Recombinant brucella strains, vaccines and uses thereof

Abstract

The application discloses a recombinant Brucella strain, a vaccine thereof and application. The recombinant Brucella strain is a Brucella-E2 strain obtained by displaying E2 protein of bovine viral diarrhea virus on the surface of Brucella. The Brucella disease and viral diarrhea double vaccine is prepared by displaying the E2 protein on the surface of the Brucella strain by a molecular biology method, and obtaining the E2 strain, so that the biological safety risk of the attenuated live vaccine of the Brucella disease, the high adverse reaction rate of the BVDV whole virus vaccine and other problems are solved. The double vaccine immunization improves the efficiency of animal disease prevention and control work, reduces the stress of animals, improves the animal welfare, and recovers the loss of economic benefits.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and more specifically, to a recombinant Brucella strain, its vaccine, and its application. Background Technology

[0002] Brucellosis, also known as brucellosis, is one of the most widespread and harmful zoonotic diseases in the world. Vaccination is the most effective means of reducing the high prevalence of brucellosis and controlling its spread. Currently used vaccines are all live attenuated vaccines, mainly A19, S2, M5, and A19-ΔVirB12, which still pose a high risk of infection to humans and pregnant animals, severely hindering the widespread use of vaccines. Therefore, developing a safer and more effective brucellosis vaccine is urgently needed.

[0003] Bovine viral diarrhea (BVD) is caused by bovine viral diarrhea virus (BVDV) and is characterized by fever, leukopenia, mucosal erosion and ulceration, diarrhea, or cough. BVDV is an infectious disease characterized by persistent infection in cattle, causing significant economic losses to the cattle industry. It is listed as a reportable disease by the World Organisation for Animal Health (OIE). The International Committee on Taxonomy of Viruses classifies BVDV into two genotypes: BVDV1 and BVDV2, each further subdivided into multiple genotypes. Each genotype can also be classified into cytopathic and non-cytopathic biotypes. The disease was reported to be prevalent in my country in the 1980s. With the rapid intensification of cattle farming in recent years, the incidence of BVDV has been increasing annually, causing substantial harm and economic losses to the industry. The main type of vaccine used for BVDV is the whole-virus inactivated vaccine. However, its preparation process requires the introduction of large amounts of exogenous proteins, leading to a high likelihood of adverse reactions in cattle after vaccination, thus hindering vaccine use. The E2 protein, a surface structural protein of BVDV, can simultaneously induce humoral and cellular immunity and produce neutralizing antibodies, making it a preferred target for preparing detection antigens and vaccines.

[0004] The process of vaccinating cattle requires restraining them before vaccination, which can cause stress. Multiple vaccinations can lead to a decrease in feed intake and milk production, resulting in economic losses. Combination vaccines that can provide multiple protections with a single injection represent a new demand for disease control. Summary of the Invention

[0005] This application aims to provide a recombinant Brucella strain, its vaccine, and its application to improve the efficiency of animal disease prevention and control and reduce animal stress.

[0006] To achieve the above objectives, according to one aspect of this application, a recombinant Brucella strain is provided. This recombinant Brucella strain is a Brucella-E2 strain obtained by displaying the E2 protein of bovine viral diarrhea virus on the surface of Brucella.

[0007] Furthermore, the Brucella bacteria are a shadow strain.

[0008] Furthermore, the recombinant Brucella strain is one in which the OMP10 protein of Brucella is replaced with the E2 protein of bovine viral diarrhea virus.

[0009] Furthermore, the gene sequence of the E2 protein of bovine viral diarrhea virus is a codon-optimized sequence; preferably, the E2 protein sequence of bovine viral diarrhea virus is shown in SEQ ID NO: 12.

[0010] Furthermore, the E2 protein of bovine viral diarrhea virus is fused with a strong promoter and the Brucella OMP10 signal peptide sequence to form a fusion sequence, which is then expressed in a recombinant Brucella strain; preferably, the fusion sequence is shown in SEQ ID NO: 9; preferably, the strong promoter is a Brucella strong promoter or a universal strong promoter for Gram-positive bacteria; more preferably, the strong promoter is a superoxide dismutase strong promoter P. sod .

[0011] Furthermore, the gene for the OMP10 protein of Brucella was obtained by replacing SEQ ID NO: 9.

[0012] According to another aspect of this application, the use of any of the above-mentioned recombinant Brucella strains in the preparation of recombinant Brucella vaccines is provided.

[0013] According to another aspect of this application, a recombinant Brucella vaccine is provided. This recombinant Brucella vaccine is prepared from any of the aforementioned recombinant Brucella strains.

[0014] Furthermore, the Brucella content in the recombinant Brucella vaccine is not less than 5 × 10⁻⁶. 10 CFU / dose, with an E2 protein content of bovine viral diarrhea virus not less than 60 μg / dose; preferably, the recombinant Brucella vaccine also includes pharmaceutically acceptable excipients; preferably, the excipients are vaccine adjuvants, optionally, the vaccine adjuvants are single-phase aqueous adjuvants, single-phase oil adjuvants or water-in-oil-in-water adjuvants.

