Phyllotreta striolata lethal gene spt16 and application thereof

Abstract

This invention discloses a lethal gene fragment Spt16 of the yellow-striped flea beetle, the sequence of which is shown in SEQ ID NO.1. This invention also discloses a method for cloning the lethal gene fragment Spt16. Furthermore, this invention discloses the dsRNA sequence (SEQ ID NO.4) of the lethal gene Spt16 and its preparation method. This invention further discloses the application of dsRNA in killing the yellow-striped flea beetle. This invention utilizes the dsRNA of this gene fragment to feed yellow-striped flea beetles, causing RNA interference and effectively killing them with a mortality rate as high as 75.9%, which can be applied to the control of the yellow-striped flea beetle.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, and in particular relates to a lethal gene Spt16 of the striped flea beetle, its cloning method, its dsRNA preparation method, and its application in pest control. Background Technology

[0002] The striped flea beetle (Phyllotreta striolata) is an oligophagous, globally significant pest that damages various vegetables, particularly cruciferous vegetables such as mustard greens, cabbage, radishes, and bok choy. It has surpassed the diamondback moth to become the number one pest in vegetable production. The larvae feed on plant roots, affecting nutrient absorption and transport, thus impacting plant growth and potentially causing death. Adults feed on leaves, affecting photosynthesis and vegetable quality. Current control methods primarily rely on integrated pest management, including physical and chemical control. However, the use of chemical pesticides can lead to increased pesticide resistance, environmental pollution, ecological damage, and even food safety issues. Therefore, developing environmentally friendly, target-specific pest control strategies is urgently needed.

[0003] Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) silences specific genes and inhibits their expression by specifically degrading the mRNA of the target gene. As a novel, efficient, highly specific, and environmentally friendly biotechnology, RNAi has great potential in pest control and the development of new pesticides, and has already been successfully applied. For example, in 2017, the U.S. Environmental Protection Agency (EPA) approved the world's first transgenic corn variety expressing insect double-stranded RNA (dsRNA), MON87411, which showed excellent control effects against corn rootworms. GreenLight Biosciences' double-stranded RNA spray can be used to control pests, weeds, and harmful fungi. Its first product is suitable for controlling the Colorado potato beetle and is expected to receive formal registration in 2022. Clearly, RNAi has broad development and application prospects in the control of agricultural pests.

[0004] Spt16 is a component of the Facilitated Chromatin Transcription (FACT) complex, a chromatin regulator that recognizes nucleosomes and is responsible for mRNA elongation, DNA replication, and repair. It is an important protein regulating transcription and plays a crucial role in both transcription and DNA replication. The Spt16 gene is essential for life; therefore, RNA interference technology can be used to disrupt the expression of the Spt16 gene in agricultural pests, resulting in lethality and thus pest control. Summary of the Invention

[0005] The purpose of this invention is to address the problems raised in the background art by providing a lethal gene fragment Spt16 of the flea beetle, its cloning method, its dsRNA preparation method, and its applications.

[0006] The technical solution adopted by the present invention to solve its technical problem is: a lethal gene fragment Spt16 of flea beetle, the sequence of which is shown in SEQ ID NO.1.

[0007] Furthermore, it also includes the complementary sequence of SEQ ID NO.1.

[0008] Furthermore, it also includes a fragment of at least 19 consecutive nucleotides of SEQ ID NO.1.

[0009] Furthermore, it also includes the complementary sequence of at least 19 consecutive nucleotides of the fragment of SEQ ID NO.1.

[0010] This invention also discloses a method for cloning the lethal gene fragment Spt16 of the flea beetle, comprising the following steps:

[0011] (1) Total RNA was extracted from *Begonia flavomarginata*, and the first strand of cDNA was synthesized from the extracted total RNA. The first strand of cDNA was used as a template for RT-PCR amplification of the Spt16 gene. The upstream primer sequence for amplifying the Spt16 gene fragment was SEQ ID NO.2 (P1), and the downstream primer sequence was SEQ ID NO.3 (P2). The PCR products were separated by agarose gel electrophoresis, and the target DNA fragment was recovered. The RT-PCR amplification system was as follows: 5×Phusion GC Buffer 20μL, 10mM dNTPs 2μL, DMSO 3μL, Phusion DNA Polymerase 1μL, cDNA template 2μL, ddH2O 64μL, primer P1 (SEQ ID NO.2) 4μL, primer P2 (SEQ ID NO.3) 4μL, and primer P2 (SEQ ID NO.3) 4μL. NO.3) 4μL; PCR reaction program: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 55℃ annealing for 20s, 72℃ extension for 3min, 35 cycles; 72℃ extension for 10min.

