillus tegira* exhibited inhibition zones against *Candida utilis*, indicating that these two strains have a significant inhibitory effect on *Candida utilis*.

[0072] Example 7 Typical patient: Wu**, male, 37 years old, symptoms: skin infection caused by fungal infection. The experiment began on July 30, 2022, in Qingdao, Shandong Province. 1 mL of the supernatant prepared in Example 2 was applied daily until August 4, 2022. Experimental results are as follows: Figure 6 As shown, the supernatant prepared in Example 2 has a good repair effect on skin diseases caused by fungi.

[0073] In summary, the reducing polysaccharide produced by Bacillus belye Yian-sdu-015 of the present invention is soluble in water, significantly increases the viscosity of the solution, and has free radical scavenging ability, showing good application prospects in skin repair and solving skin problems.

[0074] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. The use of a reducing polysaccharide in the preparation of products for repairing skin and / or treating fungal infections; the method for preparing the reducing polysaccharide includes the following steps: 1) Bacillus beleibasis Yian-sdu-015 was inoculated into a synthetic medium and cultured to obtain a fermentation broth containing reducing polysaccharides; The preservation number of the Bacillus belyssae Yian-sdu-015 is CGMCC NO.20600; The synthetic culture medium comprises the following components at the following concentrations: sodium pyruvate 2-5.0 g / L, ammonium chloride 2-20 g / L, dipotassium hydrogen phosphate 0.1-5.0 g / L, magnesium sulfate 0.1-5.0 g / L, manganese sulfate 0.1-5.0 g / L, glutamic acid 0.1-5.0 g / L, sodium malate 0.1-5.0 g / L, glycerol 0.1-5.0 g / L, thiamine 0.1-5.0 g / L, boric acid 0.1-5.0 g / L, cobalt chloride 0.001-0.01 g / L, and calcium chloride 0.001-0.01 g / L; 2) The fermentation broth is mixed with a precipitant and separated to obtain purified reducing polysaccharide; The fungi include Candida utilis.

2. The application according to claim 1, characterized in that, The precipitant includes one or more of the following: ethanol (95%~100% by volume), methanol (95%~100% by volume), isopropanol (95%~100% by volume), and acetone (95%~100% by volume).

3. The application according to claim 1, characterized in that, The volume ratio of the Bacillus berberis Yian-sdu-015 fermentation broth to the precipitant is 1:1~2.

4. The application according to claim 1, characterized in that, The inhibition rate of the reducing polysaccharide was 31.0%, and the SOD enzyme activity was 4.99 μ / mL.

5. A product for repairing skin and / or treating fungal infections, characterized in that, The active ingredient in the product includes reducing polysaccharides; The method for preparing the reduced polysaccharide includes the following steps: 1) Bacillus beleibasis Yian-sdu-015 was inoculated into a synthetic medium and cultured to obtain a fermentation broth containing reducing polysaccharides; The preservation number of the Bacillus belyssae Yian-sdu-015 is CGMCC NO.20600; The synthetic culture medium comprises the following components at the following concentrations: sodium pyruvate 2-5.0 g / L, ammonium chloride 2-20 g / L, dipotassium hydrogen phosphate 0.1-5.0 g / L, magnesium sulfate 0.1-5.0 g / L, manganese sulfate 0.1-5.0 g / L, glutamic acid 0.1-5.0 g / L, sodium malate 0.1-5.0 g / L, glycerol 0.1-5.0 g / L, thiamine 0.1-5.0 g / L, boric acid 0.1-5.0 g / L, cobalt chloride 0.001-0.01 g / L, and calcium chloride 0.001-0.01 g / L; 2) The fermentation broth is mixed with a precipitant and separated to obtain purified reducing polysaccharide; The fungi include Candida utilis.

6. The product according to claim 5, characterized in that, The precipitant includes one or more of the following: ethanol (95%~100% by volume), methanol (95%~100% by volume), isopropanol (95%~100% by volume), and acetone (95%~100% by volume).

7. The product according to claim 5, characterized in that, The volume ratio of the Bacillus berberis Yian-sdu-015 fermentation broth to the precipitant is 1:1~2.

8. The product according to claim 5, characterized in that, The inhibition rate of the reducing polysaccharide was 31.0%, and the SOD enzyme activity was 4.99 μ / mL.

Images