Expression vectors, strains, methods and applications for biosynthesis of nicotinamide riboside

Abstract

The application relates to the technical field of nicotinamide riboside, in particular to an expression vector, a strain, a method and application for biosynthesis of nicotinamide riboside. The expression vector carries a first coding gene of an outward transport protein MdtL and a second coding gene of a phosphoribosyl transferase NAMPT, the nucleotide sequence of the first coding gene is shown as SEQ ID NO. 1, the nucleotide sequence of the second coding gene is shown as SEQ ID NO. 2, and the expression vector is expressed by a host bacterium and then extracellularly secretes the phosphoribosyl transferase to catalyze synthesis of nicotinamide riboside from nicotinamide. The bacillus into which the expression vector is transferred can extracellularly express the phosphoribosyl transferase, and the content of nicotinamide riboside in fermentation is much higher than the biosynthesis amount in escherichia coli.

Description

Technical Field

[0001] This application relates to the field of nicotinamide ribose technology, specifically to expression vectors, strains, methods, and applications for the biosynthesis of nicotinamide ribose. Background Technology

[0002] Nicotinamide adenine dinucleotide (NAD), which has the ability to regulate the activity of type III protein lysine deacetylases (Sirloins), is considered to have the potential to treat cancer, Parkinson's disease, obesity, diabetes, and other age-related diseases. NAD is the sole substrate of Sirloins, and its level directly determines the activity of the Sirloin family, which in turn has a significant impact on cell lifespan. However, NAD cannot directly enter cells, so it is necessary to supplement its precursors to increase NAD levels in cells, thereby achieving anti-aging effects. Among the various NAD precursors, nicotinamide ribose (NR) can significantly increase intracellular NAD levels after being taken up by eukaryotes. Based on this characteristic, nicotinamide ribose has been applied in the field of anti-aging. Meanwhile, related studies have shown that nicotinamide ribose can effectively improve the clinical symptoms of diabetes and neurological diseases; as a platform compound, nicotinamide ribose is used to prepare anticancer drugs. Therefore, nicotinamide ribose has enormous economic value and application prospects, and its production is attracting increasing attention.

[0003] In the production of nicotinamide ribose, phosphoribosyltransferase (Nampt) has been reported to significantly promote the synthesis of its precursor (nicotinamide mononucleotide), thereby leading to the synthesis of nicotinamide ribose. Biosynthetic methods have been employed, such as overexpression of phosphoribosyltransferase alone in *E. coli*, but the expression level is limited and cannot efficiently achieve the biosynthesis of nicotinamide ribose. Summary of the Invention

[0004] The inventors of this application have creatively demonstrated that by co-expressing the genes encoding the transport protein MdtL and the phosphoribosyltransferase NAMPT, not only can phosphoribosyltransferase be expressed extracellularly, but the amount of nicotinamide ribose produced during fermentation is also significantly higher than the amount synthesized in *E. coli*. Therefore, this application discloses at least the following technical solutions in its embodiments:

[0005] (1) An expression vector carrying a first coding gene for the exogenous protein MdtL and a second coding gene for the phosphoribosyltransferase NAMPT, wherein the nucleotide sequence of the first coding gene is shown in SEQ ID NO.1 and the nucleotide sequence of the second coding gene is shown in SEQ ID NO.2, wherein the expression vector is expressed by its host bacteria and then secretes the phosphoribosyltransferase extracellularly to catalyze the synthesis of nicotinamide into nicotinamide ribose.

[0006] (2) A recombinant Bacillus licheniformis carrying the expression vector described in (1), wherein the expression vector is transcribed, translated and expressed by the Bacillus licheniformis during its growth.

[0007] (3) A recombinant Bacillus subtilis carrying the expression vector described in (1), wherein the expression vector is transcribed, translated and expressed by the Bacillus subtilis during its growth process using phosphoribosyltransferase.

[0008] (4) A recombinant Bacillus amyloliquefaciens carrying the expression vector described in (1), wherein the expression vector is transcribed, translated and expressed by the Bacillus amyloliquefaciens during its growth.

[0009] (5) A method for constructing an expression vector, wherein the expression vector (1) is described, and the method for constructing the expression vector includes:

[0010] Obtain nucleic acid molecules of the first coding gene and the second coding gene;

[0011] Obtain the basic vector fragment of the expression vector;

[0012] The nucleic acid molecule of the second encoding gene is ligated to the basic vector fragment, transformed into Escherichia coli, and screened to obtain a second positive transformant. The vector carrying the second encoding gene is then isolated from the second positive transformant.