[0012] (2) The recovered target DNA fragment is inserted into the DNA polymerase. The Blunt Zero vector was transformed into Escherichia coli T1, plated onto LB solid medium containing ampicillin, and incubated overnight at 37°C.

[0013] (3) Select white single colonies, use SEQ ID NO.2 and SEQ ID NO.3 as primers to perform colony PCR, screen for positive recombinants, pick single colonies that are identified as positive recombinants by colony PCR and shake them in ampicillin LB medium to extract plasmids;

[0014] (4) The plasmid was sequenced using an automated sequencer to obtain the Spt16 gene fragment shown in SEQ ID NO.1.

[0015] The present invention also discloses a dsRNA synthesized from the lethal gene fragment Spt16 of the flea beetle, the sequence of which is shown in SEQ ID NO.1.

[0016] This invention also discloses a method for preparing dsRNA, comprising the following steps: designing and synthesizing primer P3 with sequence SEQ ID NO.5 and primer P4 with sequence SEQ ID NO.6 based on the verified Spt16 gene fragment sequence; using a plasmid containing the lethal gene fragment Spt16 of flea beetle as a template, performing PCR amplification to obtain the amplification product; separating the amplification product by agarose gel electrophoresis to obtain the target DNA fragment; and synthesizing dsRNA using the T7 High Yield RNA Transcription Kit.

[0017] This invention further discloses the application of dsRNA in killing flea beetles.

[0018] This invention discloses a Spt16 gene fragment, a component of the chromatin-promoting transcription complex (FACT), that can cause death in the flea beetle, and its application. The sequence of the Spt16 gene fragment is shown in SEQ ID NO.1. Feeding the flea beetle with the dsRNA of this gene fragment, thus interfering with its RNA activity, can effectively kill the flea beetle, achieving a mortality rate as high as 75.9%. This method can be applied to the control of the flea beetle, laying the foundation for the subsequent development of direct-spray RNA agents for its control. This approach also protects the ecological security of my country's vegetable industry and has significant economic and social benefits.

[0019] This invention provides a lethal gene fragment Spt16 from the yellow-striped flea beetle. Spt16 is a component of the facilitated chromatin transcription complex (FCTC), a chromatin regulator that recognizes nucleosomes and is responsible for mRNA elongation, DNA replication, and repair. It is an important protein regulating transcription and has important physiological functions. This invention synthesizes dsRNA of the Spt16 lethal gene fragment and silences the Spt16 gene using RNAi technology, resulting in a significant lethal effect on the yellow-striped flea beetle with good specificity, making it a green and environmentally friendly insecticide.

[0020] This invention provides an effective target for the prevention and control of flea beetles using RNA interference technology.

[0021] This invention uses a feeding method for RNAi experiments, which reduces mechanical damage to the insect body compared to the injection method and facilitates experimental operation.

[0022] This invention provides a bioassay method for the yellow-striped flea beetle. Through feeding bioassay experiments, it is verified that RNAi of the Spt16 gene has a lethal effect on the yellow-striped flea beetle, providing a new experimental means for establishing a new strategy for pest control using RNAi technology. Attached Figure Description

[0023] Figure 1 The results of Spt16 amplification in this invention are shown, where lane 1 is a 10000bp DNA maker and lane 2 is the Spt16 gene fragment of the flea beetle.

[0024] Figure 2 This is an electrophoresis diagram of dsRNA synthesis in this invention. Lane 3 is a 2000bp DNA maker; lane 4 is the dsRNA of the Spt16 gene fragment of the yellow striped flea beetle.

