A method for high production of exosome-mediated lycopene secretion and high production

By knocking out a specific gene in E. coli and introducing an MVA pathway plasmid, a defective strain Δlpp-ΔnlpI-ΔmlaE-ΔtolA was constructed, which solved the problem of difficult lycopene secretion and achieved efficient lycopene production. The yield in shake flasks increased by 36.16 times, and the yield in fermenters reached 575 mg/L.

CN116515877BActive Publication Date: 2026-08-04JIANGNAN UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGNAN UNIV
Filing Date
2022-10-31
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

Lycopene's hydrophobic nature makes it difficult to be secreted, leading to its accumulation in cells and affecting productivity.

Method used

By knocking out the lpp, nlpI, mlaE, and tolA genes in Escherichia coli BL21(DE3), a defective strain Δlpp-ΔnlpI-ΔmlaE-ΔtolA was constructed, and an exogenous MVA pathway plasmid was introduced to enhance the production of outer membrane vesicles (OMVs) and mediate the secretion and transport of lycopene.

Benefits of technology

It significantly improved the production efficiency of lycopene, increasing the yield in shake flasks to 137.4 mg/L and the extracellular yield in a 4L fermenter to 575 mg/L, which is 36.16 times higher than that of the initial strain.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116515877B_ABST
    Figure CN116515877B_ABST
Patent Text Reader

Abstract

The application discloses a method for high-yield lycopene secretion and high yield, which comprises the following steps: improving the production of outer membrane vesicles by means of Escherichia coli defective bacteria Delta lpp-Delta nlpI-Delta mlaE-Delta tolA, mediating the secretion and export of lycopene, and realizing high yield of lycopene; the Escherichia coli defective bacteria Delta lpp-Delta nlpI-Delta mlaE-Delta tolA is obtained by knocking out the genes lpp, nlpI, mlaE and tolA from the wild bacteria BL21 (DE3) in sequence. The Escherichia coli defective bacteria Delta lpp-Delta nlpI-Delta mlaE-Delta tolA provided by the application has 6.1 times more OMVs than the wild bacteria.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of lycopene production, specifically involving a method for high-yield lycopene secretion mediated by outer membrane vesicles. Background Technology

[0002] Lycopene is an acyclic tetraterpenoid (C40) compound, a long lipophilic compound that gives plants such as tomatoes, guavas, and watermelons their distinctive red color (Grabowska et al., 2019). The trans and cis conformations of lycopene may be related to its high oxidative activity. Therefore, lycopene is used in the health sector as an anti-aging, anti-inflammatory, and antioxidant agent, and it is widely used to treat inflammation associated with various cancers and diabetes (Qi et al., 2021; Saini et al., 2020). Lycopene is also used in the functional food and cosmetic industries (Li et al., 2020).

[0003] Like many terpenoids, lycopene is synthesized by a suitable microbial host (Fordjour et al., 2022; Li et al., 2020). The isoprene-like universal precursor IPP / DMAAPP is a major component of lycopene biosynthesis. In this process, IPP / DMAAPP is condensed to farnesyl pyrophosphate synthase to farnesyl pyrophosphate (FPP), which is then converted to geraniol geraniol pyrophosphate (GGPP), phytoene, and red lycopene by geraniol geraniol synthase and phytoene synthase / desaturase (Li et al., 2020).

[0004] Therefore, improved precursor supply is needed to promote IPP / DMAPP accumulation. Both *Escherichia coli* and *Corynebacterium glutamicum* possess the MEP pathway for terpene synthesis; however, unlike *E. coli*, *Corynebacterium glutamicum* is a carotenoid-producing bacterium whose entire gene cluster is capable of producing decaisoxanthin (Krubasik et al., 2001; Krubasik & Sandman, 2000). The introduction of crtEBI pathway genes and exogenous MVA pathways has led to a significant improvement in lycopene production in *E. coli* (Li et al., 2020).

[0005] Lycopene, a type of carotenoid, is hydrophobic and not easily secreted, leading to its accumulation in cells. This can hinder normal cellular processes, thus affecting productivity. Summary of the Invention

[0006] The purpose of this section is to outline some aspects of embodiments of the present invention and to briefly describe some preferred embodiments. Simplifications or omissions may be made in this section, as well as in the abstract and title of this application, to avoid obscuring the purpose of these documents; however, such simplifications or omissions should not be construed as limiting the scope of the invention.