[0013] The vector carrying the second coding gene is amplified to obtain a linear vector fragment carrying the second coding gene.

[0014] The nucleic acid molecule encoding the first gene was ligated to the linear vector fragment, transformed into E. coli, and the first positive transformant was obtained by screening.

[0015] (6) A method for constructing recombinant Bacillus, comprising:

[0016] Obtain the expression vector described in (1);

[0017] The expression vector was transferred into the Bacillus, and positive clones were obtained by screening, which are the recombinant Bacillus.

[0018] (7) A method for producing phosphoribosyltransferase by fermentation, comprising:

[0019] Obtain the *Bacillus licheniformis* described in (2), or the *Bacillus subtilis* described in (3), or the *Bacillus amyloliquefaciens* described in (4); and

[0020] Phosphoribotransferase is harvested from the fermentation broth of Bacillus licheniformis as described in (2), Bacillus subtilis as described in (3), or Bacillus amyloliquefaciens as described in (4).

[0021] (8) A method for producing phosphoribosyltransferase by fermentation, comprising:

[0022] Obtain the Bacillus licheniformis described in (2), or the Bacillus subtilis described in (3), or the Bacillus amyloliquefaciens described in (4);

[0023] Inoculated into a fermentation medium containing nicotinamide for fermentation culture; and

[0024] Phosphoribotransferase was harvested from the supernatant of the fermentation broth.

[0025] Compared with the prior art, the above solutions (1) to (8) have at least one of the following beneficial effects:

[0026] By constructing the aforementioned expression vector, it can be transformed into different types of Bacillus. For example, the expression vector was transformed into Bacillus licheniformis, Bacillus subtilis, and Bacillus amyloliquefaciens, respectively. The resulting recombinant Bacillus strains can ferment a medium containing nicotinamide and express phosphonucleotide transferase to directly biosynthesize nicotinamide ribose. Compared to other recombinant strains transformed with only phosphonucleotide transferase, the strain obtained in this application provides a nicotinamide ribose yield of at least 9%, representing a yield increase of at least 30%. Attached Figure Description

[0027] Figure 1 This is a gel image for verifying the Nampt gene DNA fragment provided in the embodiments of this application; lane M is the marker, and from top to bottom, the DNA sizes are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; lane 1 is the target band.

[0028] Figure 2 This is a gel image for verifying the pHY-300 vector fragment provided in the embodiments of this application. Lane M is the marker, and from top to bottom, the DNA sizes are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; lane 1 is the target band.

[0029] Figure 3 This is a gel image of the pHY-Nampt calcium-transformed colony PCR verification provided in the embodiments of this application. Lane M is the marker, and the DNA sizes from top to bottom are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; lane 1 is the target band.

[0030] Figure 4 This is a gel image for verifying the mdtL (Ec) gene DNA fragment provided in the embodiments of this application. Lane M is the marker, and the DNA sizes from top to bottom are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; lane 1 is the target band.

[0031] Figure 5 This application provides a gel image for verifying the vector fragment amplified using plasmid pHY-NampT as a template. Lane M is the marker, and the DNA sizes from top to bottom are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; lane 1 is the target band.

[0032] Figure 6 This is a gel image of pHY-Nampt-mdtL (Ec) calcium-transformed colony PCR verification provided in the embodiments of this application. Lane M is the marker, and from top to bottom, the DNA sizes are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; lane 1 is the target band.

[0033] Figure 7 This is a gel image of pHY-Nampt-pnuC (Ec) calcium-transformed colony PCR verification provided in the embodiments of this application. Lane M is the marker, and the DNA sizes from top to bottom are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; Lane 1 is the target band, with a size of 720 bp.

[0034] Figure 8This is a gel image for PCR verification of pHY-Nampt-pnuC (Bm) calcium-transformed colonies provided in the embodiments of this application. Lane M is the marker, and the DNA sizes from top to bottom are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; Lane 1 is the target band, with a size of 651 bp.

[0035] Figure 9 This is a gel image for PCR verification of pHY-Nampt-ermD (Ec) calcium-transformed bacterial colonies provided in the embodiments of this application. Lane M is the marker, and the DNA sizes from top to bottom are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; Lane 1 is the target band, with a size of 1451 bp.

[0036] Figure 10 This is a gel image of WX-02 / pHY-Nampt-mdtL (Ec) electroporation colony PCR verification provided in the embodiments of this application. Lane M is the marker, and the DNA sizes from top to bottom are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; Lane 1 is the target band, with a size of 1442 bp.