[0015] According to another aspect of this application, a method for constructing the above-mentioned recombinant Brucella strain is provided. This method includes displaying the E2 protein of bovine viral diarrhea virus (BVPDV) onto the surface of Brucella using molecular biological methods; preferably, displaying the E2 protein of BVPDV onto the surface of Brucella using molecular biological methods includes replacing the OMP10 protein of Brucella with the E2 protein of BVPDV; preferably, the gene sequence of the E2 protein of BVPDV is optimized according to the A19 codon usage table; preferably, the superoxide dismutase strong promoter P... sod The OMP10 signal peptide sequence and the gene sequence of the E2 protein of bovine viral diarrhea virus were fused and expressed in the recombinant Brucella strain.

[0016] The brucellosis and viral diarrhea bivalent vaccine of this application utilizes molecular biology methods to display the E2 protein onto the surface of Brucella mycelia, obtaining E2 strains and preparing the bivalent vaccine. This bivalent vaccine exhibits high protein expression levels, generates higher levels of neutralizing antibodies, demonstrates better immunogenicity, and possesses high safety and few side effects. The OMP10 of the Brucella mycelia serves as a substitution target, efficiently inducing E2 protein expression [1], with the highest E2 protein expression concentration reaching 1200 μg / ml. The brucellosis mycelia-containing vaccine contains a content of not less than 5 × 10⁻⁶. 10 CFU / dose, viral diarrhea E2 protein content not less than 60μg / dose; this not only solves the biosafety risks of brucellosis live attenuated vaccines and the high adverse reaction rate of BVDV whole virus vaccines, but also effectively improves the immunogenicity of vaccines, increases the efficiency of animal disease prevention and control, and reduces animal stress. Attached Figure Description

[0017] The accompanying drawings, which form part of this application, are used to provide a further understanding of this application. The illustrative embodiments and descriptions of this application are used to explain this application and do not constitute an undue limitation of this application. In the drawings:

[0018] Figure 1 The electrophoresis results of PCR amplification of the upstream and downstream homologous arms of OMP10 are shown, where M: DL2000; 1-2: downstream homologous arm amplification results; 3-4: downstream homologous arm amplification results;

[0019] Figure 2 The electrophoresis results of SacB gene PCR amplification are shown, where M: DL2000; 1-2: SacB amplification results;

[0020] Figure 3 The electrophoresis results of OMP10 PCR amplification are shown, where M: DL2000; 1-2: OMP10 amplification results;

[0021] Figure 4 The results of SDS-PAGE detection of A19BG-E2 antigen are shown, where M: protein marker; 1: A19BG antigen; 2: A19BG-E2 antigen;

[0022] Figure 5 The results of Western blotting detection of A19BG-E2 antigen are shown, where M: protein marker; 1: A19BG-E2 antigen; 2: A19BG antigen;

[0023] Figure 6 The results of Brucella antibody and BVDV neutralizing antibody detection after A19BG-E2 immunization are shown.

[0024] Figure 7 The results of protection against M28 and wild-type BVDV challenge after A19BG-E2 immunization are shown.

[0025] Figure 8 The results of bacterial shedding after immunization with A19 and A19BG-E2 are shown.

[0026] Figure 9 The results of body temperature monitoring in cattle after receiving three vaccines: A19, A19BG-E2, and BVDV are shown.

[0027] Figure 10 The results of observations on adverse reactions in cattle after receiving three vaccines, A19, A19BG-E2, and BVDV, are shown.

[0028] Figure 11 The results of immune challenge protection with A19 vaccine and A19BG-E2 vaccine are shown;

[0029] Figure 12 The results of immune challenge protection with BVDV vaccine and A19BG-E2 vaccine are shown;

[0030] Figure 13 The SDS-PAGE results of the strain are shown, where M: protein marker; 1: A19BG antigen; 2: A19BG-E2 (OMP16) antigen; 3: A19BG-E2 (OMP19) antigen; and

[0031] Figure 14 The SDS-PAGE results of the strain are shown, where M: protein marker; 1: A19BG-E2 (E2 unoptimized) antigen; 2: A19BG-E2 (optimized); 3: A19BG antigen. Detailed Implementation

[0032] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. This application will now be described in detail with reference to the accompanying drawings and embodiments.

[0033] In view of the technical problems in the existing technology, such as the need for multiple injections of Brucella vaccine and bovine viral diarrhea / mucosal disease vaccine, which leads to a decrease in feed intake and milk production and economic losses, this application proposes the following technical solution.

[0034] According to a typical embodiment of this application, a recombinant Brucella strain is provided. This recombinant Brucella strain is an E2 strain obtained by displaying the E2 protein of bovine viral diarrhea virus onto the surface of Brucella using molecular biological methods.

[0035] The brucellosis and viral diarrhea bivalent vaccine of this application utilizes molecular biology methods to display the E2 protein onto the surface of Brucella shadow bacteria, obtaining the E2 strain and preparing the bivalent vaccine. This vaccine, obtained by fusing the target protein and the shadow bacteria using genetic engineering methods, solves the biosafety risks associated with live attenuated brucellosis vaccines and the high adverse reaction rate of whole-virus BVDV vaccines. Furthermore, the E2 strain possesses the properties of an immune adjuvant, enhancing the immune response to the E2 protein and producing higher levels of neutralizing antibodies; the bivalent vaccine of this invention achieves a Brucella shadow vaccine content of not less than 5 × 10⁻⁶. 10 CFU / dose, with a viral diarrhea E2 protein content of not less than 60μg / dose; achieving the effect of one injection for two protections, improving the efficiency of animal disease prevention and control, reducing animal stress, improving animal welfare, and recovering economic losses.