[0007] In view of the problems existing in the above and / or prior art, the present invention is proposed.

[0008] Therefore, the purpose of this invention is to overcome the shortcomings of the prior art and provide a method for high-yield outer membrane vesicle-mediated production of lycopene.

[0009] To solve the above-mentioned technical problems, the present invention provides the following technical solution: a method for high-yield outer membrane vesicle-mediated lycopene secretion and high production, comprising,

[0010] By using the E. coli defective bacteria Δlpp-ΔnlpI-ΔmlaE-ΔtolA to enhance the production of outer membrane vesicles, lycopene secretion and transport can be mediated to achieve high lycopene production.

[0011] The Escherichia coli defect strain Δlpp-ΔnlpI-ΔmlaE-ΔtolA was obtained by sequentially knocking out the genes lpp, nlpI, mlaE, and tolA from the wild-type BL21(DE3) gene.

[0012] The sequence of the knocked-out gene lpp is shown in SEQ ID NO: 1;

[0013] The sequence of the knocked-out gene nlpI is shown in SEQ ID NO: 2;

[0014] The sequence of the knocked-out gene mlaE is shown in SEQ ID NO: 3;

[0015] The sequence of the knocked-out gene tolA is shown in SEQ ID NO: 4.

[0016] In a preferred embodiment of the method described in this invention, the plasmids used for gene knockout include plasmid pCas9 and plasmid pTarget, wherein...

[0017] The sequence of the plasmid pCas9 is shown in SEQ ID NO: 5;

[0018] The sequence of the plasmid pTarget is shown in SEQ ID NO: 6.

[0019] In a preferred embodiment of the method described in this invention, the method of mediating the secretion and transport of lycopene includes:

[0020] The tomato lycopene-producing plasmid was transferred into the Escherichia coli defect strain Δlpp-ΔnlpI-ΔmlaE-ΔtolA to obtain the lycopene-producing strain;

[0021] Lycopene was produced by fermenting a lycopene-producing strain in a fermentation medium.

[0022] In a preferred embodiment of the method described in this invention, the tomato red plasmids produced include plasmids pACYCDuet-1-mvaE-mvaS-mvK-pmK-mvaD, pETDuet-1-crtE-crtB-crtI-IDI, and pRSFDuet-1-plsB-plsC-mvaE-mvK; wherein...

[0023] The sequence of the plasmid pACYCDuet-1-mvaE-mvaS-mvK-pmK-mvaD is shown in SEQ ID NO: 7;

[0024] The sequence of the plasmid pETDuet-1-crtE-crtB-crtI-IDI is shown in SEQ ID NO: 8;

[0025] The sequence of the plasmid pRSFDuet-1-plsB-plsC-mvaE-mvK is shown in SEQ ID NO: 9.

[0026] As a preferred embodiment of the method described in this invention, the fermentation medium comprises 7 g / L glucose, 15 g / L yeast extract, 2 g / L KH2PO4, 12 g / L K2HPO4, 5 g / L tryptone, 1.1 g / L MgSO4, 7 g / L H2O, 0.5 g / L citric acid, and 4 g / L glycerol.

[0027] In a preferred embodiment of the method described in this invention, the fermentation culture includes,

[0028] Overnight seed cultures were pre-cultured in LB medium at 30°C and 220 rpm.

[0029] At an initial OD600 of 0.1, overnight seed was inoculated into 50 ml of fermentation medium and cultured at 37°C and 220 rpm for 4 hours.

[0030] Add the inducing agent after 4 hours and incubate at 30℃ and 220rpm for 72 hours.

[0031] In a preferred embodiment of the method described in this invention, the inducing agent comprises isopropyl thiogalactoside.

[0032] In a preferred embodiment of the method described in this invention, the amount of isopropyl thiogalactoside added is 0.3–0.5 mM.

[0033] In a preferred embodiment of the method described in this invention, the amount of isopropyl thiogalactoside added is 0.3 mM.

[0034] In a preferred embodiment of the method described in this invention, the incubation time is 72 hours.

