An iPS cell model simulating erythroid differentiation arrest and construction method and application thereof

Abstract

The application discloses an iPS cell model simulating erythroid differentiation arrest and a construction method and application thereof. Non-integrated Yamanaka factor plasmids are introduced into bone marrow mononuclear cells carrying a PUS1 homozygous mutation by an electroporation technology, and the bone marrow mononuclear cells are reprogrammed into iPSCs. Meanwhile, a site-directed sgRNA and a repair template are designed for the mutation site, and an iPSC strain with a repaired mutation site is constructed by using a CRISPR / Cas9 technology. An improved erythroid directional differentiation method is established for normal human-derived iPSCs, patient-specific iPSCs and the repair strains thereof to evaluate the differentiation capacity. The patient-specific iPSC model and the erythroid differentiation method constructed by the application can well simulate the phenotype of erythroid differentiation arrest, and can quickly, conveniently and efficiently screen potential drugs for CSA or other anemias.

Description

Technical Field

[0001] This application relates to the field of cell construction technology, and in particular to an iPS cell model that simulates erythroid differentiation arrest using bone marrow mononuclear cells from MLASA patients, as well as its construction method and application. Background Technology

[0002] Sideroblastic anemia (SA) is a type of anemia characterized by abnormal iron granules in erythroid precursor cells. These iron-overloaded mitochondria surround the cell nucleus, forming "ring iron," which is clearly visible as blue granules in bone marrow smears stained with Prussian blue. SA can be divided into two main categories: hereditary and acquired. Congenital sideroblastic anemia (CSA) is caused by congenital gene mutations. The reported pathogenic genes mainly involve pathways related to heme synthesis, iron-sulfur cluster synthesis and transport, and mitochondrial protein synthesis.

[0003] Mitochondrial myopathy, lactic acidosis, and sideroblastic anemia syndrome (MLASA) is a rare autosomal recessive genetic disorder, belonging to the syndrome type of CSA. Based on the mutated gene carried by the patient, it is divided into three subtypes, MLASA1-3, which are caused by pseudouridine synthase 1 (Pseudouridine Synthase 1, ...). PUS1 ), mitochondrial tyrosyl-tRNA synthetase, YARS2 ) and mitochondrial DNA MT-ATP6 Caused by gene mutation. PUS1 MLASA1 patients caused by mutations are characterized by early onset, severe illness, and high mortality. In addition to the common symptoms of MLASA patients such as progressive childhood exercise intolerance, sideroblastic anemia (usually around puberty), hyperlactatemia, and mitochondrial myopathy, MLASA1 patients may also experience cognitive impairment, developmental delay, cardiomyopathy, dysphagia, and respiratory distress. Clinical manifestations vary greatly among individuals, and even two patients from the same family carrying the same mutation may not have completely identical clinical phenotypes. YARS2 catalyzes the synthesis of mitochondrial tyrosine-tRNA and plays a crucial regulatory role in mitochondrial protein coding. MLASA2 patients generally have milder symptoms than MLASA1 patients, and some MLASA2 patients can achieve complete clinical remission of sideroblastic anemia. Furthermore, one study found that not all... YARS2 All patients with gene mutations will exhibit cyclic iron, but only about 76% of patients will show this disease symptom. (This refers to the presence of iron rings in the mitochondrial genome.) MT-ATP6Gene mutations can affect the function of oxidative respiratory chain complex V; currently, only one case has been diagnosed with MLASA3. MT-ATP6 The m.8993T>G mutation is one of the first pathogenic mutations in the mitochondrial genome discovered thirty years ago. Patients often present with multisystemic disease, but the main symptoms occur in nerve and muscle-related tissues, without hematologic disorders. Currently, there are no effective treatments for MLASA other than blood transfusions, iron chelation therapy, and other systemic symptomatic treatments.

[0004] PUS1 belongs to the PUS family, whose members bind to various RNAs, including tRNA, snRNA, rRNA, and mRNA, and modify them with pseudouridine, with or without RNA dependence. The human PUS family has 13 members, which can be divided into 6 classes based on their different structural domains. Existing research has shown that some members are closely associated with diseases, among which… PUS3 Homozygous mutations can lead to intellectual disability, while PUS7 Homozygous mutations not only affect intellectual development but can also regulate tumorigenesis by influencing translation. Furthermore, the PUS family participates in intracellular biological processes and energy metabolism; for example, PUS10 can regulate miRNA biosynthesis and affect cytoplasmic tRNA function, while RPUSD3 and RPUSD4 have been identified as playing important regulatory roles in oxidative phosphorylation. The PUS1 protein has two isoforms: one located in the nucleus, which can modify specific pre-mRNAs and cytoplasmic tRNAs, and the other located in the mitochondria, modifying specific mitochondrial tRNAs. Because the PUS1 protein sequence is highly conserved across species, in recent years, research teams have used model organisms such as yeast and mice, as well as patient-derived fibroblasts and lymphoblasts, to study its effects. PUS1 Preliminary research has been conducted on gene mutations. However, this work only covers... PUS1 While partial analyses have been conducted on mitochondrial dysfunction and defects in the oxidative respiratory chain caused by gene mutations, in-depth research on the pathogenesis of anemia in MLASA1 patients remains limited. Furthermore, the complexity of MLASA disease itself and the rarity of cases significantly restrict research. Since the first discovery of MLASA1 patients in 1995, only a handful of carriers have been traced back to 2020 over a period of 25 years. PUS1 Fewer than 20 patients were identified with gene mutations, and the mutation sites and types varied significantly among them, resulting in marked heterogeneity in clinical phenotypes. Therefore, developing a cell line model that simulates erythroid differentiation arrest is of great significance for in-depth research into the pathological mechanisms of the disease and for creating conditions for screening drugs to treat related diseases. Summary of the Invention

[0005] In order to solve the above-mentioned technical problems, this application provides an iPS cell model that simulates erythroid differentiation arrest, a method for its construction, and its application.