[0036] To express a target protein through genetic engineering by fusing it with Brucella bacteria, a suitable replacement target needs to be selected. However, not all replacements achieve satisfactory results. After extensive experimentation, the inventors of this application were pleasantly surprised to discover that OMP10 not only serves as a suitable target but also efficiently induces the expression of the E2 protein. Therefore, in this application, the E2 protein of bovine viral diarrhea virus is preferred to replace the OMP10 protein of Brucella, which is of great significance for vaccine production and subsequent immunization.

[0037] In order to improve the expression of the E2 protein of bovine viral diarrhea virus on the surface of Brucella, the inventors optimized its gene sequence according to the Brucella A19 codon usage table; preferably, the optimized E2 protein sequence of bovine viral diarrhea virus is shown in SEQ ID NO: 12.

[0038] In gene fusion expression, numerous factors can influence vaccine yield and immunogenicity. The technical effects of these factors cannot be predicted by those skilled in the art based on known data and common sense; they require extensive creative work for screening and verification. This application, after numerous experiments, surprisingly discovered a method that achieves high target protein yield and strong vaccine immunogenicity. For example, according to a typical embodiment of this application, the E2 protein of bovine viral diarrhea virus, a strong promoter, and the Brucella OMP10 signal peptide sequence are fused together and expressed in a recombinant Brucella strain; wherein, the strong promoter can be a Brucella strong promoter or a universal strong promoter for Gram-positive bacteria; preferably, the strong promoter is a superoxide dismutase strong promoter P. sod More preferably, the fusion sequence is shown in SEQ ID NO: 9; the resulting E2 protein has high yield and strong immunogenicity.

[0039] In a preferred embodiment of this application, the gene for the OMP10 protein of Brucella is replaced by SEQ ID NO: 9.

[0040] According to a typical embodiment of this application, the use of the above-mentioned recombinant Brucella strain in the preparation of recombinant Brucella vaccine is provided.

[0041] According to a typical embodiment of this application, a recombinant Brucella vaccine is provided. This recombinant Brucella vaccine is prepared from the aforementioned recombinant Brucella strain. The E2 protein of this BVDV virus is chimeric with the Brucella bacterial shadow, and a bivalent vaccine is prepared, providing dual protection with a single injection, improving work efficiency, reducing animal stress, increasing economic benefits, and enhancing the immune response to the E2 protein, producing higher levels of neutralizing antibodies.

[0042] The recombinant Brucella vaccine is a brucellosis vaccine, which solves the biosafety risks associated with live attenuated brucellosis vaccines and the high adverse reaction rate of whole-virus BVDV vaccines. In one embodiment of this application, the Brucella A19BG content in the recombinant Brucella vaccine is not less than 5 × 10⁻⁶. 10 CFU / dose, with an E2 protein content of bovine viral diarrhea virus not less than 60 μg / dose.

[0043] According to a typical embodiment of this application, the recombinant Brucella vaccine further includes excipients; preferably, the excipients are vaccine adjuvants, which may be single-phase aqueous adjuvants, single-phase oil adjuvants, or water-in-oil-in-water adjuvants.

[0044] According to a typical embodiment of this application, a method for constructing the above-mentioned recombinant Brucella strain is provided. This method includes displaying the E2 protein of bovine viral diarrhea virus (BVPDV) onto the surface of Brucella using molecular biological methods; preferably, displaying the BVPDV E2 protein onto the Brucella surface using molecular biological methods includes replacing the OMP10 protein of Brucella with the BVPDV E2 protein; preferably, the gene sequence of the BVPDV E2 protein is optimized according to the Brucella A19 codon usage table; preferably, the superoxide dismutase strong promoter P... sod The OMP10 signal peptide sequence of Brucella strong promoter and the gene sequence of E2 protein of bovine viral diarrhea virus were fused and expressed in recombinant Brucella strains.

[0045] The beneficial effects of this application will be explained below with reference to specific experiments.

[0046] Example 1

[0047] I. Construction of strain A19BG-E2

[0048] The E2 protein of BVDV was displayed on the surface of Brucella A19BG using homologous recombination. The E2 protein replaced the surface membrane protein of A19BG, and the signal peptide sequence of the lipoprotein was used to guide the E2 protein to be fully displayed on the surface of A19BG.

[0049] Brucella A19BG is a strain of Brucella A19 (strain preservation number: CVCC813, depository: China Veterinary Microbial Culture Collection Center, other information can be found at http: / / cvccinfo.ivdc.org.cn / web / shopcart / ProductsSetting_Virus_Detail.aspx?id=CVCC813) prepared by biotechnology. The specific preparation method is described in Example 1 of CN111773384A.

[0050] 1 Primer Design

[0051] Using OMP10 protein as the target protein, E2 protein substitution was performed. Primers were precisely designed to amplify the upstream and downstream homologous arms of OMP10 protein, respectively, resulting in the amplification of the upstream homologous arm S-OMP10 and the downstream homologous arm X-OMP10. The primers are shown in Table 1 below.

[0052] Table 1

[0053]

[0054] 2. Plasmid replacement construction

[0055]

[0056] 3. Electroconversion of recombinant plasmids

[0057] Preparation of A19BG competent cells: Streaked Brucella A19BG cells were cultured on TSA medium at 37°C for 3 days. Single colonies were picked and cultured in 200 ml of TSB medium with shaking until the OD600 reached approximately 0.3. The cells were then placed in an ice-water mixture for 30 min. After centrifugation at 5000 rpm for 10 min, the bacterial pellet was collected, washed five times with ultrapure water containing 10% glycerol, and resuspended in 2 ml of ultrapure water containing 10% glycerol. 200 μL of the pellet was dispensed into each tube to obtain A19BG competent cells, which were then stored at -80°C for later use.