[0025] Figure 3 This is a statistical analysis of the insecticidal mortality rate of dsRNA in this invention. Detailed Implementation

[0026] To enable those skilled in the art to better understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0027] A lethal gene fragment Spt16 of flea beetle, the sequence of which is shown in SEQ ID NO.1, also includes the complementary sequence of SEQ ID NO.1, a fragment of at least 19 consecutive nucleotides of SEQ ID NO.1, and the complementary sequence of the fragment of at least 19 consecutive nucleotides of SEQ ID NO.1.

[0028] A method for cloning the lethal gene Spt16 of the flea beetle: (1) Total RNA of the flea beetle was extracted using the Trizol method, and the first strand of cDNA was synthesized; (2) Using the first strand of cDNA as a template, primer pairs P1 (SEQ ID NO.2) and P2 (SEQ ID NO.3) were designed, and the full length of Spt16 was amplified by RT-PCR to obtain PCR products; (3) The PCR products were separated by agarose gel electrophoresis, and the target DNA fragment was recovered from the gel; (4) The target DNA fragment was ligated into a vector and transformed into Escherichia coli to obtain transformants; (5) The transformants were plated on a medium containing ampicillin for culture; (6) Colony PCR was performed to screen for positive recombinants, and the cloned plasmid was obtained and sequenced for identification. The RT-PCR amplification system consisted of: 20 μL of 5×Phusion GC Buffer, 2 μL of 10 mM dNTPs, 3 μL of DMSO, 1 μL of Phusion DNA Polymerase, 2 μL of cDNA template, 64 μL of ddH2O, 4 μL of primer P1, and 4 μL of primer P2. The PCR reaction program was: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 55℃ annealing for 20 s, 72℃ extension for 3 min, for 35 cycles; and 72℃ extension for 10 min.

[0029] A dsRNA of a lethal gene fragment Spt16 from the flea beetle is shown in SEQ ID NO.4.

[0030] The method for synthesizing the dsRNA sequence of the lethal gene fragment Spt16 of the flea beetle includes the following steps: (1) Using a plasmid containing the nucleotide sequence shown in SEQ ID NO.1 as a template, primer pairs SEQ ID NO.5 and SEQ ID NO.6 are designed to amplify the dsRNA gene fragment of the lethal gene Spt16 of the flea beetle. The PCR system is as follows: 5×Phusion GCBuffer 20μL, 10mM dNTPs 2μL, DMSO 3μL, Phusion DNA Polymerase 1μL, Spt16 plasmid 2μL, ddH2O 64μL, primer P3 (SEQ ID NO.5) 4μL, primer P4 (SEQ ID NO.6) 4μL. The PCR reaction program is as follows: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 55℃ annealing for 20s, 72℃ extension for 30s, 35 cycles; 72℃ extension for 10min. (2) PCR product recovery to obtain target DNA; (3) 1 μg of the above target DNA, 4 μL of 5×TranscriptAid React Buffer, 2 μL of ATPTris buffered, 2 μL of CTP Tris buffered, 2 μL of GTP Tris buffered, 2 μL of UTP Tris buffered, 2 μL of TranscriptAid Enzyme Mix, and 2 μL of TranscriptAid Enzyme Mix were incubated at 37℃ for 2 h; (4) 2 μL of 1 U / μL Dnase I was incubated for 15 min to remove the DNA template for synthesizing dsRNA; (5) dsRNA was purified by phenol / chloroform extraction for application.

[0031] A method for bioassay of dsRNA in flea beetle by feeding includes the following steps: (1) preparing sterile water containing 0.5% Tween-20 to dilute the dsRNA; (2) cutting 2cm × 3cm pieces of Chinese cabbage leaves for feeding; (3) dissolving 3μg of dsRNA in 80μL of the above 0.5% Tween-20 sterile water and vortexing to mix; (4) evenly coating 40μL of the above dsRNA solution on both the front and back of the leaves, and air-drying at room temperature to achieve a final dsRNA concentration of approximately 500ng / cm³. 2 ; The control group was coated with 40 μL of sterile water containing 0.5% Tween-20 on both sides of the leaves; (5) The leaves of the control group and the treatment group were placed in a 150 mL conical flask and a suitable amount of wet paper towels were placed in the conical flask for moisturizing; (6) The yellow striped flea beetle was stunned with CO2 and 10-15 insects were placed in the conical flask; (7) The conical flask with feed and insects was placed back in the insect rearing room. The temperature of the insect rearing room was 26℃ and the humidity was 75%. The feed containing dsRNA was changed every 24 hours.