[0006] Firstly, this application provides a method for constructing an iPS cell model that simulates erythroid differentiation arrest, which is achieved by the following technical solution.

[0007] A method for constructing an iPS cell model simulating erythroid differentiation arrest includes the following steps: introducing Yamanaka factor into mononuclear cells via electroporation, reprogramming them into induced pluripotent stem cells (iPSCs), and then establishing repair lines using CRISPR-Cas9 technology; after pluripotency verification, inducing erythroid differentiation using two methods.

[0008] Furthermore, a method for constructing an iPS cell model simulating erythroid differentiation arrest includes the following steps: S1. Construction of specific iPSCs and their repair strains I. Isolation of mononuclear cells from the patient's bone marrow; II. Construction of patient-specific iPSCs; III. Constructing repair strains using CRISPR-Cas9 technology; IV. Cultivation of iPSCs; S2. iPSC Genotyping and Pluripotency Verification I. Genotyping; II. Detection of transcriptional levels of pluripotency markers; III. Detection of expression levels of pluripotency marker proteins; IV. Differentiation of teratomas across the three germ layers; S3. iPSC Red Series Directed Differentiation I. Hypoxia method for erythroid induction; II. Red line induction using the normoxic method.

[0009] Furthermore, in step S1 II, a plasmid carrying the Yamanaka transcription factor is introduced into bone marrow mononuclear cells carrying homozygous mutations of PUS1 (c.523delC, p.P175fs) by electroporation. The electroporated cell suspension is then transferred to erythroid culture medium II containing feeder cells and cultured under hypoxic conditions for 7-14 days before being transferred to normoxic conditions to obtain specific iPSCs.

[0010] Furthermore, in step S1 III, the specific iPSCs are mixed with sgRNA and Cas9 and then electroporated. The electroporated cell suspension is transferred to E8 medium containing factor Y and cultured under normoxic conditions to obtain the repaired cell line. The sequence of sgRNA is shown in SEQ ID NO.1.

[0011] Furthermore, in step S3 I, iPSCs are induced to form homogeneous clones, and then induced into hematopoietic endothelial cells under hypoxic conditions using differentiation medium, enriching CD34. + Cells eventually transform hematopoietic endothelium into hematopoietic cells.

[0012] Furthermore, in step S3 II, iPSCs are induced to form embryoids, which are then cultured in a red-based induction medium under normal oxygen conditions.

[0013] Secondly, this application provides an iPS cell model that simulates erythroid differentiation arrest, which is achieved using the following technical solution.

[0014] An iPS cell model simulating erythroid differentiation arrest was constructed using the above-described method.

[0015] Thirdly, this application provides a use for an iPS cell model that simulates erythroid differentiation arrest, which is achieved by the following technical solution.

[0016] The use of the above-mentioned iPS cell model simulating erythroid differentiation arrest in screening drugs for the treatment of anemia.

[0017] Furthermore, the anemia described is sideroblastic anemia.

[0018] This application offers the following advantages. It provides a stable, passageable iPS cell line constructed from bone marrow mononuclear cells of MLASA patients, mimicking erythroid differentiation arrest. This invention requires no special treatment, providing a model basis for drug development and target exploration in SA or other anemias. Furthermore, the erythroid differentiation arrest iPS cell line model is highly efficient and convenient, enabling more experimental platforms for in-depth research on SA or other anemias, demonstrating promising application prospects, economic benefits, and market potential. Attached Figure Description

[0019] Figure 1 This is a flowchart illustrating the construction process of the iPS cell line (a) simulating erythroid differentiation arrest and its repair line (b) according to the present invention. Figure 2This is a diagram showing the genotype (a) and iPSC pluripotency verification results of the iPS cell model of this invention (b. RT-qPCR detection of transcriptional levels of pluripotency markers; c. Immunofluorescence assay detection of protein expression levels of pluripotency markers; d. Teratoma assay to assess the three germ layer differentiation capacity of iPSCs). Figure 3 This invention uses a hypoxia method to induce erythroid differentiation in iPS cells. The flowchart (a) and result diagram (b) show representative cell characteristics at each stage of iPSC differentiation, where i is the iPSC clonal morphology, ii is a flow cytometry plot of the proportion of hematopoietic endothelial cells, iii is a flow cytometry plot of the proportion of erythrocytes, and iv is a flow cytometry plot of CD71. + CD235 + c. Statistical graph of iPSC clone size; d. Statistical graph of the proportion of hematopoietic endothelial cells produced; e. Statistical graph of the proportion of erythrocytes produced. Figure 4 This invention uses normoxic iPS cells for erythroid induction. The flowchart (a) and result diagram (b) are shown below: flow cytometry representation of cell proportions at each stage of normoxic iPSC differentiation, i is the flow cytometry diagram of the proportion of hematopoietic endothelial cells produced, ii is the flow cytometry diagram of the proportion of erythrocytes produced; c. Statistical graph of the proportion of hematopoietic endothelial cells produced; d. Statistical graph of the proportion of erythrocytes produced). Detailed Implementation

[0020] The present patent application will be further described below with reference to the embodiments.

[0021] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used in the following preparation examples and examples are commercially available unless otherwise specified.

[0022] I. Construction of patient-specific iPSCs and their repair strains (1) Isolation of mononuclear cells from the patient's bone marrow 1) Equilibrate Ficoll and 1×PBS to room temperature in advance, which takes about 1 hour.

[0023] 2) Centrifuge bone marrow samples at 1500 rpm for 7 minutes.

[0024] 3) Transfer the supernatant to a new 1.5 ml EP tube, flash freeze in liquid nitrogen, and store at -80°C. The supernatant contains numerous metabolites that can be used for targeted detection.

[0025] 4) Add an equal amount of 1×PBS to the remaining cells and mix thoroughly.