[0035] Beneficial effects of this invention:

[0036] (1) Lycopene is a member of carotenoids. Its hydrophobicity makes it difficult to secrete, leading to its accumulation in cells. This may hinder normal cellular processes and thus affect low productivity. This invention provides a method for high-yield outer membrane vesicle-mediated lycopene production. By designing a defective strain Δlpp-ΔnlpI-ΔmlaE-ΔtolA that can improve the production of outer membrane vesicles (OMVs), the provided Escherichia coli defective strain is the defective strain Δlpp-ΔnlpI-ΔmlaE-ΔtolA obtained by knocking out the genes lpp, nlpI, mlaE, and tolA in Escherichia coli BL21(DE3). Compared with the wild strain, the OMVs produced by this defective strain are increased by 6.1 times.

[0037] (2) In this invention, the plasmid expressing the MVA pathway for lycopene production was transferred into Δlpp-ΔnlpI-ΔmlaE-ΔtolA to obtain the highest-producing strain LYC-9, which secreted lycopene at a yield of 137.4 mg / L in a shake flask, which was 36.16 times higher than the initial strain LYC-5 expressing the exogenous MVA pathway. The extracellular lycopene yield of strain LYC-9 in a 4L fermenter reached 575 mg / L. Attached Figure Description

[0038] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein:

[0039] Figure 1 This is a plasmid map of the dual-plasmid CRISPR-Cas9 knockout system in an embodiment of the present invention.

[0040] Figure 2 The image shows the plasmid pET-crtE-crtB-crtI-Idi pattern in an embodiment of the present invention.

[0041] Figure 3The image shows the pACYC-EKKMM plasmid pattern in this embodiment of the invention.

[0042] Figure 4 The image shows the plasmid pRSFDuet-1-plsB-plsC-mvaE-mvK in this embodiment of the invention.

[0043] Figure 5 In this embodiment of the invention, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was used to analyze OMVs isolated from wild-type bacteria and mutant strains; wherein, I, WT; II, Δlpp; III, Δlpp-ΔnlpI; IV, Δlpp-ΔnlpI-ΔmlaE; V, Δlpp-ΔnlpI-ΔtolA; VI, Δlpp-ΔnlpI-ΔmlaE-ΔtolA.

[0044] Figure 6 In the embodiment of the present invention, the biosynthesis of lycopene is shown in the following: (A) extracellular lycopene production by a defective strain expressing an enzyme that produces lycopene pathway; 1. Blue bar represents intracellular lycopene; 2. Gray bar represents OD600; 3. Box represents extracellular lycopene; and all data points represent mean ± standard deviation; (B) dodecane contains lycopene-containing outer membrane vesicles.

[0045] Figure 7 This diagram illustrates the time process of cell growth (OD600) and lycopene production in LYC-9 during fed-batch fermentation in this embodiment of the invention. The dashed line represents the IPTG induction time, and the error bar represents the standard deviation n = 3. Detailed Implementation

[0046] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.

[0047] Many specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below.

[0048] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in different places in this specification does not necessarily refer to the same embodiment, nor is it a single or selective embodiment that is mutually exclusive with other embodiments.

[0049] Example 1:

[0050] Construction of high-OMV-producing E. coli-deficient bacteria:

[0051] Using the previously reported knockout method: using a dual-plasmid CRISPR-Cas9 system (see...) Figure 1 The gene tolA, which encodes cell wall protein lpp, lipoprotein nlpI, phospholipid transport system permease protein mlaE, and colicin-transporting membrane protein, was deleted (Fordjour et al., 2019; Jiang et al., 2015).

[0052] The sequence of the knocked-out gene lpp is shown in SEQ ID NO: 1; the sequence of the knocked-out gene nlpI is shown in SEQ ID NO: 2; the sequence of the knocked-out gene mlaE is shown in SEQ ID NO: 3; and the sequence of the knocked-out gene tolA is shown in SEQ ID NO: 4.

