Grain development regulatory gene m249, its encoded protein, in del1 marker, expression vector and application thereof in grain trait improvement

Abstract

The application discloses a kernel development regulation gene m249 , an encoded protein, an InDel1 marker, an expression vector and application of the kernel development regulation gene in kernel trait improvement. Based on map-based cloning, a candidate gene of a natural mutant controlling corn kernel development is located, and the gene is confirmed by an allelism test. m249 m249 The mutation of the gene can affect corn kernel size, total starch content and amylose content, and the gene can be used for cultivating new varieties with different kernel sizes, total starch contents and amylose contents. By using the gene and the molecular marker disclosed in the application, high-yield breeding materials of corn, rice, wheat and other crops can be conveniently prepared, the breeding period of new crop varieties is shortened, the breeding cost is reduced, and the breeding efficiency is improved.​

Description

Technical Field

[0001] This application relates to the field of bioengineering technology, specifically to genes regulating grain development. m249 The encoded protein, InDel1 marker, expression vector and its application in grain trait improvement. Background Technology

[0002] Maize (Zea mays L.) originated near Mexico, evolving from the domestication of the primitive fodder grass, dating back over 9,000 years. As one of the world's most important food crops, maize has been cultivated in my country for over 400 years, with major production areas concentrated in Northeast, North, and Central China. Maize is also an important feed crop. With the rapid development of animal husbandry and deep processing industries, domestic demand for maize continues to increase, and imports are showing a year-on-year growth trend. Given the limited arable land, striving to improve maize yield and quality is a crucial task in ensuring my country's food security.

[0003] As the primary organ for maize yield, elucidating the molecular mechanisms of grain development and filling can provide theoretical support and key genes and germplasm resources for improving maize yield. Using grain mutants and forward genetics to elucidate the genetic mechanisms of maize grain development and filling is the most effective approach. Although a large number of genes regulating maize grain development and filling have been cloned, the precise regulation of grain filling and the molecular mechanisms involved in grain filling remain to be further explored and elucidated due to the extremely complex biological processes involved.

[0004] The information disclosed in this background section is intended only to enhance the understanding of the background technology of this disclosure and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0005] The inventors discovered natural mutants related to maize kernel development during the selection of maize inbred lines in the field. m249 Map-based cloning methods were used to locate the control of natural mutants. m249 The gene with the mutant phenotype was identified and confirmed using allelic testing; this gene has a significant impact on traits such as grain size, grain weight, total starch, and amylose content.

[0006] The first aspect disclosed in this application relates to a gene regulating grain development. m249 It contains nucleotide sequences selected from the following group of nucleotide sequences: (1) A DNA molecule as shown in SEQ ID NO.2; (2) cDNA molecules as shown in SEQ ID NO.4; (3) DNA molecules that can affect grain-related traits, formed by substitution of one or more bases and / or insertion and / or deletion of one or more bases and insertion / deletion of large nucleotide sequences, based on SEQ ID NO.2 or SEQ ID NO.4; (4) A nucleotide sequence that has more than 80% homology with the nucleotide sequence of SEQ ID NO.2 or SEQ ID NO.4 and affects the grain-related traits.

[0007] The second aspect disclosed in this application relates to a gene regulating grain development. m249 The encoded protein has an amino acid sequence of at least one of the following: (1) As shown in SEQ ID NO.6; (2) Proteins derived from SEQ ID NO.6 by substitution, deletion and / or addition of one or more amino acid residues and having a phenotype that affects grain-related traits; (3) An amino acid sequence that has more than 70% homology with the amino acid sequence shown in SEQ ID NO.6 and has an amino acid sequence that affects the phenotypic trait of grain.

[0008] The third aspect disclosed in this application relates to a gene containing the aforementioned grain development regulatory gene. m249 Recombinant expression vectors, kits, transgenic cell lines or recombinant bacteria.

[0009] The fourth aspect of this invention relates to a seed development regulatory gene. m249 InDel1 marker, based on genes zm00001d037190 An AC base is inserted at a position 767 bp downstream of its start codon to replace the 112 bp that are continuously deleted from that position onwards.

[0010] The fifth aspect disclosed in this application also relates to the following applications: The InDel1 marker is used in the identification of mutants. m249 Applications in [the context of the text].