[0026] 5) Transfer the mixture to a 15 ml centrifuge tube containing approximately two-thirds of the volume of Ficoll. Tilt the centrifuge tube containing Ficoll at a 45-degree angle during the transfer. Be as gentle as possible throughout the process. The mixture will eventually be distributed on top of the Ficoll.

[0027] 6) Centrifuge at 2000 rpm for 30 minutes, increasing the speed by 3 and decreasing it by 1.

[0028] 7) Take the middle white membrane layer and centrifuge at 1600 rpm for 6 minutes. Transfer the lower precipitate to a 1.5 ml EP tube and freeze in liquid nitrogen for DNA extraction.

[0029] 8) Discard the supernatant, add 5 ml of 1× PBS, and resuspend thoroughly. Centrifuge at 1600 rpm for 6 minutes.

[0030] 9) Repeat step 8).

[0031] 10) After discarding the supernatant, add 1 ml of 1× PBS and take 10 μl for cell counting. Perform subsequent experiments or cryopreserve the cells. Cryopreservation solution: 10% DMSO + 90% FBS.

[0032] (2) Construction of patient-specific iPSCs 1) Resuscitate frozen bone marrow mononuclear cells (BM-MNCs), with a cell count greater than 1×10⁻⁶. 7 .

[0033] 2) According to 10 6 -10 7 Cells were cultured at a density of 1 / ml in 6-well plates using Erythroid Culture Medium II (Red II), designated Day-6. Red II formulation: HSCEM supplemented with a final concentration of 100 ng / ml hSCF, 10 ng / ml IL-3, 2 U / ml EPO, 20 ng / ml IGF-1, 1 μM DEX, 0.2 mM 1-thioglycerol, 1× L-glutamine, and 1× P / S. After filtration through a 0.22 μm sterile membrane, the culture was stored at 4 °C and used within one month.

[0034] 3) Add 1 ml of Red II on Day-3 and Day-1 respectively.

[0035] 4) On Day 1, treat 6-well plates with 0.1% gelatin, incubate at 37°C for 30 minutes, then aspirate the gelatin. Additionally, resuscitate feeder cells and culture them in MEF medium. MEF medium formulation: DMEM medium supplemented to a final concentration of 10% FBS, 1× L-glutamine, and 1× P / S. Store at 4°C.

[0036] 5) Culture BM MNCs with Red II medium until Day 0. Replace the feeder cells laid on Day 1 with 1.5 ml of Red II medium and equilibrate in an incubator for half an hour.

[0037] 6) Prepare electroporation buffer by mixing 57 μl solution and 13 μl supplement per serving. Then add the plasmid containing four Yamanaka transcription factors in the specified proportions (see Efficient Reprogramming of Human Cord Blood CD34 for construction instructions). + Cells Into Into Induced Pluripotent Stem Cells With OCT4 and SOX2Alone. Xianmei Meng, Amanda Neises et al. Mol Ther. 2012 Feb; 20(2): 408-416.or doi: 10.1038 / mt.2011.258), with a concentration as high as possible greater than 1000 ng / μl.

[0038] 7) After thoroughly mixing the suspended BM-MNCs by pipetting, transfer the mixture to a 15 ml centrifuge tube and count 10 μl. Each electroporation reaction requires 2 × 10⁻⁶ cells / mL. 6 Aliquot BM-MNCs into 15 ml centrifuge tubes. Centrifuge at 1500 rpm for 5 minutes, discard the supernatant, gently resuspend the cell pellet in electroporation buffer, transfer it to an electroporation cuvette (avoiding air bubbles as much as possible), and then place it on a Lonza electroporator for electroporation.

[0039] 8) The cell suspension after electroporation should be immediately transferred to the culture dish containing feeder and red II prepared in 5), mixed well, placed in a hypoxia box and sealed, filled with hypoxia mixed gas, and placed in a 37°C incubator for incubation. This time is recorded as Day 0. 9) On Day 2, add 1.5 ml of iPSC medium directly, mix well, and continue culturing in the low-temperature chamber. iPSC medium: Take DMEM / F12 medium and add FGF2 to a final concentration of 50 ng / ml, ascorbic acid of 50 μg / ml, and 1× 1-glutamine, 1× P / S, 1× non-essential amino acids, and 1× ITS. After filtering through a 0.22 μm sterile filter membrane, store at 4°C and use within one month.

[0040] 10) On Day 4, discard the upper layer of culture medium and add 2 ml of iPSC medium. On Day 6 and thereafter, replace 2 ml of E8 medium (containing 0.25 mM NaB) every other day until colony formation, and culture under hypoxic conditions. 11) After approximately 7-14 days of electroporation, clones can be observed to form. Under a microscope, select individual clones, transfer them to a Matrigel-coated 24-well plate, add E8 medium, and incubate under normal aerobic conditions.

[0041] 12) Once the clone has grown to a suitable size, pass it through multiple generations for amplification. After about 10 generations, pluripotency can be verified.

[0042] (3) Construction of repair strains 1) Prepare electroporation buffer according to each 57 μl solution and 13 μl supplement.

[0043] 2) RNP complex preparation: Take 25 μl of the above electroporation buffer for each group, add 2 μl of Syn68-sgPUS1-dC523 (100 μM) and 1 μl of Cas9 (10 mg / ml). Mix well and incubate at room temperature for 10 minutes. The sequence of Syn68-sgPUS1-dC523 is as follows: ATCCGAATGTGAGAGGAAGG (SEQ ID NO.1) 3) Add 1 μl of 3424-PUS1-ssODN (100 μM), 0.5 μg of pEF1-BCL-XL-wpre-polyA, and 0.5 μg of pEF1-TP53BPin-Wpre-polyA to the remaining electroporation solution. The sequence of 3424-PUS1-ssODN is as follows: A*G*G*TGTGGCTGATTGACGACATTCTAGAAAAGATCAACAGCCACCTacCCTCTCACATTCGGATTCTGGGTAAGCCTTGCAGTGCAGGCGGCCACAC*A*C*C (SEQ ID NO.2) 4) Accutase digests iPSCs that have grown to 60-70% into single cells. Do not vigorously pipette. Filter through a 70 μm filter to obtain a single-cell suspension. Count the cells. Take 1×102 6 For each cell sample, perform electroporation. After centrifugation, add electroporation buffer, gently resuspend, and carefully transfer to an electroporation cuvette, ensuring no contact with the metal walls. Perform electroporation using the pre-set program.