[0058] 10 μL of recombinant plasmid PBK-CMV-OMP-E2-SacB was added to 100 μL of A19BG competent cells, mixed thoroughly, and then transferred to a 0.1 cm electroporation cuvette. Electroporation was performed at 1800 V and 200 Ω. After electroporation, 0.9 ml of TSB medium was added to the cuvette, mixed well, and transferred to a centrifuge tube. The cells were incubated at 28°C and 200 rpm for 24 hours. The bacterial culture was then plated on TSA agar plates containing kanamycin (50 µg / ml) and incubated at 28°C.

[0059] 4. Screening of recombinant positive strains

[0060] Single colonies were picked from TSA plates and added to an appropriate amount of TSB solution. The culture was incubated at 28°C with shaking at 200 rpm for 48 hours. The culture was then diluted and plated onto Boucher's agar plates supplemented with 5–10% sucrose, and incubated at 28°C for 4 days. Colonies grown on the plates were identified by PCR using primers OMP10-F and OMP10-R. Positive colonies identified by PCR were named A19BG-E2.

[0061] II. Identification of Recombinant A19BG-E2

[0062] The recombinant A19BG-E2 strain was cultured at 28℃ and 200 r / min for 48 hours. Viable cells were counted, and the temperature was changed to 42℃ and cultured for another 72 hours for lysis and inactivation. A19BG-E2 antigen was prepared. 10 ml of bacterial culture was taken, centrifuged at 8000 r / min for 1 minute, and the bacterial cells were collected. The E2 protein was identified by Western Blot.

[0063] Figure 1 The electrophoresis results of PCR amplification of the upstream and downstream homologous arms of OMP10 are shown, where M: DL2000; 1-2: downstream homologous arm amplification results; 3-4: downstream homologous arm amplification results; Figure 2The electrophoresis results of SacB gene PCR amplification are shown, where M: DL2000; 1-2: SacB amplification results; Figure 3 The electrophoresis results of OMP10 PCR amplification are shown, where M: DL2000; 1-2: OMP10 amplification results; Figure 4 The results of SDS-PAGE detection of A19BG-E2 antigen are shown, where M: protein marker; 1: A19BG antigen; 2: A19BG-E2 antigen; Figure 5 The results of Western blotting detection of A19BG-E2 antigen are shown, where M: protein marker; 1: A19BG-E2 antigen; 2: A19BG antigen.

[0064] Example 2

[0065] A19BG-E2 vaccine preparation process

[0066] The recombinant strain A19BG-E2 was inoculated at 1-2% into a fermenter containing soybean broth (TSB) medium (Kan 100µg / ml) and incubated at 27-29℃ for 5-6 minutes. 3 Compressed air was introduced per hour at 170–200 rpm for 40–48 hours to harvest the bacterial culture, and viable cell count and E2 protein content were determined. The A19BG-E2 strain was inactivated by induction at 160–200 rpm and 41–43°C for 60–72 hours. After inactivation, the culture was inoculated with TSB for inactivation testing. Antigen was concentrated using a 0.1 μm hollow fiber column, washed with sterile PBS buffer, and the vaccine was prepared using ISA 206 VG as adjuvant. ISA 206 VG adjuvant was slowly added to the antigen (1000–1200 billion viable cells / mL, 120–150 μg / mL E2 protein, stirred at 300–350 rpm) at a mass ratio of 1:1–1:1.2, and mixed at 150–350 rpm for 10–20 minutes before aliquoting.

[0067] Example 3

[0068] A19BG-E2 vaccine application

[0069] Twenty calves aged 3-8 months that were negative for Brucella antibodies and BVDV antigen were divided into an immunization group (10 calves) and a control group (5 calves each challenged with Brucella and BVDV). All calves were isolated and fed with saline solution. At intervals of 14-21 days, the immunization group received booster immunizations using the same dosage and method. 21-28 days after the booster immunizations, the calves were challenged with Brucella M28 strain and virulent BVDV. Five calves from each group were challenged with M28, and the M28 bacterial solution was adjusted to 1.0 × 10⁻⁶. 9 CFU / ml, inoculated via ocular mucosa, 50µl per eye. Autopsy was performed 40–45 days post-challenge for histological bacteriological examination; isolation of M28 indicated unprotected bacteria. Five animals each in the immunized and control groups were challenged with virulent BVDV, with the virulent BVDV concentration adjusted to 10. 6.5 FID50 was administered via nasal spray, 6 ml per cow. Whole blood was collected 7 days after the attack for BVDV virus testing. Detection of the virus indicated unprotected status.

[0070] Figure 6 The results of Brucella antibody and BVDV neutralizing antibody detection after A19BG-E2 immunization are shown. Figure 7 The results show the protection against M28 and wild-type BVDV challenge after A19BG-E2 immunization. These results indicate that A19BG-E2 vaccine immunization in cattle effectively induces the production of corresponding antibodies. Figure 6 ), and at the same time, it can provide protection for vaccinated cattle, effectively resisting attacks from artificial infections. Figure 7 ).