[0032] The application of the dsRNA of the lethal gene fragment Spt16 of the yellow-striped flea beetle described above in the prevention and control of the yellow-striped flea beetle.

[0033] The experimental materials and instruments used in the following examples are all commercial products. The adult yellow striped flea beetles in the examples were collected from a farm in Fuxi Street, Deqing County, Zhejiang Province. They were placed in an insect rearing room (temperature 26℃, relative humidity 75%, light intensity 60% Lx, cycle L:D=14:10) and fed with fresh tender leaves of hairy cabbage.

[0034] Example 1: Cloning of the lethal gene Spt16 from the yellow-striped flea beetle

[0035] Extraction of total RNA and first-strand cDNA synthesis from flea beetles

[0036] Take 10-20 adult flea beetles, wash them thoroughly with 1×PBS, and extract total RNA using the Trizol method. III. First-Strand Synthesis System kit: Reverse transcription of total RNA from flea beetles yields the first strand of cDNA.

[0037] Acquisition of the Spt16 gene in yellow stripe jumping

[0038] The ORF sequence of the Spt16 gene fragment was obtained from the transcriptome of *Acer flavomarginata*. Primer pairs were designed using Primer 5.0 software: upstream primer P1 (SEQ ID NO.2): CGACTTCTTGTAATGGTGGT; downstream primer P2 (SEQ ID NO.3): GAGTAACAGTAACAACGCAT.

[0039] Using cDNA obtained from reverse transcription as a template, RT-PCR amplification was performed. The PCR reaction program was as follows: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 55℃ annealing for 20 s, 72℃ extension for 3 min, 35 cycles; 72℃ extension for 10 min. The PCR reaction system consisted of: 20 μL of 5×Phusion GC Buffer, 2 μL of 10 mM dNTPs, 3 μL of DMSO, 1 μL of Phusion DNA Polymerase, 2 μL of cDNA template, 64 μL of ddH2O, 4 μL of primer P1 (SEQ ID NO.2), 4 μL of primer P2 (SEQ ID NO.3), for a total of 100 μL.

[0040] Agarose gel electrophoresis separates PCR products, such as Figure 1 As shown, the target DNA was recovered using gel.

[0041] The recovered target DNA fragment is inserted into the DNA polymerase. The bacteria were transformed into E. coli T1 in the Blunt Zero vector, plated onto ampicillin-containing LB solid medium, and incubated overnight at 37°C.

[0042] Select white single colonies, perform colony PCR using primers P1 (SEQ ID NO.2) and P2 (SEQ ID NO.3), screen for positive recombinants, pick single colonies identified as positive recombinants by colony PCR, and culture them in ampicillin LB medium to extract plasmids;

[0043] The plasmid was sequenced using a fully automated sequencer to obtain the Spt16 gene fragment shown in SEQ ID NO.1.

[0044] Example 3: Synthesis and purification of the lethal gene Spt16 dsRNA from the flea beetle.

[0045] Based on the Spt16 gene fragment shown in SEQ ID NO.1, primers P3 (SEQ ID NO.5) and P4 (SEQ ID NO.6) were designed and synthesized. The sequence of P3 is as follows: TAATACGACTCACTATAGG GAG

[0046] ACCATACAAGAGGAGTTGCTGAAGAA, (underlined part is T7 sequence); P4 sequence is: TAATACGAC TCACTATAGG GAGATTCTCTTCTGTGCTGTGTTCT (The underlined part is the T7 sequence).

[0047] Using the lethal gene fragment Spt16 (sequence shown in SEQ ID NO.1) plasmid as a template, the dsRNA sequence fragment of Spt16 was amplified using primers P3 and P4. The PCR reaction system was as follows: 20 μL of 5×Phusion GC Buffer, 2 μL of 10 mM dNTPs, 3 μL of DMSO, 1 μL of Phusion DNA Polymerase, 2 μL of Spt16 plasmid, 64 μL of ddH2O, 4 μL of primer P4 (SEQ ID NO.5), and 4 μL of primer P3 (SEQ ID NO.6), for a total of 100 μL. The PCR reaction program was as follows: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 55℃ annealing for 20 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min.