[0053] The specific steps are as follows:

[0054] (1) Using the software example sgRNA Scorer (Genscript, 2015), sgRNAs (20 nucleotide sequences complementary to the target genes) were designed. The corresponding single-lead RNA (sgRNA) sequences designed for each target gene, lpp, nlpI, mlaE, and tolA, are shown below:

[0055] sgRNA lpp-1:AATCCTGGTTCTACTCTGC TGG(PAM)

[0056] sgRNA lpp-2:GAAAGCTACTAAACTGGTAC TGG(PAM)

[0057] sgRNA nlpI-1:ACTACGCGCACTTGAATCGC GGG(PAM)

[0058] sgRNA nlpI-2:CTACCTAAGTCTGGGGGATT TGG(PAM)

[0059] sgRNA nlpI-3:TGTCCAAATCCCCCAGACTT AGG(PAM)

[0060] sgRNA mlaE-1: GGTTCTGACCACTTATAGTG CGG(PAM)

[0061] sgRNA mlaE-2:TTGCCGCGTTGTTGTTTGCC GGG(PAM)

[0062] sgRNA mlaE-3:ACTCGTCTCTGGCTGTTCTG GGG(PAM)

[0063] sgRNA tolA-1:ATAGAAGCTTCAGCCGGAGG CGG(PAM)

[0064] sgRNA tolA-2:GACGCTGTCATGGTTGATTC AGG(PAM)

[0065] sgRNA tolA-3:CGCATAAAACTGGCACCCGA TGG(PAM)

[0066] (2) Insert the sgRNA into the available pTarget plasmid.

[0067] (3) Perform kinase inactivation as follows to ensure the connection of incompatible ends:

[0068] a. 1.3 mg (x) of linear DNA;

[0069] b.10X Blunting Buffer 1uL;

[0070] c. Inactivate 0.5 μL of the Kination enzyme mixture;

[0071] d. Add ddH2O to 10 μL (10–x);

[0072] e. Incubate at 37°C for 10 minutes and then at 70°C for 10 minutes in a thermal cycler;

[0073] f. Ligand reactant mixture: 5 μL reactant and 5 μL solution I (Takara);

[0074] g. Incubate at 16°C for 12 to 16 hours;

[0075] h. Transform the plasmid and spread it on a plate containing LB spectinomycin.

[0076] (4) Design and construct the donor gene (linear DNA). The primers used to construct the donor gene for gene knockout are shown below:

[0077] lpp-UP-F:GTTGGTACTGAGCAAAGGCGTT

[0078] lpp-UP-R: GCCATTTTTCACTTCACAGGTACTATATTAATACCCTCTAGATTGAGTTAATCTCCA

[0079] lpp-DOWN-F:TAACTCAATCTAGAGGGTATTAATA TAGTACCTGTGAAGTGAAAAATGGCG

[0080] lpp-DOWN-R:ACCTCATTCATGGTACCAGTGCG

[0081] nlpI-UP-F:CCACCATCGAAATCGAAGATGA

[0082] nlpI-UP-R:GATTACGGGCTGATGTGTACGTCAG CGAAGACCACGGTTGAATGAAC

[0083] nlpI-DOWN-F:GACGTTCATTCAACCGTGGTCTTCG CTGACGTACACATCAGCCCGTAA

[0084] nlpI-DOWN-R:TGTGTTTAGAGAAATCCGTCATTGC

[0085] mlaE-UP-F:ACTGCGCGAACATACCCAACTT

[0086] mlaE-UP-R:TTCATTTTTTTTCGTTTGCATGAAC GAGTGGCTTAACTCCCTGGTAAAAGA

[0087] mlaE-DOWN-F:CTTTTACCAGGGAGTTAAGCCACTC GTTCATGCAAACGAAAAAAAATGA

[0088] mlaE-DOWN-R:GCGCATCGCCACTATTCTTATT

[0089] tolA-UP-F:CGCGATCTCAAGTCCGAAATC

[0090] tolA-UP-R:ACCGTCCGAACAGTCAACATCGCGATCTCGGTTTCCAAAAACTGTTCG

[0091] tolA-DOWN-F:GGCGAACAGTTTTTGGAAACCGAGATCGCGATGTTGACTGTTCGG

[0092] tolA-DOWN-R:CCGCCAGTGTCAACAAGTTGATA

[0093] (5) Amplify the upstream and downstream DNA sequences of the gene to be deleted using their respective primers, and purify the PCR products as follows:

[0094] Reaction 1:

[0095] a) Upstream 1uL

[0096] b) Downstream 1uL

[0097] c)ddH2O 23uL

[0098] d) PCR enzyme 25uL

[0099] e) Reaction conditions: 9 cycles

[0100] f) No purification

[0101] Reaction 2:

[0102] a) 8 μL of reactants

[0103] b) 1.5 μL of upstream forward primer

[0104] c) 1.5 μL of downstream reverse primer

[0105] d)ddH2O 14uL

[0106] e) PCR enzyme 25uL

[0107] f) Purify the PCR product.