[0071] Example 4

[0072] Comparative trial of A19BG-E2 vaccine with A19 and BVDV vaccines

[0073] Side reaction comparison experiment

[0074] Fifteen cattle that were negative for both Brucella and BVDV antibodies were divided into three groups and immunized with Brucella live vaccine (A19 strain), Bovine Viral Diarrhea / Mucosal Disease inactivated vaccine (BVDV), and the A19BG-E2 vaccine described in this application, respectively.

[0075] Virus challenge experiment

[0076] Twenty-five cattle were identified as double-negative for both Brucella and BVDV antibodies. Five cattle were immunized with live Brucella vaccine (Strain A19); five cattle were immunized with inactivated Bovine Viral Diarrhea / Mucosal Disease vaccine (BVDV) and were boosted with the same dose and method 21 days later; five cattle were immunized with the A19BG-E2 vaccine described in this application and were boosted with the same dose and method 21 days later; and ten cattle served as negative controls (five each challenged with Brucella and BVDV) and were not immunized with any vaccine.

[0077] The specific strains and steps used in the challenge experiment are the same as in Example 3.

[0078] The following tests were conducted on the bacterial shedding status, body temperature response, adverse reactions, and viral challenge protection in cattle after the above immunization. The results are as follows: Figure 8-12 As shown.

[0079] in, Figure 8 The results of bacterial shedding after immunization with A19 and A19BG-E2 are shown. Bacterial shedding can be detected in cattle in the A19 vaccine group after immunization, with the peak period of bacterial shedding within 7 days after immunization. However, no bacterial shedding was detected in any animals in the A19BG-E2 vaccine group during the detection period after immunization, indicating no biosafety risk caused by vaccine injection. Figure 9 The results of body temperature monitoring in cattle after vaccination with three vaccines, A19, A19BG-E2, and BVDV, are shown. Within 1 to 3 days after vaccination, cattle in the A19 and BVDV vaccine groups showed a strong body temperature reaction, with body temperature significantly higher than before vaccination. The body temperature of cattle in the A19BG-E2 group was consistent with that before vaccination, with no abnormalities. Figure 10 The results of observation of adverse reactions in cattle after three vaccines, A19, A19BG-E2 and BVDV, are shown. No adverse reaction symptoms were observed in the experimental cattle in the A19 and A19BG-E2 vaccine groups. In the BVDV vaccine group, one cow showed adverse reaction symptoms of salivation and abdominal breathing. Figure 11 The results of immune challenge protection against A19 vaccine and A19BG-E2 vaccine are shown. After immunization of cattle with A19BG-E2 vaccine, it can provide protection equivalent to that of A19 vaccine against wild-type Brucella M28 strain. Figure 12 The results of immune challenge protection with BVDV vaccine and A19BG-E2 vaccine are shown. Both A19BG-E2 vaccine and BVDV vaccine can resist attack by virulent wild-type BVDV virus.

[0080] The results above show that, compared with BVDV and A19 vaccines, A19BG-E2 vaccine has higher safety and provides equivalent protection to BVDV and A19 vaccines for vaccinated animals.

[0081] Reference Example 1

[0082] I. Construction of OMP16 and OMP19 strains for replacing proteins

[0083] E2 protein substitution was performed using OMP16 and OMP19 proteins as target proteins, respectively. Primers were precisely designed to amplify the upstream and downstream homologous arms of OMP16 and OMP19 proteins, respectively, and the upstream and downstream homologous arms were amplified. The method was the same as in Example 1.

[0084] The amplification primers for OMP16 and OMP19 are shown in Table 2.

[0085] Table 2

[0086]

[0087] II. Construction of strains without optimized E2 gene

[0088] Recombinant Brucella strains were constructed using the superoxide dismutase strong promoter Psod, the Brucella strong promoter OMP10 signal peptide sequence, and the unoptimized E2 gene sequence, in the same manner as in Example 1.

[0089] III. Identification of Recombinant A19BG-E2

[0090] Recombinant strains A19BG-E2 (OMP16), A19BG-E2 (OMP19), and A19BG-E2 (E2 unoptimized) were cultured separately at 28°C and 200 rpm for 48 hours. The temperature was then reduced to 42°C and cultured for another 72 hours for lysis and inactivation. Antigens were prepared, and 10 ml of the bacterial culture was centrifuged at 8000 rpm for 1 minute to collect the bacterial cells. The E2 protein was identified by SDS-PAGE.

[0091] Figure 13 The SDS-PAGE results of the strain are shown, where M: protein marker; 1: A19BG antigen; 2: A19BG-E2 (OMP16) antigen; 3: A19BG-E2 (OMP19) antigen. Figure 13 It is known that if OMP16 and OMP19 proteins are used as target proteins for E2 protein replacement, the resulting strains cannot express the E2 protein.

[0092] Figure 14 The SDS-PAGE results of the strain are shown, where M: protein marker; 1: A19BG-E2 (E2 unoptimized) antigen; 2: A19BG-E2 (optimized); 3: A19BG antigen. (From...) Figure 14Band analysis at 50KD showed that the recombinant strain constructed without optimization of the E2 gene sequence produced very little E2 protein, while optimization significantly increased the expression of E2 protein in A19BG, with a much higher yield compared to the unoptimized sequence. Detection revealed that the highest expression concentration of E2 protein after optimization could reach 1200 μg / ml.