[0011] Gene zm00001d037190 Application of Genomic DNA (as shown in SEQ ID NO.1, cDNA as shown in SEQ ID NO.3) in the improvement of grain size traits.

[0012] The grain development regulatory gene m249 Or the application of the InDel1 marker in the regulation of grain size traits or in the breeding of grain size varieties / lines.

[0013] The grain development regulatory genem249 Or the application of the InDel1 marker in the regulation of total starch and / or amylose content in grains, or in varieties / lines with varying total starch and / or amylose content. For example, by, but not limited to, overexpression and / or knockout of the grain development regulatory genes. m249 To cultivate varieties with different seed sizes, total starch and / or amylose content.

[0014] The grain development regulatory gene m249 Or the application of the InDel1 marker in the regulation of plant respiratory pathway traits.

[0015] One or more technical solutions provided in the embodiments of this application have at least the following technical effects or advantages: 1. Map-based cloning has identified the controlling natural mutant. m249 The gene with the mutated phenotype was identified, and the gene was confirmed using allelic testing.

[0016] 2. Genes m249 Overexpression and knockout of [a substance] can affect the total starch content and amylose content of corn kernels, and can be used to breed new varieties with different total starch content and amylose content in kernels.

[0017] 3. The genes and molecular markers disclosed in this application can be used to facilitate the creation of high-yield breeding materials for crops such as corn, rice, and wheat, shorten the breeding cycle of new crop varieties, reduce breeding costs, and improve breeding efficiency. Attached Figure Description

[0018] Figure 1 For a comparison of grain phenotypes between wild-type and mutant in one embodiment of this application; A: Separated ears of Zheng 58×m249 F2, scale bar 1 cm; B: Wild-type and mutant m249 Ten days after pollination, the fruit ears are marked with blue arrows, indicating mutants. m249 Grains, scale bar 1 cm; C: wild type and mutant m249 Comparison of kernel length in mature ears, scale bar: 1 cm; D: wild type and mutant m249 Comparison of kernel width of ear 10 days after pollination, scale bar 1 cm; E: wild type and mutant m249 Mature ear kernels - comparison, scale bar 1 cm; F: wild type and mutant m249 Comparison of germination rates of mature ears of grain, scale bar: 1 cm; G: wild type and mutant m249 A comparison of germination rates five days after seed soaking and germination, scale bar: 1 cm; H: wild type and mutant. m249 Comparison of germination rates of mature ears of grain; I: Wild type and mutant m249 Comparison of 100-grain weight; J: Wild type and mutantm249 Longitudinal section observation of mature kernels; K: wild type and mutant m249 Cross-section observation of mature kernels; L: wild type and mutant m249 Observation of translucency of mature kernels; M: wild type and mutant m249 Analysis of total starch content in mature kernels; N: wild type and mutant m249 Analysis of amylose content in mature seeds.

[0019] Figure 2 Gene in one embodiment of this application m249 Fine-grained localization; using Zheng 58 and mutants m249 The constructed F2 population has genetic significance. m249 Perform precise positioning; m249 It was located in a region of approximately 450 kb on chromosome 6; the left and right sides of the diagonal line below each marker represent the number of recombinant individuals and the population, respectively.

[0020] Figure 3 This is a sequence analysis of candidate gene mutation sites in one embodiment of this application; WT represents the homozygous wild-type sequencing result; aa represents... m249 Mutant sequencing results.

[0021] Figure 4 This is an agarose gel image of specific mutation sites in 230 maize inbred lines, as shown in one embodiment of this application.

[0022] Figure 5 As shown in one embodiment of this application m249-mu A schematic diagram of allelic mutant mutation sites; the triangle indicates the insertion position of the mutator.

[0023] Figure 6 As shown in one embodiment of this application m249 Allelic testing of candidate genes; A: Heterozygous m249-1 with heterozygous mutants m249-mu Equipotential test, scale 1 cm; B: heterozygous m249-mu with heterozygous mutants m249-1 Equipotential measurement, with a scale of 1 cm.

[0024] Figure 7 As shown in one embodiment of this application m249 Candidate gene structure diagram; A: Gene structure, indicated in red. m249 Candidate gene mutation sites, with black and gray boxes representing exons and UTR regions, respectively; B: Schematic diagram of the m249 protein structure.