[0108] (6) Transform the constructed pCas9 plasmid into the BL21 strain:

[0109] Inoculate a single colony and incubate overnight at 37°C. Inoculate with 1% of the overnight pre-culture and incubate for 1 hour.

[0110] Promoter expression was induced by adding L-arabinose to a final concentration of 10 mM;

[0111] Continue culturing until the OD600 reaches approximately 0.6, then transfer the bacterial culture to a test tube and incubate on ice for approximately 15 minutes.

[0112] Harvest the cells and wash them twice with ddH2O;

[0113] Finally, wash twice with 10% glycerin;

[0114] Resuspend the cells in 400 μL of 10% glycerol, and aliquot 50 μL into 1.5 mL tubes.

[0115] (7) Electroporation: Add 2 uL of donor gene and 5 uL of pTarget to competent cells, incubate on ice for about 15 minutes, electroporate to transform plasmid and linear DNA, immediately add 1 mL of LB / SOB medium, incubate at 30℃ and 220 rpm for 2 hours, and plate on an agar plate containing kanamycin and spectinomycin.

[0116] (8) Discard pTarget plasmid: Inoculate with strains containing pCas9 and pTarget, add only equal amounts of 0.5mM IPTG and kanamycin, and incubate at 30°C and 220rpm for 8 to 16 hours. Streak the plasmid onto LB agar containing only kanamycin and incubate at 30°C. Pick the colonies onto agar plates containing spectinomycin and kanamycin respectively, and test the sensitivity to spectinomycin. Incubate overnight at 30°C.

[0117] (9) Repeat the process to knock out the next 3 genes.

[0118] (10) Finally, pCas9 can be lost by culturing the strain at 37°C for about 20 hours;

[0119] Kanamycin susceptibility testing is performed before subsequent tests.

[0120] Example 2:

[0121] Construction of plasmid pETDuet-1-crtE-crtB-crtI-IDI carrying lycopene:

[0122] The goal is to obtain a plasmid pET-crtE-crtB-crtI-IDI that expresses synthetic lycopene. The steps are as follows:

[0123] (1) Standard operating procedures in molecular biology were followed for plasmid extraction, DNA purification, ligation, PCR, and enzyme digestion. Plasmids were constructed using enzyme digestion and ligation methods and Gibson assembly (Gibson et al., 2009).

[0124] (2) The lycopene synthesis pathway was constructed by amplifying the genes geranylgeranyl pyrophosphate synthase (crtE), phytoene synthase (crtB) and phytoenedesaturase (crtI) from the genome of Corynebacterium glutamicum AT13032.

[0125] Using the genome of C. glutamicum AT13032 as a template, primers were designed and synthesized by Genewiz. The crtE, crtB and crtI gene fragments were obtained by PCR.

[0126] (3) Using IDI derived from Streptococcus pneumoniae as a template, the IDI gene was amplified.

[0127] (4) The genes crtE and crtB were fused together by overlap PCR to obtain the fragment crtE-crtB, and the genes crtI and IDI were fused together by overlap PCR to obtain the fragment crtI-IDI.

[0128] Table 1 PCR reaction system

[0129]

[0130] The PCR reaction conditions are as follows:

[0131]

[0132] (5) Perform agarose gel electrophoresis on the PCR amplification product, recover the agarose gel band with the correct molecular weight, and determine the concentration for later use.

[0133] (6) The plasmid pETDuet-1 and the fragment crtE-crtB were double-digested with NcoI and BamHI. The products were recovered by gel to obtain the linearized vector and the fragment crtE-crtB.