[0093] As can be seen from the above description, the embodiments of this application achieve the following technical effects:

[0094] 1) The E2 protein of BVDV virus is chimeric with Brucella agaricus shadow A19BG to prepare a bivalent vaccine, which can prevent two diseases with one injection, improve work efficiency, reduce animal stress and increase economic benefits.

[0095] 2) A19BG can enhance the immune response to E2 protein, producing higher levels of neutralizing antibodies;

[0096] 3) In this application, OMP10 of Brucella agaricus shadow A19BG can efficiently induce the expression of E2 protein as a substitution target;

[0097] 4) The bovine brucellosis and viral diarrhea bivalent vaccine provided in this application contains an A19BG content of not less than 5 × 10⁻⁶. 10 CFU / dosage, BVDV virus E2 protein content not less than 60μg / dosage;

[0098] 5) It solved the biosafety risks associated with live attenuated brucellosis vaccines and the high adverse reaction rate of whole-virus BVDV vaccines;

[0099] 6) All E2 protein sequences used in this application are optimized sequences. The E2 protein obtained after fusion expression has high yield and strong immunogenicity.

[0100] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application. sequence list <110> Tiankang Pharmaceutical (Suzhou) Co., Ltd. <120> Recombinant Brucella strains, their vaccines and applications <130> PN163693TKSWZY <160> twenty two <170> SIPOSequenceListing 1.0 <210> 1 <211> 31 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(31) <223> Primer OMP10-SF <400> 1 ggatccgcgg cgaccaggcc gggtcggaag c 31 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(31) <223> Primer OMP10-SR <400> 2 catatgatca aatcttaagg agctccggcc c 31 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(31) <223> Primer OMP10-XF <400> 3 ggatccgcgg cgaccaggcc gggtcggaag c 31 <210> 4 <211> 31 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(31) <223> Primer OMP10-XR <400> 4 catatgtttg gcaagtgctc cggtgctggc g 31 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(26) <223> Primer SacB-F <400> 5 gtcgacatga acatcaaaaa gtttgc 26 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(25) <223> Primer SacB-R <400> 6 ggatccttatttgttaacgttaatg 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(25) <223> Primer OMP10-F <400> 7 gtgcaatcga ctggatacgg cgcat 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(25) <223> Primer OMP10-R <400> 8 ttaccgtccg gccccgttga gaacg 25 <210> 9 <211> 1156 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(1156) <223> Fusion gene <400> 9 atgcgccgta tccagtcgat tgcacgtagc ccgatcgcta ttgcgctttt catgtcgctc 60 gccgttgccg gctagaagct tgccaccatg ggccagatcg tgcagggcat cctgtggctg 120 ctgctgatca caggcgtgca gggcgacctg aactgtaagc cagattacag ctatgccatc 180 gctaggtctg acaggatcgg actgctggga gctgaggatc tgacaaccga ctggaaggat 240 tacagccacg agatgatgct ggtggacacc atggtcatcg cctggtgcag agatggcaag 300 ttcgtgtacc actctagatg tacacgcgag accaggtatc tggctacact gcattcccgg 360 gccctgccca cctccgccgt gttcgagaag ctgtttgacg gccagagaca ggaggatacc 420 gtggagatgg acgataactt cgagtttggc ctgtgcccat gtgacgccaa gcccatcgtg 480 agaggccgct acaacacaac cctgctgaat ggccctgctt tccagatggt gtgcccaatc 540 ggctggacag gcaccgtgtc ttgtatgctg gccaatggcg acacactgga taccgctgtg 600 gtgcgcacat acaggcggtc caagcccttt ccttataggc agggctgcat cacacagaag 660 accctgggcg aggacctgta caactgcgat ctgggcggca attggacatg cgtgaccggc 720 gacaggctgc agtataccgg aggctctatc gagtcctgca agtggtgtgg cttcaagttt 780 cagaagtctg agggcctgcc tcattaccca atcggcaagt gtaagctgaa gaacgagaca 840 ggctatcggt tcgtggattc caccagctgc atagagagg gagtggctat cgtgccaacc 900 ggactggtga agtgtaagat cgccctgcaa gccttacgag atcatcccct ccgagggccc 960 tgtggagaag acagcctgta cctttaacta cacaaagacc ctgaagaata agtatttcga 1020 gccccgcgac agctactttc agcagtatat gctgaagggc gagtaccagt attggttcga 1080 tctggaggtg accgaccacc atagggatta ttttgctgag tccatccatc accatcacca 1140 tcactaagaa ttcatg 1156 <210> 10 <211> 822 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(822) <223> OMP10 upstream homologous arm gene sequence <400> 10 gtccatgctc tccattagaa agtttcgcgt gtgatgtatg gaaacttacc cgaaaacaag 60 tccttagtgt gaggataatg aaactgttgc gaaactgtcg caatgaaagc cgcccgtttc 120 aggacgcggg cggcatctcg atcagcggac cagaacgttg cggaactgcc agggatcttt 180 cctgtcgacg tcttcctcga agagcccgtc gcggccctca agcggcgtcc agtcggtata 240 atagcccttt acaggtccga gatattgcat ctgcacctca aggcagcggc ggtaatccat 300 ttcgtcggtc tcgacgatgc cgctttgcgg gttttccagc gcccagacca tgccggcgag 360 cacagcggaa gaaacctgca agccggttgc gttctggtag ggcgcaagct tgcgcgcttc 420 ctgcacggtc agttgcgagc cgtaccaata ggcgtttctg gcgtggccat agagcaggac 480 gccaagctcg tccgcaccgt ccagaatttc gttttcttcg aggacatgct gtacgggctg 540 ggcctttccg cccgcaccga acatttcgtc aagcgagaca atggcgtcgt tgcaggggtg 600 gtaggcatag tggcaggtga ggcggaagtc gagcttgcct ttcttgtcac gcagggtgaa 660 gaaatccgcg atggaaatcg cctcattatg cgtcacaagc aggccatatt gcgcgccaag 720 cgtcgggcac catgtacgga tgcgcgtatt gccgccgggt tgttcaagga aaatggcggc 780 cttgttgccc tttttctgct tgcgggcgtt cttgggcttc ca 822 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(24) <223> OMP10 signal peptide gene <400> 11 atgtcgctcg ccgttgccgg ctag 24 <210> 12 <211> 1083 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(1083) <223> E2 gene <400> 12 agaagcttgc caccatgggc cagatcgtgc agggcatcct gtggctgctg ctgatcacag 60 gcgtgcaggg cgacctgaac tgtaagccag attacagcta tgccatcgct aggtctgaca 120 ggatcggact gctgggagct gaggatctga caaccgactg gaaggattac agccacgaga 180 tgatgctggt ggacaccatg gtcatcgcct ggtgcagaga tggcaagttc gtgtaccact 240 ctagatgtac acgcgagacc aggtatctgg ctacactgca ttcccgggcc ctgcccacct 300 ccgccgtgtt cgagaagctg tttgacggcc agagacagga ggataccgtg gagatggacg 360 ataacttcga gtttggcctg tgcccatgtg acgccaagcc catcgtgaga ggccgctaca 420 acacaaccct gctgaatggc cctgctttcc agatggtgtg cccaatcggc tggacaggca 480 ccgtgtcttg tatgctggcc aatggcgaca cactggatac cgctgtggtg cgcacataca 540 ggcggtccaa gccctttcct tataggcagg gctgcatcac acagaagacc ctgggcgagg 600 acctgtacaa ctgcgatctg ggcggcaatt ggacatgcgt gaccggcgac aggctgcagt 660 ataccggagg ctctatcgag tcctgcaagt ggtgtggctt caagtttcag aagtctgagg 720 gcctgcctca ttacccaatc ggcaagtgta agctgaagaa cgagacaggc tatcggttcg 780 tggattccac cagctgcaat agagagggag tggctatcgt gccaaccgga ctggtgaagt 840 gtaagatcgc cctgcaagcc ttacgagatc atcccctccg agggccctgt ggagaagaca gcctgtacct ttaactacac aaagaccctg aagaataagt atttcgagcc ccgcgacagc tactttcagc agtatatgct gaagggcgag taccagtatt ggttcgatct ggaggtgacc gaccaccata gggattattt tgctgagtcc atccatcacc atcaccatca ctaagaattc atg 1083 <210> 13 <211> 794 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(794) <223> OMP10 is a snowflake swimming pool <400> 13 ggtgaggatg acttcgggct tgaaggaag cgtagccaga tgcttttcga cggaacgcgc cagcgcgtcg atatagaccg gctcggcctc gtatgacggc acggtgcgga ttgcaggcat 120 gaagcgcttt ttcatcagcg cctcgaaga cttgtcgttc accgtcgccg tggtggtggc ggaatattgc ggatagagcg ggaatatcac aatccgctcg cagccctgct gaagcaggcg 240 gtcggttatg ctctcgatgg aaggctggcc atagcgcatc gcccagtcca ccacgacatt 300 gggttggtcg ctaagtgctt tggcaagttt ctcgccctgc gcgcgcgtat aggtgcgcag 360 gggcgattca ttattctcgt gattccagat gcgatcatag agcctgccgg aacgcctggg 420 ccgtgtgttg agaacaatac cgtaaaggat cgggtaccag ataaggcgcg accattcgat 480 gacgcggcgg tcggagagaa attcggcaag atagcgccgc atcgggccgt agctcgtgcc 540 gtccggcgtg ccgagattga ccagcaaaac cccgactttc ggcagtttgg ccgatgtatg 600 cagcggggtc tgcgctgtct ggctgacgtt cacacgcacc ttgtccgttc cactcatatt 660 ccgactccat gttctgccgg aaaactagag aaaaaaagac aaattacaat cctgacaaat 720 cgttgtttat cggatcgtgt gtaacgggca gggaaacggc ccggtttggg ccgtttctgt 780 tttccaaaaa ggga 794 <210> 14 <211> 1422 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(1422) <223> SacB gene sequence <400> 14 ttatttgtta actgttaatt gtccttgttc aaggatgctg tctttgacaa cagatgtttt 60 cttgcctttg atgttcagca ggaagctcgg cgcaaacgtt gattgtttgt ctgcgtagaa 120 tcctctgttt gtcatatagc ttgtaatcac gacattgttt cctttcgctt gaggtacagc 180 gaagtgtgag taagtaaagg ttacatcgtt aggatcaaga tccattttta acacaaggcc 240 agttttgttc agcggcttgt atgggccagt taaagaatta gaaacataac caagcatgta 300 aatatcgtta gacgtaatgc cgtcaatcgt catttttgat ccgcgggagt cagtgaacag 360 gtaccatttg ccgttcattt taaagacgtt cgcgcgttca atttcatctg ttactgtgtt 420 agatgcaatc agcggtttca tcactttttt cagtgtgtaa tcatcgttta gctcaatcat 480 accgagagcg ccgtttgcta actcagccgt gcgtttttta tcgctttgca gaagtttttg 540 actttcttga cggaagaatg atgtgctttt gccatagtat gctttgttaa ataaagattc 600 ttcgccttgg tagccatctt cagttccagt gtttgcttca aatactaagt atttgtggcc 660 tttatcttct acgtagtgag gatctctcag cgtatggttg tcgcctgagc tgtagttgcc 720 ttcatcgatg aactgctgta cattttgata cgtttttccg tcaccgtcaa agattgattt 780 ataatcctct acaccgttga tgttcaaaga gctgtctgat gctgatacgt taacttgtgc 840 agttgtcagt gtttgtttgc cgtaatgttt accggagaaa tcagtgtaga ataaacggat 900 ttttccgtca gatgtaaatg tggctgaacc tgaccattct tgtgtttggt cttttaggat 960 agaatcattt gcatcgaatt tgtcgctgtc tttaaagacg cggccagcgt ttttccagct 1020 gtcaatagaa gtttcgccga ctttttgata gaacatgtaa atcgatgtgt catccgcatt 1080 tttaggatct ccggctaatg caaagacgat gtggtagccg tgatagtttg cgacagtgcc 1140 gtcagcgttt tgtaatggcc agctgtccca aacgtccagg ccttttgcag aagagatatt 1200 tttaattgtg gacgaatcaa attcagaaac ttgatatttt tcattttttt gctgttcagg 1260 gatttgcagc atatcatggc gtgtaatatg ggaaatgccg tatgtttcct tatatggctt 1320 ttggttcgtt tctttcgcaa acgcttgagt tgcgcctcct gccagcagtg cggtagtaaa 1380 ggttaatact gttgcttgtt ttgcaaactt tttgatgttc at 1422 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(26) <223> Primer OMP16-SF <400> 15 ggatcctctc cattggtgtg atgaag 26 <210> 16 <211> twenty four <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(24) <223> Primer OMP16-SR <400> 16 catatgggcc ggagctcctt aaga 24 <210> 17 <211> 27 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(27) <223> Primer OMP16-XF <400> 17 ggatcctaaa accggcaacg tcccgag 27 <210> 18 <211> 31 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(31) <223> Primer OMP16-XR <400> 18 catatgatcg ccagcctgcg cgagatagat g 31 <210> 19 <211> 28 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(28) <223> Primer OMP19-SF <400> 19 ggatccatag tccgtgccgg gcgtacgc 28 <210> 20 <211> 28 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(28) <223> Primer OMP19-SR <400> 20 catatgcagg ttctccattt gcgcattt 28 <210> twenty one <211> 29 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(29) <223> Primer OMP19-XF <400> twenty one ggatcctctg acccggaaac gatgaacag 29 <210> twenty two <211> 26 <212> DNA <213> Artificial Sequence <220> <221> primer_bind <222> (1)..(26) <223> Primer OMP19-XR <400> twenty two catatgccgg cgggattgga tcatcc 26