[0025] Figure 8 As shown in one embodiment of this application m249 Alignment of the amino acid sequences of the seven PPR motifs of the normal protein encoded by the gene.

[0026] Figure 9 As shown in one embodiment of this application m249 Spatiotemporal expression analysis of genes.

[0027] Figure 10 As shown in one embodiment of this application m249 Subcellular localization corresponding to the encoding of normal proteins.

[0028] Figure 11 Transcript abundance analysis of 35 mitochondrial genes in one embodiment of this application.

[0029] Figure 12 Mitochondria in a mutant in one embodiment of this application nad5 Transcript intron amplification; A. Schematic diagram of the structure of the maize mitochondrial nad5 transcript and corresponding primer positions. Black filled boxes represent exons, and lines represent introns; B. Mitochondria of mutants. nad4 The splicing efficiency of introns 1 and 3 in transcripts decreased.

[0030] Figure 13 As shown in one embodiment of this application m249 Analysis of the shearing efficiency of 22 class II introns in mitochondria.

[0031] Figure 14 As shown in one embodiment of this application m249 It does not affect the cleavage of mitochondrial introns other than NAD5; for the detection gel image of each intron, the two lanes are, in order: wild type, m249 .

[0032] Figure 15 For the analysis of mitochondrial complex abundance and complex I activity in one embodiment of this application; (A) BN-PAGE analysis of mitochondrial complex. Non-denaturing polyacrylamide gels were stained with Coomassie brilliant blue, and mitochondrial complexes of wild-type and mutant seeds 18 days after pollination were separated by 5%–13.5% BN-PAGE; (B) Analysis of mitochondrial NADH dehydrogenase activity.

[0033] Figure 16 For the analysis of Aoxs gene expression level in one embodiment of this application; qRT-PCR analysis of the expression levels of alternative respiratory pathway-related genes (including Aox1, Aox2, and Aox3) in wild-type and mutant seeds 15 days after pollination. ZmActin The (GRMZM2G126010) gene is an internal reference, and the value represents the average of three biological and technical replicates. Detailed Implementation

[0034] Unless otherwise specified, all instruments and equipment used in the following examples are conventional instruments and equipment; all reagents and materials used are commercially available conventional products; and all experimental and detection methods used (such as genomic DNA extraction, RNA extraction and reverse transcription, RT-PCR, real-time quantitative PCR, grain mitochondrial protein extraction, protoplast subcellular localization, BN-PAGE gel electrophoresis, Western blot, corn kernel paraffin sections, etc.) are conventional methods unless otherwise specified.

[0035] The natural mutants used in the following examples m249 The core inbred line Zheng 58 was provided by the Maize Genetics Research Group of Henan Agricultural University (collector: Tang Jihua; collection time: January 2018; location: Ledong County, Hainan Province) for the construction of the F2 segregating population and gene localization. High-generation homozygous wild-type and mutants obtained through multiple generations of continuous self-pollination were used for functional experiments.

[0036] Corn rotator insertion material m249-mu The materials were purchased from the ChinaMu maize mutant library (http: / / chinamu.jaas.ac.cn / ) as allelic testing materials.

[0037] Example 1 Mutant m249 Acquisition and phenotypic expression mutant m249 It is a material that underwent a natural mutation during the selection of maize inbred lines. The mature ears exhibit two distinct kernel phenotypes, showing a clear distinction between large and small kernels. Figure 1 -A is shown). Analysis of normal and mutant kernels on F2 segregating ears 10 days after self-pollination revealed that the mutant kernels ( Figure 1 The mutant seeds (indicated by arrow B) are significantly smaller and lighter in color than the wild type, and fill more slowly. Phenotypic analysis of mature seeds revealed that the mutant seeds were significantly shorter, wider, and thicker than the wild type. Figure 1 (As shown in -C, 1-D, 1-E), the germination rates decreased by 26%, 40%, and 56%, respectively. Simultaneously, analysis of the grain germination rate revealed that the mutant... m249 Only a small number of seeds germinated radicles on the 5th day after soaking, while wild-type seeds all germinated radicles and sprouted normally. Figure 1 -F (as shown), on the 13th day after germination, the mutant m249 The plant height was significantly lower than that of the wild type, and development stopped at the two-leaf stage until death. Figure 1 -G (as shown). Further statistical analysis of budding rate showed that the mutant m249 The germination rate was significantly lower than that of wild-type seeds. Figure 1 -H is shown). Statistical analysis of 100-grain weight shows ( Figure 1As shown in Figure -I), compared with wild-type grains, the grain weight of mutant grains was significantly reduced (Student's t-test, P<0.05). Analysis of cross-sections, longitudinal sections, and translucency of the grains showed that the proportion of hard endosperm was significantly reduced, the proportion of floury endosperm was significantly increased, and the translucency was significantly reduced in mutant grains. Figure 1 JL); Further analysis of starch and amylose content revealed a significant increase in total starch and amylose content in the mutant grains. Figure 1 MN).