[0134] Table 2 Enzyme digestion system

[0135] Restriction endonucleases 5μL 5μL 10X Green buffer 5μL 5μL DNA 5μg 1μg ddH2O up to 50μL up to 50μL

[0136] (7) Ligate the linearized plasmid vector and the crtE-crtB fragment. The ligation system is shown below:

[0137] Table 3 Connection System

[0138] Ligation Mix 10μL carrier 0.05 pmol Excerpt 0.15 pmol ddH2O up to 20μL

[0139] (8) The ligation product was transformed into E. coli JM109, plated on LB (Amp) plates, and incubated overnight at 37°C to obtain transformants. Single colonies of transformants that were verified by Junli PCR were picked, incubated overnight at 37°C in Amp-resistant LB liquid medium, and plasmids were extracted. The pET-crtE-crtB plasmid was confirmed by Genewiz sequencing.

[0140] (9) Following the above procedure, clone the crtI-IDI fragment into the pET-crtE-crtB plasmid using NdeI and XhoI restriction sites to construct pET-crtE-crtB-crtI-IDI. Figure 2 ).

[0141] Example 3:

[0142] Construction of plasmid pRSFDuet-1-plsB-plsC-mvaE-mvK carrying lycopene:

[0143] The purpose of this experiment was to obtain a plasmid pRSFDuet-1-plsB-plsC-mvaE-mvK that overexpresses the key enzymes mvaE and mvK, as well as the membrane synthesis gene. The steps are as follows:

[0144] (1) Following the above operation method and procedure: using the chromosomal DNA gene of Escherichia coli BL21(DE3) as a template, 1-acylglycerol-3-phosphate acyltransferase (plsC) and lycerol-3-acyltransferase (plsB) were cloned into pRSFDuet-1 through the restriction sites NdeI and XhoI to generate plasmid pRSFDuet-plsBC.

[0145] (2) mvaE and mvK are considered to be two rate-limiting enzymes in the MVA pathway. These two genes are transmitted via the plasmid pACYCDuet-1-mvaE-mvaS-mvK-pmK-mvaD( Figure 3 The expression was amplified and overexpressed, and then cloned into the NcoI and BamHI restriction sites pRSFDuet-plsBC using the above method to generate the plasmid pRSFDuet-mvaE-mvK-plsBC. Figure 4 Positive colonies were verified by colony PCR and Genewiz sequencing.

[0146] Example 4

[0147] Performance testing:

[0148] The steps for yield testing of OMVs produced by E. coli-deficient bacteria are as follows:

[0149] (1) In order to generate and extract OMV, the strain of Escherichia coli was cultured in 50 ml LB medium at 30°C and 220 rpm for 24 hours.

[0150] (2) After culturing for 24 hours, the culture medium was centrifuged at 8000 rpm for 10 minutes at 4°C (Thermo Scientific Sorval ST 16R) to remove cells.

[0151] (3) Before sedimentation, carefully filter the supernatant using a 0.45 μm filter and centrifuge at 31200 rpm for 2.5 hours at 4 °C using Hitachi himac CP70ME.

[0152] (4) Suspend the vesicle particles in 1 mL of PBS.

[0153] (5) The Bradford method was used to quantify membrane-associated proteins of OMV. A standard curve was created using serial dilutions of bovine serum albumin.

[0154] (6) The OMV suspension was mixed with bovine serum albumin and measured at a wavelength of 562 nm in a 96-well microtiter plate.

[0155] (7) SDS-PAGE was performed to observe the protein content in OMVs, and the results are as follows: Figure 5 As shown.

[0156] Example 5

[0157] The following steps were taken to test the yield of lycopene secretion mediated by OMVs produced by Escherichia coli-deficient bacteria:

[0158] (1) Plasmids pACYCDuet-1-mvaE-mvaS-mvK-pmK-mvaD (sequence as SEQ ID NO: 7), pETDuet-1-crtE-crtB-crtI-IDI (sequence as SEQ ID NO: 8) and pRSFDuet-1-plsB-plsC-mvaE-mvK (SEQ ID NO: 9) were transformed into wild-type WT and defective bacteria Δlpp, Δlpp-ΔnlpI, Δlpp-ΔnlpI-ΔmlaE, Δlpp-ΔnlpI-ΔtolA, Δlpp-ΔnlpI-ΔmlaE-ΔtolA to obtain strains LYC-5, LYC-6, LYC-7, LYC-8 and LYC-9.