Claims

1. A recombinant Brucella strain, characterized in that, The recombinant Brucella strain is obtained by replacing the OMP10 protein of Brucella with the E2 protein of bovine viral diarrhea virus to display it on the surface of Brucella, resulting in a Brucella E2 strain, wherein Brucella is Brucella A19 shadow strain, and the gene sequence of the E2 protein of bovine viral diarrhea virus is shown in SEQ ID NO:

12.

2. The recombinant Brucella strain according to claim 1, characterized in that, The E2 protein of the bovine viral diarrhea virus was fused with a strong promoter and the Brucella OMP10 signal peptide sequence to form a fusion sequence, which was then expressed in the recombinant Brucella strain.

3. The recombinant Brucella strain according to claim 2, characterized in that, The fusion sequence is shown in SEQ ID NO:

9.

4. The recombinant Brucella strain according to claim 2, characterized in that, The strong promoter is either a Brucella strong promoter or a universal strong promoter for Gram-positive bacteria.

5. The recombinant Brucella strain according to claim 4, characterized in that, The strong promoter is a superoxide dismutase strong promoter. P sod.

6. The recombinant Brucella strain according to claim 2, characterized in that, It is obtained by replacing the gene for the OMP10 protein of the Brucella with SEQ ID NO:

9.

7. The use of the recombinant Brucella strain according to any one of claims 1 to 6 in the preparation of a recombinant Brucella vaccine.

8. A recombinant Brucella vaccine, characterized in that, Prepared from any one of the recombinant Brucella strains as described in any one of claims 1 to 6.

9. The recombinant Brucella vaccine according to claim 8, characterized in that, The recombinant Brucella vaccine contains no less than 5 × 10⁻⁶ Brucella bacteria. 10 CFU / dosage, wherein the E2 protein content of the bovine viral diarrhea virus is not less than 60 μg / dosage.

10. The recombinant Brucella vaccine according to claim 9, characterized in that, The recombinant Brucella vaccine also includes pharmaceutically acceptable excipients.

11. The recombinant Brucella vaccine according to claim 10, characterized in that, The excipients are vaccine adjuvants.

12. The recombinant Brucella vaccine according to claim 10, characterized in that, The vaccine adjuvant is a single-phase aqueous adjuvant, a single-phase oil adjuvant, or a water-in-oil-in-water adjuvant.

Images