[0037] Figure 11 This is a gel image of WX-02 / pHY-Nampt electroporation colony PCR verification provided in the embodiments of this application. Lane M is the marker, and from top to bottom, the DNA sizes are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; Lane 1 is the target band, with a size of 1442 bp.

[0038] Figure 12 This is a gel image of WX-02 / pHY-Nampt-pnuC (Ec) electroporation colony PCR verification provided for embodiments of this application. Lane M is the marker, and from top to bottom, the DNA sizes are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; Lane 1 is the target band, with a size of 986 bp.

[0039] Figure 13This is a gel image of WX-02 / pHY-Nampt-pnuC (Bm) electroporation colony PCR verification provided in the embodiments of this application. Lane M is the marker, and the DNA sizes from top to bottom are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; Lane 1 is the target band, with a size of 971 bp.

[0040] Figure 14 This is a gel image of WX-02 / pHY-Nampt-ermD (Ec) electroporation colony PCR verification provided in the embodiments of this application. Lane M is the marker, and the DNA sizes from top to bottom are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp; Lane 1 is the target band, with a size of 1451 bp.

[0041] Figure 15 The images show gel images of BS168 / pHY-Nampt and HZ-12 / pHY-Nampt electroporation colony PCR verification provided in the embodiments of this application. Lane M is the marker, and the DNA sizes from top to bottom are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp. Lanes 1 and 2 are for BS168 / pHY-Nampt and HZ-12 / pHY-Nampt electroporation colony PCR verification, respectively, with a band size of 1668 bp in both lanes.

[0042] Figure 16 The images show gel images of electroporated colony PCR verification of BS168 / pHY-Nampt-mdtL (Ec) and HZ-12 / pHY-Nampt-mdtL (Ec) provided for embodiments of this application. Lane M is the marker, and the DNA sizes from top to bottom are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp. Lanes 1 and 2 are for electroporated colony PCR verification of BS168 / pHY-Nampt-mdtL (Ec) and HZ-12 / pHY-Nampt-mdtL (Ec), respectively, with a band size of 1442 bp in both lanes.

[0043] Figure 17 This is a schematic diagram of an expression vector structure provided in an embodiment of this application. Detailed Implementation

[0044] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not specifically described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0045] It should be noted that the terms "first," "second," etc., in the specification, claims, and accompanying drawings of this invention are used to distinguish similar objects and are not necessarily used to describe a specific order or sequence, nor do they substantially limit the technical features thereafter. It should be understood that such data can be interchanged where appropriate so that the embodiments of the invention described herein can be implemented in orders other than those illustrated or described herein. Furthermore, the terms "comprising" and "having," and any variations thereof, are intended to cover non-exclusive inclusion; for example, a process, method, system, product, or apparatus that comprises a series of steps or units is not necessarily limited to those steps or units explicitly listed, but may include other steps or units not explicitly listed or inherent to such processes, methods, products, or apparatus.

[0046] To better understand the invention and not to limit its scope, all figures indicating amounts, percentages, and other numerical values ​​used in this application should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0047] Nampt of Meiothermus ruber was expressed in the E. coli system, and based on this enzymatic property, it can be used to produce NR by single-enzyme catalysis. However, it can only be expressed intracellularly in the E. coli system. Moreover, this does not clearly indicate that it can be directly fermented in nicotinamide-containing media to produce nicotinamide ribose (see "Liao Yibo et al., Expression of nicotinamide phosphoribosyltransferase in E. coli and its catalytic synthesis of nicotinamide mononucleotide [J] Modern Food Science and Technology, Vol. 37, No. 2, 2021").

[0048] This application provides an expression carrier, such as... Figure 17As shown, the expression vector carries a first coding gene for the exocrine protein MdtL and a second coding gene for the phosphoribosyltransferase NAMPT. The nucleotide sequence of the first coding gene is shown in SEQ ID NO.1, and the nucleotide sequence of the second coding gene is shown in SEQ ID NO.2. After expression by its host bacteria, the expression vector secretes the phosphoribosyltransferase extracellularly. Using this expression vector, NAMPT can be expressed in Bacillus and extracellular expression can be achieved. The resulting recombinant strain can efficiently biosynthesize nicotinamide ribose using a nicotinamide-containing culture medium.