[0038] To clone the gene that causes this mutant phenotype, a mutant was constructed. m249 The F2 generation segregating population of the cross between Zheng 58 and Zheng 58 was analyzed. Four segregating ears were randomly selected for segregation ratio analysis. The results showed that the segregation ratio of the mutant was 3:1, indicating that the mutant... m249 The mutant phenotype is controlled by a recessive single gene.

[0039] In summary, during the developmental process of grain development, mutants... m249 The grain development of this variety is lagging behind that of the wild type, and the embryo development is abnormal, resulting in reduced grain size and increased total starch and amylose content.

[0040] Example 2 m249 Gene cloning and functional verification 1. m249 Map cloning Map-based cloning was used to locate the target gene. Two parental lines, Zheng 58 and a mutant, were extracted. m249 Genomic DNA was collected, and 15 wild-type kernels and 15 mutant kernels were selected from F2 segregating ears for BSA pooling to construct two extreme phenotypes (dominant pooling and recessive pooling). Linkage marker screening was performed using 300 pairs of indel primers and 1000 pairs of SSR primers from the entire maize genome. Eight pairs of polymorphic markers were identified near bins 6.04-6.05 on chromosome 6. Further development and screening of polymorphic molecular markers, along with expanding the segregating population, and linkage and crossing over analysis, located the target gene between S11110 and S11179 on chromosome 6, with a physical distance of approximately 5.1M.

[0041] Further utilizing 3072 F2 segregating populations, endosperm DNA was rapidly extracted using the alkaline boiling method for screening of exchangeable single plants, ultimately yielding 45 exchangeable single plants. Simultaneously, referencing reference sequences from various maize inbred lines on the maizeGDB website, caps-1 and indel-11 markers were designed to narrow down the localization region; ultimately, the target gene was located between markers caps-1 and indel-11, with a physical distance of approximately 450 kb between them. Figure 2 (As shown).

[0042] 2. Identify the target gene and perform allele testing. Sequence analysis from the website Maize Sequence (http: / / ensembl.gramene.org) identified 11 candidate genes within this localization region. Sequencing analysis of these 11 candidate genes revealed that the mutant... zm00001d037190 The gene (maizegdb database V4 version) has two AC bases inserted 767bp downstream of the start codon ATG in its coding region, while simultaneously deleting 112bp (e.g. Figure 3 As shown), a frameshift mutation occurs, prematurely terminating protein translation. The remaining 10 genes show no sequence differences. Subsequently, specific primers were designed based on the mutation site, and the molecular marker InDel1 (marker sequence, F: CACATCCCAGCAAGCCAA, R: GACCCTCGGAACAAGTACCT) was developed. Without this sequence mutation, the WT electrophoresis result showed a 761 bp target band; with the sequence mutation, the target band was... m249 The electrophoresis result showed a 650bp target band. Sequencing analysis of 200 maize natural populations revealed that the mutation at this site was not present in the natural maize populations, indicating that this mutation site is located in... m249 The middle is specific ( Figure 4 As shown), this marker can be used to identify items containing... m249 Alleles of this mutation type were screened. This gene was identified as a candidate gene.

[0043] To further confirm Zm00001d037190 yes m249 Candidate genes were selected, and allelic hybridization experiments were conducted. First, [genes] were purchased from the ChinaMu maize mutant library (http: / / chinamu.jaas.ac.cn / ). zm0000d0137190 The mu transposon insertion mutant material of the gene is named m249-mu (Gene structure such as) Figure 5 (As shown). Using the original heterozygous mutant m249-1 Heterozygous mutant with mu transposon insertion m249-mu Reciprocal crosses were performed, and the test results showed that the hybrid offspring exhibited segregation in grain size phenotype. Figure 6 As shown in Table 1), the separation ratio conforms to 3:1. In summary, the isotropic test proves... Zm00001d037190 yes m249 The candidate gene, whose mutation leads to a phenotype of smaller grains.