[0044] 5) After completing the electroporation, immediately place the electroporation cup in a 37°C incubator for 5 minutes and preheat the E8 medium (containing Y factor).

[0045] 6) Slowly and gently transfer the cell suspension into preheated culture medium and dispense it into two Matrigel-treated wells. Add NaB to one well to a final concentration of 1 mM and leave the other well empty.

[0046] 7) Cultured under normal aerobic conditions for 3 days, cells were collected and knock-in (KI) efficiency was analyzed by PCR ICE.

[0047] 8) Cells with high KI efficiency are picked individually under a microscope or sorted in 96-well flow cytometry plates. After PCR, they are sequenced to determine whether gene repair has been completed.

[0048] (4) Cultivation of iPSCs Culture of iPSCs and ESCs: Matrigel-coated well plates were used for the culture of iPSCs and ESCs. The culture medium was Essential 8™ (E8) or mTeSR™1 (mTeSR1) complete medium, which was replaced daily with fresh medium equilibrated to room temperature. Cells were passaged every 3-5 days. For passage, after digestion with DPBS (containing 0.5 mM EDTA) or TrypLE for 5 minutes, the culture was terminated with medium containing 10 μM Y27632 (Y factor), and the cells were gently dispersed into clumps of 3-10 cells each. Cells were then passaged at an appropriate density. On the first day of thawing and passage, the medium should contain 10 μM Y factor, which was removed within 24 hours. Cell cryopreservation was performed using trehalose cryopreservation solution (30% 0.3 g / ml trehalose + 50% FBS + 20% DMSO). iPS cell lines are regularly tested for mycoplasma to ensure they are free from contamination by cells, fungi, and mycoplasma during culture. Cells are cultured in a constant-temperature cell incubator at 37°C with saturated humidity and 5% CO2.

[0049] II. iPSC Genotyping and Pluripotency Verification (1) Genotyping A. Genomic DNA extraction (TIANamp Genomic DNA Kit) 1) Take 1 × 10 6 The cells (iPSCs were pre-digested) were transferred to a 1.5 ml EP tube, centrifuged at 3000 rpm for 5 minutes, the supernatant was discarded, and 200 μl of Buffer GA was added.

[0050] 2) Add 20 μl of proteinase K and mix thoroughly. Incubate at 56°C for 2 h.

[0051] 3) Then add 200 μl of Buffer GB, mix thoroughly, and incubate at 70°C for 10 minutes.

[0052] 4) Add 200 μl of anhydrous ethanol and shake thoroughly for 15 s.

[0053] 5) Transfer the mixture from 4) to a Spin Column CB2 (placed in a 2 ml collection tube) and centrifuge at 12,000 rpm for 30 s. Discard the filtrate in the collection tube.

[0054] 6) Add 500 μl of Buffer GD to the Spin Column CB2 tube and centrifuge at 12000 rpm for 30 s. Discard the filtrate in the collection tube.

[0055] 7) Add 600 μl of Buffer PW to the Spin Column CB2 tube and centrifuge at 12000 rpm for 30 s. Discard the filtrate in the collection tube.

[0056] 8) Repeat 7).

[0057] 9) Centrifuge at 12000 rpm for 2 minutes. Discard the collection tube and place the Spin Column CB2 into a new 1.5 ml EP tube. Add 50 μl of Buffer TE directly above the membrane in the center of the Spin Column CB2 tube. Incubate at room temperature for 5 minutes, then centrifuge at 12000 rpm for 2 minutes.

[0058] 10) Nanodrop detection of DNA concentration B. Polymerase chain reaction (PCR) 1) Reaction system

[0059] 2) Reaction conditions

[0060] C. Agarose gel electrophoresis to determine sample purity 1) Clean the glue-making box, glue-making plate and comb, and assemble them.

[0061] 2) Weigh the required agar powder (generally, to prepare 1.5% agar gel, dissolve 1.5 g of agar powder in 100 ml of 1× TAE) and pour it into an Erlenmeyer flask. Add 1× TAE. The TAE stock solution is 50×, and the formula is as follows:

[0062] 3) Dissolve the powder completely in a microwave oven at high temperature, then let it sit at room temperature until it cools to about 60°C (not hot to the touch). Add an appropriate amount of nucleic acid dye and mix thoroughly.

[0063] 4) Pour the agar solution into the gel casting plate and let it stand at room temperature until the gel solidifies.

[0064] 5) Remove the comb teeth, add 10 μl to each well, and add DNA ladder to both sides.

[0065] 6) Electrophoresis at 130 V for 30-60 minutes.

[0066] 7) Images were captured using the Tanon fully automated digital gel imaging system. The results were analyzed using ImageJ.

[0067] D. Liquid or gel strip samples are sent to BGI Genomics for Sanger sequencing.

[0068] (2) Detection of transcriptional levels of pluripotency markers A. RNA extraction 1) Take 10 5 -10 6 Transfer the cells to a 1.5 ml EP tube, centrifuge at 3000 rpm for 5 minutes, and discard the supernatant.

[0069] 2) Add 1 ml of PBS to the EP tube and resuspend thoroughly. Centrifuge at 3000 rpm for 5 minutes, discard the supernatant, and repeat once.