[0049] In some embodiments, the first coding gene further includes a first promoter sequence and a first terminator sequence, the first promoter sequence being shown in SEQ ID NO.5 and the first terminator sequence being shown in SEQ ID NO.6. The second coding gene further includes a second promoter sequence and a second terminator sequence, the second promoter sequence being shown in SEQ ID NO.3 and the second terminator sequence being shown in SEQ ID NO.4.

[0050] In some embodiments, the expression vector is a plasmid vector or a lentiviral vector. For example, the plasmid vector may be pHY-P43, pHY300PLK, pBE2R(cm)-mCitrine, pBE2R(cm), pBE2R-mCitrine, pBE2R-P43-EGFP-HpaII-Signal-Hyg, pBE2R-EGFP, pBE2R, pMA0911, pHT43-SUMO-GFP, pWB980, pHT43-His, pHT43, pET-37b(+), pET-27b(+), pET-26b(+), pET-25b(+), pET-22b(+), or pNCMO2.

[0051] This application also discloses a strain of Bacillus licheniformis carrying the expression vector provided in the above embodiments. This expression vector is transcribed, translated, and expresses phosphoribosyltransferase by the Bacillus licheniformis during its growth. Specifically, the host bacterium is Bacillus licheniformis WX-02 (accession number CCTCC NO: M208065). Experiments have confirmed that this Bacillus licheniformis can ferment a culture medium containing nicotinamide, increasing the nicotinamide ribose yield by at least 19% and achieving a yield of at least 8 g / L.

[0052] This application provides a strain of Bacillus subtilis carrying the expression vector provided in the above-described embodiments. This expression vector is transcribed, translated, and used by the Bacillus subtilis to express phosphoribosyltransferase during its growth. Specifically, the host bacterium is Bacillus subtilis 168 (platform number Bio-82277, Microbial Strains Query Network). Experiments have confirmed that this Bacillus subtilis can ferment a culture medium containing nicotinamide, increasing the nicotinamide ribose yield by at least 24% to a minimum of 7 g / L.

[0053] This application provides a strain of *Bacillus amyloliquefaciens* carrying the expression vector provided in the above-described embodiments. This expression vector is transcribed, translated, and used by the *Bacillus amyloliquefaciens* to express phosphoribosyltransferase during its growth. Specifically, the host bacterium is *Bacillus amyloliquefaciens* HZ-12 (accession number CCTCC NO: M2017805). Experiments have confirmed that this *Bacillus amyloliquefaciens* can ferment a medium containing nicotinamide, increasing the nicotinamide ribose yield by at least 34% to a minimum of 2 g / L.

[0054] This application also provides a method for constructing the above-mentioned expression vector, including:

[0055] Obtain nucleic acid molecules of the first coding gene and the second coding gene;

[0056] Obtain the basic vector fragment of the expression vector;

[0057] The nucleic acid molecule of the second encoding gene is ligated to the basic vector fragment, transformed into E. coli, and screened to obtain a second positive transformant. The vector carrying the second encoding gene is then isolated from the second positive transformant.

[0058] The vector carrying the second coding gene is amplified to obtain a linear vector fragment carrying the second coding gene.

[0059] The nucleic acid molecule encoding the first gene was ligated to the linear vector fragment, transformed into E. coli, and the first positive transformant was obtained by screening.

[0060] Example 1: Construction of expression vector pHY-Nampt-mdtL(Ec)

[0061] (1) Obtain the nucleic acid molecule of the second coding gene (Nampt gene sequence)

[0062] Using Chitinophaga pinensis genomic DNA (WP_012788281.1) as a template, primer Nampt-F (shown in SEQ ID NO.7) was designed. CGGAATTCATGACGAAAGAAAACCTG (the underlined part is the EcoRI restriction site) and Nampt-R (as shown in SEQ ID NO. 8). GCTCTAGA TTAGATCGTCGCGTTTTT, where the underlined portion represents the XbaI restriction site) amplified the gene expression cassette (including the first promoter, Nampt gene, and first terminator) of the phosphoribosyltransferase gene Nampt, resulting in a 1416bp Nampt gene sequence (e.g., TTAGATCGTCGCGTTTTT, where the underlined portion represents the XbaI restriction site). Figure 1 (As shown).

[0063] (2) Obtaining the basic vector fragment of the expression vector

[0064] The Bacillus expression vector pHY300 (Novagen) was double-digested with EcoRI and XbaI to obtain the double-digested vector fragment, as shown below. Figure 2 As shown, a basic vector fragment with a length of 4845bp was obtained.