[0044] Table 1. Allelic tests of heterozygous m249-1 and heterozygous m249-mu plants .

[0045] Example 3 m249 Protein structure and expression patterns of genes Using the TRP pred website (http: / / tprpred.tuebingen.mpg.de / tprpred) zm00001d037190 Gene sequence prediction revealed that the gene contains only one exon, with a coding sequence length of 1491 bp (SEQ ID NO.1), encoding a protein containing 496 amino acids (SEQ ID NO.5), consistent with the T1 transcript annotated in the Maize GDB reference gene Zm-B73-REFERENCE-GRAMENE-4.0 (https: / / www.maizegdb.org / gene_center / gene / Zm00001d037190). Functional annotation showed that this gene encodes a P-type PPR protein containing 7 PPR domains, and the sequences of these 7 domains are highly conserved to a certain extent. Figure 8 As shown). In the mutant, the frameshift mutation resulted in the deletion of the last 6 (2-7) PPR domains of the PPR protein (as shown). Figure 7 (As shown).

[0046] Based on the amino acid sequence of the wild type (SEQ ID NO.5), phylogenetic analysis was conducted in several major species, including rice, maize, sorghum, wheat, Arabidopsis thaliana, and soybean. The results showed that the gene has homologous sequences in multiple species, with the highest homology found in the genes of sorghum and rice. The homology of the sorghum gene was 92%, and that of the rice gene was 76%. This indicates that the gene is relatively conserved in terms of function in grasses.

[0047] In order to further m249 The spatiotemporal expression pattern of the gene was analyzed. RNA was extracted from roots, stems, leaves, filaments, bracts, female ears, and grains at 9, 12, and 15 days post-pollination, and analyzed by quantitative real-time PCR. The results showed that the gene was expressed in all tissues, indicating it is a constitutively expressed gene, with higher expression levels in grains at 12 and 15 days post-pollination (e.g., [missing data]). Figure 9 (As shown).

[0048] Example 4: Localization of m249 protein To m249The subcellular location of the gene-encoded protein was analyzed, and the coding region sequence (SEQ ID NO.3) without a stop codon was amplified and ligated into a PRTL expression vector to construct a GFP fusion protein expression vector. This vector was then transformed into maize protoplasts for transient expression experiments. Laser confocal microscopy revealed that the green fluorescence signal of the GFP fusion protein overlapped with the red fluorescence signal of the mitochondrial fluorescent probe, confirming that the protein is located in the mitochondria (e.g., mitochondria). Figure 10 (As shown in the image). The results above indicate that m249 is located in mitochondria.

[0049] Example 5 m249 Analysis of nad4 transcript expression in mutants PPR proteins are a class of RNA-binding proteins that are mainly involved in RNA editing and splicing processes. m249 Encoding a P-type PPR protein, located in mitochondria, it may be involved in the splicing of mitochondrial gene transcripts. Wild-type and mutant seeds were collected 13 days after pollination, and 35 genes encoding proteins in the mitochondria were analyzed. The results showed that, compared with the wild type, m249 In mutants nad5 The mature transcript of the gene is significantly longer than the wild-type transcript, and its intron splicing may be affected (e.g. Figure 11 (As shown).

[0050] nad5 Encoding the fifth subunit of mitochondrial complex I, it contains two cis introns (intron 1 and intron 4) and two trans introns (intron 2 and intron 3), for further investigation... nad5 The reasons for differences in transcripts. Utilizing... nad5 RT-PCR analysis was performed using specific primers on adjacent exons of the four introns in the transcript to detect intron splicing efficiency. Figure 12 The results showed that m249 In mutants nad5 The splicing efficiency of the first intron of the transcript decreases, and the splicing of the fourth intron is retained and inhibited.

[0051] To further verify m249 To investigate whether the splicing of introns in other mitochondrial protein-coding genes was affected, the splicing efficiency of 22 group II introns in mitochondria was further analyzed using qRT-PCR. The results showed that, in addition to... nad5 Apart from intron 1 and intron 4 splicing being affected, the intron splicing efficiency of other mitochondrial genes did not change significantly. Figure 13 ).In summary, m249 Acting on nad5Shearing of intron 1 and intron 4.