[0070] 3) Shake the remaining cell pellet at high speed for 15 seconds, then add 1 ml of TRIzol™ reagent and resuspend the cells with a pipette. Quick-freeze in liquid nitrogen. Store at -80°C or proceed directly to the next experiment.

[0071] 4) Centrifuge the Phasemaker tube at 12000 rcf for 30 s.

[0072] 5) Thaw the TRIzol-lysed cell mixture on ice. Transfer the mixture to a Phasemaker tube. Incubate at room temperature for 5 minutes.

[0073] 6) Add 200 μl of chloroform to each tube, cap the tube, and shake vigorously for 15 seconds. Incubate at room temperature for 10 minutes.

[0074] 7) Centrifuge at 13000 rcf, 4°C for 5 minutes.

[0075] 8) Transfer the clear liquid from the top layer to a new 1.5 ml EP tube and add 500 μl of isopropanol.

[0076] 9) (Optional) When the cell count is low, add 0.5 μl of glycogen to help RNA precipitation and visualization.

[0077] 10) After incubating on ice for 10 minutes, centrifuge at 12000 rcf, 4°C for 10 minutes.

[0078] 11) Discard the supernatant and resuspend the precipitate in 1 ml of 75% ethanol.

[0079] 12) Centrifuge at 7500 rcf, 4°C for 5 minutes.

[0080] 13) Discard the clear liquid on the top layer, open the lid and let it air dry for 5 minutes (the white precipitate will gradually become transparent).

[0081] 14) Dissolve the RNA precipitate in 20 μl of RNase-free water.

[0082] 15) Nanodrop detection of RNA concentration.

[0083] B. Reverse transcription to synthesize cDNA 1) Removal of genomic DNA Transfer 950 ng of RNA to an 8-tube pouch (make up to 7 μl with RNase-free water), then add 2 μl of 5× gDNA Eraser Buffer and 1 μl of gDNA Eraser. Cap the pouch, shake it briefly, and then place it in a PCR instrument and incubate at 42°C for 2 minutes.

[0084] 2) cDNA synthesis Preparation of reaction solutions: Each reaction requires 4 μl of 5× primerscript buffer 2, 4 μl of RTPrimer Mix, 1 μl of RNase-free water, and 1 μl of PrimerScript RT Enzyme Mix I. Add the prepared reaction solutions to the 8-cell tubing, cap it, and place it in a PCR instrument. Incubate at 37°C for 15 minutes, followed by incubation at 85°C for 5 seconds. Store the synthesized cDNA samples at -20°C.

[0085] C. Real-time quantitative PCR (RT-qPCR) 1) Prepare the RT-qPCR reaction system according to the table below, with 3 replicate wells for each sample. Before loading, centrifuge the microplates using a MINIP-2500 microplate for 60 seconds.

[0086] RT-qPCR reaction system

[0087] 2) Perform RT-qPCR reactions on the QuantStudio 5 instrument according to the procedure described in the table below.

[0088] RT-qPCR reaction program

[0089] See the experimental results. Figure 2 b.

[0090] (3) Detection of expression levels of pluripotency marker proteins (immunofluorescence) 1) iPSCs and ESCs were seeded in 24-well plates (on the bottom slide) at a cell growth density of 50-60%.

[0091] 2) Discard the culture medium, add 500 μl of 1× PBS, and place on a shaker at room temperature for 3 minutes.

[0092] 3) Fixation: Discard 1×PBS, add 250 μl of 4% paraformaldehyde, and place on a shaker at room temperature for 15 minutes.

[0093] 4) Discard the supernatant, add 500 μl of 1× PBS, and incubate on a shaker at room temperature for 3 minutes.

[0094] 5) Permeabilization: Discard 1× PBS, add 250 μl of permeabilizing agent (PBS contains 0.1% Triton-X-100, prepare fresh before use), and place on a shaker at room temperature for 15 minutes.

[0095] 6) Discard the supernatant, add 500 μl of 1× PBS, and incubate on a shaker at room temperature for 3 minutes. Repeat three times.

[0096] 7) Discard 1× PBS, add 500 μl PBB (PBS contains 0.5% BSA) and wash 3 times, each time placing on a shaker at room temperature for 3 minutes.

[0097] 8) Blocking: Discard PBB, add 500 μl of blocking solution (PBS containing 2% BSA), and incubate on a shaker at room temperature for 45 minutes.

[0098] 9) Primary antibody incubation: Discard the blocking solution, add 500 μl of primary antibody diluted with PBB at a suitable concentration (refer to the antibody instructions for specific dilution concentration), place on a shaker at 4°C, and incubate overnight.

[0099] 10) Recover the primary antibody, add 500 μl of PBB and wash 3 times, placing it on a shaker at room temperature for 3 minutes each time.

[0100] 11) Secondary antibody incubation: Discard PBB, add 500 μl of secondary antibody diluted with PBB at a suitable concentration (generally between 1:250 and 1:500, and the species should be the same as the primary antibody), and place on a shaker at room temperature in the dark for 1 h.

[0101] 12) Recover the secondary antibody, add 500 μl of PBB and wash 3 times, each time placing it on a shaker for 3 minutes at room temperature in the dark.

[0102] 13) Remove PBB, add 500 μl of 1× PBS and wash 3 times, each time at room temperature in the dark on a shaker for 3 minutes.

[0103] 14) Nuclear staining: Discard 1× PBS, add 250 μl of DAPI dilution solution (1:500), and place on a shaker at room temperature in the dark for 5 minutes.

[0104] 15) Add 500 μl of 1×PBS and wash 3 times, each time placing on a shaker for 3 minutes at room temperature in the dark.

[0105] 16) Add 10 μl of mounting medium to the slide beforehand (keep it at 56°C to prevent premature solidification), quickly remove the slide, and invert it onto the spot where the mounting medium was added, trying to avoid the formation of air bubbles. Keep the entire process away from light.