[0065] (3) Steps to the second positive transformant

[0066] The obtained Nampt gene fragment was digested with EcoRI and XbaI to obtain a double-digested fragment;

[0067] The Nampt gene fragment and the basic vector fragment were ligated using T4 DNA ligase to obtain the ligation product. This ligation product was transformed into *E. coli* DH5α using the calcium chloride conversion method. Transformants were selected by screening on a tetracycline-resistant medium at 37°C, and colony PCR was performed to verify the transformants (using primers pHY-F (SEQ ID NO. 9) and pHY-R (SEQ ID NO. 10)). Figure 3 As shown, if the PCR verification result of the transformant is that an electrophoretic band appears at 1668bp, it indicates that the expression vector was successfully constructed, and the above transformant is the second positive transformant (i.e., the phosphoribosyltransferase free expression plasmid pHY-Nampt).

[0068] (4) Obtain the nucleic acid molecule of the first coding gene (mdtL gene sequence)

[0069] Using Escherichia coli genomic DNA (NC_000913.3) as a template, primers EcmdtL-F (SEQ ID NO.11) and EcmdtL-R (SEQ ID NO.12) were designed to amplify the mdtL (Ec) gene expression cassette (including the second promoter, the mdtL (Ec) gene, and the second terminator), resulting in a 1176 bp mdtL (Ec) gene sequence (e.g., ...). Figure 4 (As shown).

[0070] (5) Amplify the vector carrying the second coding gene

[0071] A linear vector fragment carrying the second coding gene was obtained, and the primers used for amplification included T5-amp-F (shown in SEQ ID NO.13) and T5-amp-R (shown in SEQ ID NO.14), as follows. Figure 5 As shown, a vector fragment (phosphoribotransferase free expression plasmid pHY-Nampt) carrying the second coding gene with a length of 7044 bp was obtained.

[0072] (6) The first positive transformant was obtained.

[0073] The mdtL gene sequence obtained in step (4) and the linear vector fragment obtained in step (5) were ligated with T5 exonuclease to obtain the ligation product. The ligation product was transformed into Escherichia coli DH5α by calcium chloride conversion. Transformants were screened in a tetracycline-resistant medium at 37°C to obtain transformants. The transformants were verified by colony PCR (primers pHY-F and pHY-R were used). If the PCR verification result of the transformant showed an electrophoretic band at 1442 bp, it indicated that the knockout vector was successfully constructed. The above transformant was the first positive transformant and named: exogenous protein and phosphoribosyltransferase co-expression plasmid pHY-Nampt-mdtL (Ec). The colony PCR verification result was as follows: Figure 6 As shown, the size is 1442 bp.

[0074] Comparative Example 1: Construction of the expression vector pHY-Nampt

[0075] The phosphoribosyltransferase free expression plasmid pHY-Nampt obtained in steps (1)-(3) of Example 1 was used as the expression vector of Comparative Example 1.

[0076] Comparative Example 2: Construction of the expression vector pHY-Nampt-pnuC(Ec)

[0077] The second coding gene in step (5) of Example 1 was replaced with pnuC(Ec) (including the second promoter, the pnuC(Ec) gene and the second terminator, the pnuC(Ec) gene is shown in SEQ ID NO.15). The gene sequence was obtained from Escherichia coli genomic DNA (NC_000913.3), and the amplification primers were EcpnuC-F (shown in SEQ ID NO.16) and EcpnuC-R (shown in SEQ ID NO.17). The pnuC(Ec) gene sequence length was 720 bp. The resulting expression plasmid was named pHY-Nampt-pnuC(Ec), and its colony PCR verification results are as follows. Figure 7 As shown.

[0078] Comparative Example 3: Construction of the expression vector pHY-Nampt-pnuC(Bm)

[0079] The second coding gene in step (5) of Example 1 was replaced with pnuC(Bm) (including the second promoter, the pnuC(Bm) gene, and the second terminator; the pnuC(Bm) gene is shown in SEQ ID NO. 18). The pnuC(Bm) gene sequence was derived from the genomic DNA of Bacillus mycoides. The amplification primers were BmpnuC-F (shown in SEQ ID NO. 19) and BmpnuC-R (shown in SEQ ID NO. 20). The pnuC(Bm) gene sequence was 651 bp long, and the resulting expression plasmid was named pHY-Nampt-pnuC(Bm). The colony PCR verification results are as follows: Figure 8 As shown.