[0159] (2) De novo biosynthesis of lycopene was carried out in a fermentation medium consisting of 7 g / L glucose, 15 g / L yeast extract, 2 g / L KH2PO4, 12 g / L K2HPO4, 5 g / L tryptone, 1.1 g / L MgSO4, 0.5 g / L citric acid, and 4 g / L glycerol. Overnight seed cultures were pre-cultured in LB medium at 30°C and 220 rpm.

[0160] (3) At an initial OD600 of 0.1, overnight seeds were inoculated into 50 ml of fermentation medium and cultured at 37°C and 220 rpm for 4 hours.

[0161] (4) After 4 hours, add 0.3 mM IPTG as an inducer and incubate at 30 °C and 220 rpm for 72 hours.

[0162] Example 6

[0163] Determination of intracellular lycopene concentration:

[0164] (1) Cells were precipitated from a 2 mL sample by centrifugation at 10,000X g for 5 minutes.

[0165] (2) Wash the cells twice with double-distilled water, centrifuge again, resuspend in acetone (2 mL), incubate in the dark at 55°C for 15 minutes with intermittent vortexing, and then centrifuge at 8000X g for 3 minutes.

[0166] (3) The acetone extract at OD472nm was measured on a spectrophotometer. Acetone was used as a blank to indirectly determine the relative lycopene content.

[0167] (4) Serial dilution of the standard stock solution is used to create a standard curve. The stem cell weight (DCW) is calculated according to the formula, 1OD600 = 0.323DCW / L.

[0168] Determination of extracellular lycopene concentration:

[0169] (1) n-Dodecane has been selected as an organic layer for extracting and capturing lycopene-containing OMVs.

[0170] (2) After IPTG induction, 20% n-dodecane was added as an organic layer. After fermentation, the n-dodecane layer was centrifuged at 10000X g for 5 minutes. Photometric analysis was performed at 472 nm using a spectrophotometer, with n-dodecane used as a blank.

[0171] (3) Calculate the lycopene yield. The results are as follows: Figure 6 As shown.

[0172] Example 7

[0173] Feed-batch yield test of lycopene secretion mediated by OMVs produced by E. coli defective bacteria Δlpp-ΔnlpI-ΔmlaE-ΔtolA:

[0174] (1) Fed batch fermentation was carried out in a 4L bioreactor using 2L of synthetic fermentation medium.

[0175] (2) The synthesis medium consists of 1.1 g / L citric acid monohydrate, 12 g / L yeast extract, 8 g / L NH4(SO4)2, 2.5 g / L KH2PO4, 1 g / L MgSO4·7H2O, 3.5 g / L K2HPO4, 5 g / L glycerol, and 20 g / L glucose.

[0176] Add 1 mL / L of trace element solution to the fermentation medium. The trace element solution consists of 2.5 g / L anhydrous CaCl2, 1.5 g / L ZnSO4·7H2O, 0.7 g / L CuSO4·5H2O, 1.5 g / L MnCl2·4H2O, 0.4 g / L CoCl2·H2O, 0.8 g / L H2BO3, 0.4 g / L Na2MoO4·2H2O, 10 g / L FeSO4·7H2O, 0.5 g / L AlCl3·6H2O, and 1 g / L EDTA.

[0177] (3) Add 20% n-dodecane as a second layer after IPTG induction.

[0178] (4) The pH was maintained at 7 by titration with 10N NH4OH and 5N H2SO4. The feed solution consisted of 2 g / L MgSO4·7H2O and 50% (w / w) glucose.

[0179] (5) Samples were periodically taken for OD600 and lycopene analysis. Results are as follows: Figure 7 As shown.

[0180] The lycopene pathway derived from Corynebacterium glutamicum was expressed in Escherichia coli BL21(DE3), improving the synthesis of the universal precursor IPP / DMAAPP and overexpressing the exogenous MVA pathway. OMV production was induced / triggered by deleting specific genes to alter cell membrane stability, and lycopene secretion and efflux were mediated.