[0052] The results were further confirmed using RT-PCR. Analysis revealed that, compared to the wild type, m249 middle nad5 The abundance of the target bands was significantly reduced after normal splicing of the first and fourth introns of the transcript. Therefore, this ultimately indicates that... m249 The full length of the mutant nad5 The significantly reduced abundance of transcripts compared to wild type is due to nad5 This is caused by the decrease in shearing efficiency of introns 1 and 4 (as shown in Figure 14).

[0053] Example 6 m249 Changes in respiratory chain complexes in mutants mitochondria nad5 The gene encodes one of the subunits of mitochondrial complex I. Because... m249 In mutants nad5 The splicing of the first and fourth introns of the transcript was affected. nad5 The reduction in normal transcripts may therefore affect mitochondrial respiratory chain complex I. The abundance and activity of mitochondrial complexes in wild-type and mutants 13 days post-pollution were detected by BN-PAGE. The results showed that, compared to wild-type, m249 Mutant Complex I and Supercomplex I+III 2 The significantly decreased abundance indicates that the assembly of mitochondrial complex I is affected. Meanwhile, a significant increase in the abundance of complex III was observed (e.g., Figure 15 As shown in the figure, based on the research results reported in the literature, this may be due to the supercomplex I+III. 2 Feedback regulation resulting from decreased abundance (Xiu et al., 2016).

[0054] Furthermore, the activity of mitochondrial complexes was tested, and it was found that compared with the wild type, m249 Complex I and supercomplex I+III associated with NADH dehydrogenase in the mutant 2 The activity of [the substance] increased significantly (e.g. Figure 15 (As shown). The above experimental results indicate that abnormal RNA splicing occurs in the genes encoding the mitochondrial complex subunits, thereby affecting the assembly and activity of the mitochondrial complex. Western blot analysis revealed abnormalities in complex I. nad7 Decreased expression in the mutant indicates a defect in complex I. Meanwhile, Cytc antibody assays show an increased content of complex III in the mutant.

[0055] Example 7 m249Changes in the expression levels of genes related to the alternating oxidative respiratory pathway in mutants In addition to the mitochondrial respiratory pathway, plants also possess an alternative respiratory pathway called alternating oxidative respiration. When complex I of the cytochrome pathway in the respiratory chain is blocked, genes of the alternating respiratory pathway, such as alternating oxidases (Aoxs) genes, increase their expression levels (Toda et al., 2012). The maize genome contains three alternating oxidase (Aoxs) genes from the alternating oxidative respiration pathway. qRT-PCR analysis of the expression levels of these three genes revealed that the expression levels of AOX2 and AOX3 genes in the mutant were significantly increased compared to the wild type (e.g., AOX2 and AOX3). Figure 16 (As shown). The above results indicate that when m249 The mutant's respiratory pathway is blocked, which activates the expression of genes in the alternating oxidative respiratory pathway to maintain its normal respiratory function.

[0056] This application cloned [the image] using a bitwise cloning method. m249 The candidate gene encodes a P-type PPR protein. The mutant has an insertion of two AC bases 767 bp downstream of the start codon ATG, along with a deletion of 112 bp, resulting in a frameshift mutation. Subcellular localization experiments showed that the encoded protein is located in mitochondria. Analysis of the expression of mature transcripts of the mitochondrial protein-encoding gene in wild-type and mutant individuals revealed that the mitochondrial gene... nad5 The cleavage of introns 1 and 4 of the transcript was affected, thereby disrupting the activity of mitochondrial complex I. Simultaneously, the mitochondrial respiratory pathway was impaired, activating the alternating oxidative respiratory pathway.

[0057] Although some preferred embodiments of this invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.

[0058] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from the spirit and scope of the invention. Therefore, if these modifications and variations fall within the scope of the claims and their equivalents, this invention is also intended to include these modifications and variations.

Claims

1. A gene regulating grain development m249 Its nucleotide sequence is shown in SEQ ID NO.

2.

2. A gene containing the grain development regulatory gene of claim 1 m249 Recombinant expression vectors, kits, transgenic cell lines or recombinant bacteria.

Images