[0080] Comparative Example 4: Construction of the expression vector pHY-Nampt-ermD(Ec)

[0081] The second coding gene in step (5) of implementation column 1 was replaced with ermD (Ec) (including the second promoter, the ermD (Ec) gene and the second terminator, the ermD (Ec) gene is shown in SEQ ID NO.21), the gene sequence was obtained from E. coli genomic DNA (NC_000913.3), the amplification primers were EcermD-F (shown in SEQ ID NO.22) and EcermD-R (shown in SEQ ID NO.23), the pnuC (Ec) gene sequence length was 1451bp, and the obtained expression plasmid was named pHY-Nampt-ermD (Ec). The verification results of its colony PCR are as follows. Figure 9 As shown.

[0082] This application also discloses a method for constructing recombinant Bacillus, comprising: obtaining the expression vector provided in the above embodiments; transferring the expression vector into the Bacillus, and screening to obtain positive clones, which are the recombinant Bacillus.

[0083] In the construction of the recombinant Bacillus strain (named WX-02 / pHY-Nampt-mdtL (Ec)) in Example 1, the expression vector pHY-Nampt-mdtL (Ec) provided in Example 1 was electroporated into Bacillus licheniformis WX-02. Tetracycline resistance was used as a selection marker, and colony PCR was performed. pHY-YF and pHY-YR were used as verification primers. If the PCR verification result of the transformant showed an electrophoretic band at 1442 bp, it indicated that the recombinant strain was successfully constructed and a positive transformant was obtained. The colony PCR verification results are as follows: Figure 10 As shown.

[0084] In the construction of the recombinant Bacillus strain (named WX-02 / pHY-Nampt) in Comparative Example 1, the expression vector pHY-Nampt provided in Comparative Example 1 was electroporated into Bacillus licheniformis WX-02. Tetracycline resistance was used as a selection marker, and colony PCR was performed for screening. pHY-F and pHY-R were used as verification primers. If the PCR verification result of the transformant showed an electrophoretic band at 1442 bp, it indicated that the recombinant strain was successfully constructed and a positive transformant was obtained. The colony PCR verification results are as follows: Figure 11 As shown.

[0085] In the construction of the recombinant Bacillus strain (named WX-02 / pHY-Nampt-pnuC (Ec)) in Comparative Example 2, the expression vector pHY-Nampt-pnuC (Ec) provided in Comparative Example 2 was electroporated into Bacillus licheniformis WX-02. Tetracycline resistance was used as a selection marker, and colony PCR was performed for screening. amp-YF and amp-YR were used as verification primers. If the PCR verification result of the transformant showed an electrophoretic band at 986 bp, it indicated that the recombinant strain was successfully constructed and a positive transformant was obtained. The colony PCR verification results are as follows: Figure 12 As shown.

[0086] In the construction of the recombinant Bacillus strain (named WX-02 / pHY-Nampt-pnuC(Bm)) in Comparative Example 3, the expression vector pHY-Nampt-pnuC(Bm) provided in Comparative Example 3 was electroporated into Bacillus licheniformis WX-02. Tetracycline resistance was used as a selection marker, and colony PCR was performed for screening. amp-YF and amp-YR were used as verification primers. If the PCR verification result of the transformant showed an electrophoretic band at 971 bp, it indicated that the recombinant strain was successfully constructed and a positive transformant was obtained. The colony PCR verification results are as follows: Figure 13 As shown.

[0087] In the construction of the recombinant Bacillus strain (named WX-02 / pHY-Nampt-ermD (Ec)) in Comparative Example 4, the expression vector pHY-Nampt-ermD (Ec) provided in Comparative Example 4 was electroporated into Bacillus licheniformis WX-02. Tetracycline resistance was used as a selection marker, and colony PCR was performed for screening. amp-YF and amp-YR were used as verification primers. If the PCR verification result of the transformant showed an electrophoretic band at 1451 bp, it indicated that the recombinant strain was successfully constructed and a positive transformant was obtained. The colony PCR verification results are as follows: Figure 14 As shown.

[0088] Therefore, this application also provides a method for producing phosphoribosyltransferase by fermentation, comprising:

[0089] The *Bacillus licheniformis*, *Bacillus subtilis*, or *Bacillus amyloliquefaciens* provided in the above embodiments are obtained; they are inoculated into a nicotinamide ribose fermentation medium for fermentation; and phosphoribosyltransferase is harvested from the fermentation broth. Fermentation of these *Bacillus licheniformis*, *Bacillus subtilis*, or *Bacillus amyloliquefaciens* produces phosphoribosyltransferase, which efficiently catalyzes the synthesis of nicotinamide ribose from nicotinamide, increasing the yield and production rate of nicotinamide ribose.