[0048] The PCR product was recovered to obtain the target DNA.

[0049] The target DNA (1 μg), 5×TranscriptAid React Buffer (4 μL), ATP Tris buffer (2 μL), CTP Tris buffer (2 μL), GTP Tris buffer (2 μL), UTP Tris buffer (2 μL), and TranscriptAid Enzyme Mix (2 μL) were incubated at 37°C for 2 h. Then, 1 U / μL Dnase I was added and incubated for 15 min to remove the DNA template for dsRNA synthesis. The dsRNA was purified using phenol / chloroform extraction for insecticidal experiments. The purified dsRNA was as follows: Figure 2 As shown.

[0050] Example 4: Insecticidal experiment using the lethal gene Spt16 of the yellow-striped flea beetle (dsRNA).

[0051] Prepare sterile water containing 0.5% Tween-20 to dilute dsRNA. Add 50 μL of Tween-20 to 10 mL of sterile water and vortex to mix. Cut a 2 cm x 3 cm piece of cardboard. Using the cardboard as a template, cut out cabbage leaves of the same size as the cardboard, with a cabbage leaf area of ​​approximately 6 cm². 2 For feeding flea beetles; dissolve 3 μg of dsRNA in 80 μL of the above 0.5% Tween-20 sterile water and vortex to mix; evenly coat the upper surface of the leaf with 40 μL of the above dsRNA solution, air dry at room temperature, and then evenly coat the lower surface of the leaf with 40 μL of the above dsRNA solution and air dry, so that the final concentration of dsRNA is approximately 500 ng / cm³. 2 The control group consisted of 40 μL of sterile water containing 0.5% Tween-20 applied to both sides of the leaf; the control group consisted of leaves coated with 500 ng / cm³ of sterile water. 2 Leaves containing dsRNA were placed in 150mL Erlenmeyer flasks, with a suitable amount of damp paper towels placed inside for moisture retention. The flea beetles were stunned with CO2, and 8-12 beetles were placed in each flask. The flasks containing feed and beetles were then returned to the rearing room, which was maintained at 26℃ and 75% humidity. The feed containing dsRNA was changed every 24 hours. Flea beetles fed with 0.5% Tween-20 sterile water and Spt16-dsRNA-treated Chinese cabbage were observed. On days 4-5, neither the control nor the treatment groups showed significant effects on the flea beetles. From day 6 onwards, flea beetles began to die. By day 15, the Spt16-dsRNA treatment was significantly effective, with a significantly higher mortality rate than the control group. Figure 3 As shown.

[0052] The above description is only a specific embodiment of the present invention and not all embodiments. Any equivalent modifications made by those skilled in the art to the technical solutions of the present invention by reading the present invention specification shall be covered by the claims of the present invention.

[0053] The above specific embodiments are used to explain and illustrate the present invention, but not to limit the present invention. Any modifications and changes made to the present invention within the spirit and scope of the claims shall fall within the protection scope of the present invention.

Claims

1. A dsRNA synthesized from the lethal gene fragment Spt16 of the flea beetle, characterized in that: The sequence of the lethal gene fragment Spt16 of the flea beetle is shown in SEQ ID NO.1, and its dsRNA sequence is shown in SEQ ID NO.

4.

2. A method for preparing dsRNA as described in claim 1, characterized in that, The procedure includes the following steps: Based on the validated Spt16 gene fragment sequence, primer P3 with the sequence SEQ ID NO.5 and primer P4 with the sequence SEQ ID NO.6 were designed and synthesized. Using a plasmid containing the lethal gene fragment Spt16 of flea beetle as a template, PCR amplification was performed to obtain the amplification product. The amplification product was separated by agarose gel electrophoresis to obtain the target DNA fragment. dsRNA was synthesized using the T7 High Yield RNATranscription Kit.

3. The application of the dsRNA as described in claim 1 in killing flea beetles.

Images