[0106] 17) The prepared immunofluorescence slides can be placed in a humidified chamber at 4°C for two weeks. Images should then be taken using a two-photon laser confocal microscope.

[0107] See the experimental results. Figure 2 c.

[0108] (4) Differentiation of teratomas into three germ layers 1) Cell treatment: iPSCs and ESCs were grown to 80-90% in a 10 cm dish. The supernatant was discarded, and the cells were carefully scraped off with a cell scraper. The cells were then washed twice with pre-chilled PBS, and the cells and wash buffer were transferred to the same 50 ml centrifuge tube. The tube was centrifuged at 1500 rpm for 5 minutes at 4°C. The supernatant was discarded, and the cells were resuspended in 500 μl of pre-chilled high-concentration Matrigel. 10 μl of the resuspended cells were counted, and the concentration was adjusted to 3 × 10⁻⁶ cells based on the count results. 6 / 150 μl, and transfer to a 1.5 ml EP tube, and quickly place on ice to prevent Matrigel from solidifying.

[0109] 2) Cell injection: Inject approximately 3 × 10⁻⁶ cells into the thigh muscles of 5-6 week old NSG mice on both sides. 6 The cells. The syringe used is an insulin needle syringe.

[0110] 3) Teratoma sampling: Around 8 weeks of age, a mass forms on the thigh of the mouse. After dissection, a cystic solid tumor structure with a complete capsule can be seen. The tumor is removed by blunt dissection with forceps. If the tumor is too large, it is cut into pieces with a scalpel with a diameter of about 2 cm.

[0111] 4) Tissue sectioning and HE staining: The dissected mass was quickly placed in 4% paraformaldehyde and fixed overnight at room temperature. It was then sent for laboratory pathology. The tissue section confirmed that it was a teratoma. At the same time, the HE staining results clearly showed the formation of the three germ layers.

[0112] See the experimental results. Figure 2 d.

[0113] III. Targeted Differentiation of iPSC Red Series (1) Hypoxia method for erythroid induction A. Reagent Preparation 1) iPSC culture medium: mTeSR1 + 10 μM Y-27632, store at 4°C for two weeks, or at -20°C for six months.

[0114] 2) iPSC spheroid culture medium: mTeSR1 + 625 ng / ml imatrix-511, prepare fresh before use.

[0115] 3) The formulation of the differentiation culture medium for Day 0 is as follows:

[0116] 4) The formulation of the differentiation culture medium for Day 2 is as follows:

[0117] 5) Prepare calcium- or magnesium-free phosphate-buffered saline (D-PBS).

[0118] 6) 1 mM EDTA: Add 1 ml of 0.5 M EDTA to 499 ml of DPBS.

[0119] 7) The culture medium formula for endothelial-to-hematopoietic (EHT) conversion is as follows:

[0120] B. Formation of homogeneous iPSC clones (Day 3 to Day 0) 1) iPSCs grew to 70-80% on Matrigel-coated plates. Cells used for induction of differentiation were all acclimatized with mTeSR1.

[0121] 2) Aspirate the culture medium and wash the cells twice with DPBS. Rinse the cells with TrypLE. Incubate at 37°C for 15 minutes.

[0122] 3) Resuspend the cells in mTeSR1 and transfer the suspension to a 15 ml centrifuge tube. Centrifuge at 200 rcf for 3 minutes.

[0123] 4) Discard the supernatant, resuspend the cells in iPSC culture medium, and count 10 μl of cells. Adjust the cell concentration to 2.5 × 10⁻⁶. 5 / ml.

[0124] 5) Add 500 μl of Anti-Adherence Rinsing Solution to each well of the AggreWell™ 400 and centrifuge at 13000 rcf for 5 minutes. Discard the Anti-Adherence Rinsing Solution.

[0125] 6) Observe under a microscope. There should be no air bubbles at the bottom of the plate. If there are, repeat the previous step.

[0126] 7) Discard anti-adherence rinsing solution.

[0127] 8) Rinse with 2 ml of mTeSR1, discard the rinse, and then add 1 ml of iPSC culture medium.

[0128] 9) Seeding cells: Seed 2.5 × 10⁶ cells in AggreWell™ 400. 5 Each cell is fed into each well, allowing 200 cells to fall into each micropore, which is expected to form 1250 microspheres.

[0129] 10) Make up the culture medium volume to 2 ml, gently blow the cells up and down to distribute them evenly, and try not to generate air bubbles.

[0130] 11) Centrifuge at 100 rcf for 3 minutes.

[0131] 12) Observe under a microscope whether the distribution is uniform.

[0132] 13) Incubate for 24 hours and observe whether spherical bodies form. If spherical bodies form, collect them; if not, change the medium.

[0133] 14) Collect spherical objects: a) Using a 2 ml pipette, pick up 1 ml of culture medium and blow it from top to bottom, being gentle to avoid damaging the spherical structure.

[0134] b) Use a 40 μm filter to remove single cells while retaining spheroids.

[0135] c) Wash AggreWell™ 400 again with 1 ml of culture medium and filter through the filter described in b). Repeat 3–5 times.

[0136] d) Observe under a microscope whether the spheroids in the AggreWell™ 400 have been completely collected.

[0137] e) Invert the filter onto the 6-well plate and rinse with 2-5 ml of complete culture medium.

[0138] f) Blow 2-3 times and transfer to a 15 ml tube. Take 50 μl and place it in a 96-well flat plate. Count the spheroids under a microscope. Calculation method: Total number = Number of spheroids in 50 μl / 50 μl × Total volume of spheroid suspension.

[0139] 16) Resuspend the spheroids in iPSC spheroid culture medium at a density of 4-5 spheroids / cm³. 2 The seeds were sown at a density of 10 cm⁻¹ into 6-well plates.