[0090] Therefore, this application also provides a method for biosynthesizing nicotinamide ribose, comprising:

[0091] Obtain Bacillus licheniformis, Bacillus subtilis, or Bacillus amyloliquefaciens as described in the above embodiments; inoculate them into a fermentation medium containing nicotinamide for fermentation; and harvest nicotinamide ribose from the supernatant of the fermentation broth.

[0092] A test case includes the following test steps:

[0093] (1) Test strains

[0094] The recombinant strains provided in Example 1 and Comparative Examples 1-4, respectively.

[0095] In addition, the expression vector pHY-Nampt provided in Comparative Example 1 was electroporated into Bacillus subtilis 168 and Bacillus amyloliquefaciens HZ-12, using tetracycline resistance as a selection marker, and screened by colony PCR. pHY-F and pHY-R were used as verification primers, such as... Figure 15As shown, if the PCR verification result of the transformant is that an electrophoretic band appears at 1668bp, it indicates that the recombinant strain has been successfully constructed and phosphoribosyltransferase expression strains BS168 / pHY-Nampt (Comparative Example 5) and HZ-12 / pHY-Nampt (Comparative Example 6) have been obtained.

[0096] In addition, the expression vector pHY-Nampt-mdtL (Ec) provided in Example 1 was electroporated into Bacillus subtilis 168 and Bacillus amyloliquefaciens HZ-12, using tetracycline resistance as a selection marker, and screened by colony PCR, with amp-YF and amp-YR as verification primers, such as... Figure 16 As shown, if the PCR verification result of the transformant is that an electrophoretic band appears at 1442bp, it indicates that the recombinant strain has been successfully constructed and phosphoribosyltransferase expression strains BS168 / pHY-Nampt-mdtL (Ec) (Example 2) and HZ-12 / pHY-Nampt-mdtL (Ec) (Example 3) are obtained.

[0097] (2) Test method

[0098] The phosphoribosyltransferase expression strains provided in Examples 1-3 and Comparative Examples 1-6 were subjected to fermentation tests.

[0099] Seed culture: LB medium was used as the activation medium and cultured for 11 h at 37℃ and 230 rpm until the biomass reached 0.35 g / L.

[0100] The fermentation medium was formulated as follows: 25 g / L glucose, 6 g / L nicotinamide (NAM), 15 g / L yeast extract, and 10–17.1 g / L Na₂HPO₄. . 12H₂O, 1~3 g / L KH₂PO₄, 1~3 g / L NH₄Cl, 0.1~0.5 g / L NaCl, 0.33~0.88 g / L sodium citrate, and 0.15~0.246 g / L MgSO₄ . 7H2O.

[0101] In addition, Table 1 provides 18 fermentation medium formulations. Other components of the mediums provided in Table 1 include 12.5 g / L Na₂HPO₄. . 12H₂O, 2.2 g / L KH₂PO₄, 2.4 g / L NH₄Cl, 0.32 g / L NaCl, 0.46 g / L sodium citrate, and 0.18 g / L MgSO₄ . 7H2O.

[0102] Table 1. Formulation of Nicotinamide Ribose Fermentation Medium

[0103]

[0104] Microbial synthesis of nicotinamide ribose: The cells in the activated seed culture were collected and resuspended in 5 ml of fermentation medium. A 50 mL shake flask containing 5 mL of reaction solution was placed in a shaker at 37 °C and cultured for 28 h at 230 rpm.

[0105] Detection of nicotinamide ribose: The yield of nicotinamide ribose was determined by high performance liquid chromatography (HPLC) using a ZORBAX SB-C18 column (4.6 × 250 mm). The HPLC mobile phase consisted of methanol and 30 mL M KH₂PO₄ (pH 7.5, ratio 5:95, v / v), with a flow rate of 1 mL / min. A wavelength of 254 nm was selected.

[0106] (3) Test results

[0107] Table 2. Yield, yield, and production rate of nicotinamide ribose prepared via medium 6

[0108]

[0109] Nicotinamide ribose yield (g / L) is expressed as nicotinamide ribose per liter of fermentation broth.

[0110] Nicotinamide ribose yield (mol / mol NAM) is expressed as the amount of substance converted from 1 mol of nicotinamide (NAM) to nicotinamide ribose.