[0181] This invention provides a method for high-yield lycopene production mediated by outer membrane vesicles. A defective strain, Δlpp-ΔnlpI-ΔmlaE-ΔtolA, was designed to enhance outer membrane vesicle (OMV) production. The provided E. coli defective strain is based on the E. coli BL21(DE3) gene knockout of lpp, nlpI, mlaE, and tolA. Compared to the wild-type strain, this defective strain produces 6.1 times more OMVs. Furthermore, the plasmid expressing the MVA pathway for lycopene production was transferred into Δlpp-ΔnlpI-ΔmlaE-ΔtolA to obtain the highest-producing strain, LYC-9. In shake flasks, this strain secreted 137.4 mg / L of lycopene, a 36.16-fold increase compared to the initial strain LYC-5 expressing the exogenous MVA pathway. In a 4L fermenter, strain LYC-9 produced an extracellular lycopene yield of 575 mg / L.

[0182] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A method for high production of exosome-mediated lycopene secretion and high production, characterized by: include, By using the E. coli defective bacteria Δlpp-ΔnlpI-ΔmlaE-ΔtolA to enhance the production of outer membrane vesicles, lycopene secretion and transport can be mediated to achieve high lycopene production. The Escherichia coli defect strain Δlpp-ΔnlpI-ΔmlaE-ΔtolA was obtained by sequentially knocking out the genes lpp, nlpI, mlaE, and tolA from the wild-type BL21 (DE3) gene. The sequence of the knocked-out gene lpp is shown in SEQ ID NO: 1; The sequence of the knocked-out gene nlpI is shown in SEQ ID NO: 2; The sequence of the knocked-out gene mlaE is shown in SEQ ID NO: 3; The sequence of the knocked-out gene tolA is shown in SEQ ID NO: 4; The process of mediating lycopene secretion and transport includes transferring lycopene-producing plasmids into Escherichia coli defective strain Δlpp-ΔnlpI-ΔmlaE-ΔtolA to obtain a lycopene-producing strain; and fermenting the lycopene-producing strain in a fermentation medium to obtain lycopene.

2. The method of claim 1, wherein: Plasmids used for gene knockout include plasmid pCas9 and plasmid pTarget, among which, The sequence of the plasmid pCas9 is shown in SEQ ID NO: 5; The sequence of the plasmid pTarget is shown in SEQ ID NO:

6.

3. The method of claim 1, wherein: The tomato red plasmids used for production include plasmids pACYCDuet-1-mvaE-mvaS-mvK-pmK-mvaD, pETDuet-1-crtE-crtB-crtI-IDI, and pRSFDuet-1-plsB-plsC-mvaE-mvK; wherein... The sequence of the plasmid pACYCDuet-1-mvaE-mvaS-mvK-pmK-mvaD is shown in SEQ ID NO: 7; The sequence of the plasmid pETDuet-1-crtE-crtB-crtI-IDI is shown in SEQ ID NO: 8; The sequence of the plasmid pRSFDuet-1-plsB-plsC-mvaE-mvK is shown in SEQ ID NO:

9.

4. The method of claim 1, wherein: The fermentation medium comprises 7 g / L glucose, 15 g / L yeast extract, 2 g / L KH2PO4, 12 g / L K2HPO4, 5 g / L tryptone, 1.1 g / L MgSO4, 7 g / L H2O, 0.5 g / L citric acid, and 4 g / L glycerol.

5. The method of claim 1, wherein: The fermentation culture includes, Overnight seed cultures were pre-cultured in LB medium at 30°C and 220 rpm. At an initial OD600 of 0.1, overnight seed was inoculated into 50 ml of fermentation medium and cultured at 37°C and 220 rpm for 4–6 h. Add as an inducer and incubate at 30℃ and 220 rpm for 48~72h.

6. The method of claim 5, wherein: The inducer includes isopropyl thiogalactoside.

7. The method of claim 6, wherein: The amount of isopropyl thiogalactoside added is 0.3 ~ 0.5 mM.

8. The method of claim 7, wherein: The amount of isopropyl thiogalactoside added was 0.3 mM.

9. The method of claim 5, wherein: The incubation time is 72 hours.