[0140] 17) Incubate in a normal oxygen 37°C incubator for 3 days per week.

[0141] C. Induction of hematopoietic endothelial (HE) cells (Day 0–Day 4) 1) Day 0-2: Discard the culture medium, add Day 0 differentiation solution, fill the hypoxia box with hypoxia mixed gas (5% O2 + 5% CO2 + 90% N2), and incubate in a 37°C incubator.

[0142] 2) Day 2-4: Discard the culture medium, add Day 2 differentiation solution, and culture in a hypoxic box.

[0143] D. HE cell enrichment (Day 4) 1) Transfer the cell supernatant to a 50 ml centrifuge tube, wash twice with DPBS, rinse once with an appropriate amount of TryplE, and digest at 37°C for 30 minutes.

[0144] 2) Add 1 mM EDTA to dissociate to single-cell level, stop the reaction with cell supernatant, centrifuge at 200 rcf for 3 minutes, resuspend in 1 ml 1× PBS, and count 10 μl. Take 5×10 5 Cells were incubated with 1.5 μl of flow cytometry antibody mix at 4°C for 30 minutes, followed by flow cytometry analysis to determine the proportion of hematoxylin and eosin (HE) production. The flow cytometry antibody formulation is as follows:

[0145] 3) Add an appropriate amount of PBE (300 μl / 1×10⁻⁶) to the remaining cells based on the counting results. 8 Cells were resuspended, and then an equal amount of FcR inhibitor and CD34 magnetic beads (100 μl / 1×10⁻⁶) were added. 8 (Cells), mix thoroughly by blowing.

[0146] 4) Incubate at 4°C in the dark for 30 minutes.

[0147] 5) Add 5 ml of 1× PBS and centrifuge at 200 rcf for 5 minutes.

[0148] 6) Place the yellow membrane on an MS / LS column and wash the column with 500 μl / 5 ml of 1× PBS.

[0149] 7) Discard the cell supernatant, resuspend the cells in 500 μl / 3 ml of 1× PBS, and transfer them to the column.

[0150] 8) Wash three times with 500 μl / 3 ml of 1× PBS.

[0151] 9) Rinse the cells in the MS / LS with 1 ml / 5 ml of 1× PBS.

[0152] 10) Collect CD34 after centrifuging at 200g for 5 minutes. + cell.

[0153] E. Transformation of hematopoietic endothelium into hematopoietic tissue (EHT, Day 4–Day 11) 1) Resuspend CD34 in 1 ml of EHT medium + Cells. Adjust the live cell density to 2 × 10⁻⁶. 5 / ml. Take 1×10 5 Cells were incubated with 1.5 μl of flow cytometry antibody mix at 4°C for 30 minutes, and then the CD34 cells sorted by magnetic beads were detected by flow cytometry. + Cell purity. Antibody formulation as above.

[0154] 2) Dilute 1 mg / ml fibronectin with 1× PBS to 5 μg / ml.

[0155] 3) Add 500 μl of fibronectin at a concentration of 5 μg / ml to a 24-well plate (do not spread it around the edges; reserve it for adding water to prevent drying out. That is, only use the 8 wells in the middle) and incubate at room temperature for 30 minutes.

[0156] 4) Discard the coated fibronectin and add 500 μl of CD34. + Cells (i.e., 1×10) 5 / well), cultured under low oxygen for one week.

[0157] F. Hematopoietic cell detection (Day 11) 1) Transfer the supernatant to a flow cytometer and wash twice with DPBS.

[0158] 2) Add an appropriate amount of TrypLE, aspirate, and incubate at 37°C for 5 minutes.

[0159] 3) Add 1 ml of 1× PBS, mix well and resuspend, combine with the supernatant, and centrifuge at 200 rcf for 3 minutes.

[0160] 4) Discard the supernatant, resuspend the cells, label with flow cytometry antibody, incubate at 4°C for 30 minutes, and then perform flow cytometry analysis. The flow cytometry antibody formulation is as follows:

[0161] *After detection, CD71 + CD235a + Cells are sorted.

[0162] See the experimental results. Figure 3 .

[0163] (2) Red line induction by normoxic method A. Embryomorph (EB) formation 1) On Matrigel-coated plates, iPSCs grow to 70-80%.

[0164] *The cells used for inducing differentiation have all been acclimatized with mTeSR1.

[0165] 2) Discard the supernatant, add 1 ml of DPBS to wash twice, add 1 ml of preheated TrypLE, and digest at 37°C for 5 minutes.

[0166] 3) Resuspend the cells thoroughly, transfer them to a 15 ml centrifuge tube, add 7 ml of stop culture medium (DMEM F / 12 + 10% FBS), and then filter through a 70 μm cell filter.

[0167] 4) Centrifuge at 300 rcf for 5 minutes, discard the supernatant, and add 3 ml of 1× PBS.

[0168] 5) Centrifuge at 300 rcf for 5 minutes, then discard the supernatant. Repeat once.

[0169] 6) Discard the supernatant, resuspend thoroughly in APEL2 with added factor, and count the cells. The culture medium formula is as follows:

[0170] 8) Adjust the cell concentration to 6×10 4 / ml, transfer the cell suspension to a 60 mm dish and gently rub 10 times with a 1 ml pipette tip.

[0171] 9) Then, using a pipette, seed the cells at a rate of 100 μl per well into a specially designed low-adsorption 96-well plate, seeding only the central 60 wells, and adding 150 μl of 1× PBS to the surrounding wells using a pipette.

[0172] 10) Cover the 96-well plate with sealing film, centrifuge at 300 rcf for 5 minutes.

[0173] 11) Observe the cell state under a microscope.

[0174] 12) Culture the cells in a 37°C incubator under normal oxygen for 6 days. Avoid moving the cells as much as possible to prevent contamination.

[0175] 13) On the third day, take out the cells to check for contamination. If contaminated, discard them directly.

[0176] B. HE cell detection 1) When the EB spheres differentiate to day 6, take 10 EB spheres and digest them with TrypLE in a 37°C water bath for 10 minutes.

[0177] 2) Terminate digestion with the supernatant, centrifuge at 300 rcf for 5 minutes.

[0178] 3) Discard the supernatant, add 1.2 μl of flow cytometry antibody to the remaining 100 μl of liquid, incubate at 4°C in the dark for 30 minutes, and then perform flow cytometry detection. The antibody formulation is as follows:

[0179] 4) After confirming that approximately 20% of HE has been generated, collect the EB spheres. Proceed to the next experiment.

[0180] C. Red-lineage induction 1) Add 500 μl of 2% gelatin to each well of a 12-well plate and incubate at room temperature for 1 hour. (Can be used within one week if incubated at 37°C) 2) Resuspend the EB spheres in erythroid induction medium. The formulation of the erythroid induction medium is as follows:

[0181] 3) Discard the gelatin and seed 10-12 EB balls per well into a 12-well plate. Incubate at 37°C with normal oxygen for 6 days.

[0182] 4) On day 6, the erythroid ratio was determined. Cells from each well were filtered through a yellow membrane, and 1 μl of flow cytometry antibody was added. The cells were incubated at 4°C in the dark for 30 minutes before flow cytometry analysis. The antibody formulation is as follows:

[0183] Flow cytometry analysis of iPSC erythroid-induced differentiation was performed using a BD FACS Canto II flow cytometer, and the results were analyzed using FlowJo 10.4. Furthermore, sorting was performed using a BD FACS AriaIII flow cytometer.

[0184] See the experimental results. Figure 4 .

[0185] In summary, this application reprogrammed mononuclear cells derived from the bone marrow of patients carrying homozygous mutations in PUS1 (c.523delC, p.P175fs) into induced pluripotent stem cells (iPSCs) via electroporation of non-integrating Yamanaka factor plasmids. Simultaneously, site-directed sgRNAs and repair templates were designed targeting this mutation site, and pluripotent stem cell lines repairing the PUS1 mutation site were constructed using CRISPR / Cas9 technology. After verifying the pluripotency of iPSCs, their differentiation capacity was evaluated by erythroid-directed differentiation using two different induction methods (hypoxia and normoxic methods) on normal human iPSCs (Normal-PSCs), patient-specific iPSCs (MLASA-iPSCs), and their repaired lines (MLASA-Res-iPSCs). In both systems, erythroid differentiation arrest was observed in iPSCs with the PUS1 P175fs mutation, while the repair group could restore erythroid differentiation efficiency to normal levels. This result indicates that PUS1 plays an important regulatory role in erythroid differentiation, and its protein deficiency leads to abnormal erythroid development.

[0186] The embodiments described in this specific implementation are preferred embodiments of this application and are not intended to limit the scope of protection of this application. Therefore, all equivalent changes made in accordance with the structure, shape and principle of this application should be covered within the scope of protection of this application.

Claims

1. A method for constructing an iPS cell model simulating erythroid differentiation arrest, characterized in that: Includes the following steps: Yamanaka factor was introduced into mononuclear cells via electroporation, reprogramming them into induced pluripotent stem cells. After pluripotency verification, erythroid-directed differentiation was induced using either hypoxia or normoxic methods. The specific steps are as follows: S1. Construction of Specific iPSCs I. Isolation of mononuclear cells from the patient's bone marrow; II. Construction of patient-specific iPSCs; III. Cultivation of iPSCs; S2. iPSC Genotyping and Pluripotency Verification I. Genotyping; II. Detection of transcriptional levels of pluripotency markers; III. Detection of expression levels of pluripotency marker proteins; IV. Differentiation of teratomas across the three germ layers; S3. iPSC Red Series Directed Differentiation I. Hypoxia method for erythroid induction; II. Red series induction using the normoxic method; In step S1 II, a plasmid carrying the Yamanaka transcription factor was introduced into bone marrow mononuclear cells of patients carrying homozygous mutations of PUS1 c.523delC, p.P175fs by electroporation. The cell suspension after electroporation was transferred to erythroid culture medium II containing feeder cells and cultured under hypoxic conditions for 7-14 days before being transferred to normoxic conditions to obtain specific iPSCs. Red series medium II formulation: HSCEM supplemented with a final concentration of 100 ng / ml hSCF, 10 ng / ml IL-3, 2 U / ml EPO, 20 ng / ml IGF1, 1 μM DEX, 0.2 mM 1-thioglycerol, 1× L-glutamine, and 1× P / S.

2. The method for constructing an iPS cell model simulating erythroid differentiation arrest according to claim 1, characterized in that: In step S3 I, iPSCs are induced to form homogeneous clones, and then induced into hematopoietic endothelial cells under hypoxic conditions using differentiation medium, enriching CD34. + The cells will eventually transform from hematopoietic endothelial cells into hematopoietic cells. The Day 0 differentiation culture medium formula is as follows: CHIR99021 2μM, BMP4 80 ng / ml, VEGF 80 ng / ml, and Essential 8 to be supplemented. The Day 2 differentiation culture medium formula is as follows: SB431542 1μM, SCF 100 ng / ml, VEGF 80 ng / ml, and Essential 6 to be supplemented.

3. The method for constructing an iPS cell model simulating erythroid differentiation arrest according to claim 1, characterized in that: In step S3 II, iPSCs are induced to form embryoids, which are then cultured in a red-based induction medium under normal oxygen conditions.

4. An iPS cell model simulating erythroid differentiation arrest constructed by any of the construction methods described in claims 1-3.

5. The use of the iPS cell model of claim 4, which simulates erythroid differentiation arrest, in screening drugs for the treatment of anemia.

6. The use according to claim 5, characterized in that: The anemia described is sideroblastic anemia.

Images