[0111] Nicotinamide ribose production rate (g / (Lh)) is defined as the mass of nicotinamide ribose produced per liter of culture medium per hour.

[0112] As shown in Table 2, compared with the strains provided in Comparative Examples 1 to 4, the test strain provided in Example 1 significantly improved the yield, production rate, and production speed of nicotinamide, indicating that the expression vector provided in Example 1 plays a decisive role in its biosynthesis of extracellular nicotinamide ribose.

[0113] Table 3. Yield, yield, and production rate of nicotinamide ribose prepared using different optimized culture media.

[0114]

[0115] As shown in Table 3, under different culture conditions, compared with the control strain WX-02 / pHY-Nampt provided in Comparative Example 1, which is a free expression strain of phosphoribosyltransferase, the nicotinamide ribose yield of the transporter protein and phosphoribosyltransferase co-expression strain WX-02 / pHY-Nampt-mdtL(Ec) provided in Example 1 can be increased by 13% to 23%, which is a significant advantage.

[0116] In one test case, the fermentation method was as follows:

[0117] (1) Seed culture: LB was used as the activation medium and cultured for 11 h at a temperature of 37℃ and a rotation speed of 230 rpm until the biomass reached 0.35 g / L.

[0118] (2) Preparation of nicotinamide ribose synthesis reaction solution: Collect the bacterial cells and resuspend them in 5 ml of nicotinamide ribose fermentation medium. The formulation of the nicotinamide ribose fermentation medium is as follows: 25 g / L glucose, 6 g / L nicotinamide (NAM), 15 g / L yeast extract, 12.5 g / L Na2HPO4 . 12H₂O, 2.2 g / L KH₂PO₄, 2.4 g / L NH₄Cl, 0.32 g / L NaCl, 0.46 g / L sodium citrate, and 0.21 g / L MgSO₄ . 7H2O, biomass is 1 g / L.

[0119] (3) Synthesis of nicotinamide ribose: A 50 mL shake flask containing 5 mL of reaction solution was placed in a shaker at 37°C and cultured for 28 h at a speed of 230 rpm.

[0120] (4) Detection of nicotinamide ribose: The yield of nicotinamide ribose was determined by high performance liquid chromatography (HPLC) using a ZORBAX SB-C18 column (4.6 x 250 mM). The HPLC mobile phase consisted of methanol and 30 mM KH2PO4 (pH 7.5, ratio 5:95, v / v), and the flow rate was 1 ml / min. A wavelength of 254 nm was selected.

[0121] The above-mentioned nicotinamide ribose fermentation was carried out using WX-02 / pHY-Nampt, WX-02 / pHY-Nampt-mdtL (Ec), BS168 / pHY-Nampt, BS168 / pHY-Nampt-mdtL (Ec), HZ-12 / pHY-Nampt, and HZ-12 / pHY-Nampt-mdtL (Ec), and the yield was measured. The data are as follows.

[0122] Table 4 shows that the introduction of the transporter protein MdtL (Ec) increased the yield of nicotinamide ribose by 19% in Bacillus licheniformis, by 24% in Bacillus subtilis 168, and by 34% in Bacillus amyloliquefaciens HZ-12.

[0123] Table 4. Effects of introducing mdtL (Ec) on nicotinamide ribose yield, productivity, and production rate in different Bacillus species.

[0124]

[0125] The above description is merely a preferred embodiment of this application, but the scope of protection of this application is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application.

Claims

1. An expression vector carrying a first coding gene for the exogenous protein MdtL and a second coding gene for the phosphoribosyltransferase NAMPT, wherein the nucleotide sequence of the first coding gene is shown in SEQ ID NO.1 and the nucleotide sequence of the second coding gene is shown in SEQ ID NO.2, wherein the expression vector, after being expressed by its host bacterium, secretes the phosphoribosyltransferase extracellularly to catalyze the synthesis of nicotinamide into nicotinamide ribose.

2. The expression vector according to claim 1, characterized in that, The first coding gene further includes a first promoter sequence and a first terminator sequence, the first promoter sequence being shown in SEQ ID NO.5 and the first terminator sequence being shown in SEQ ID NO.6; The second coding gene further includes a second promoter sequence and a second terminator sequence, the second promoter sequence being shown in SEQ ID NO.3 and the second terminator sequence being shown in SEQ ID NO.

4.

3. The expression vector according to claim 1, characterized in that, The expression vector is a plasmid vector; optionally, the plasmid vector is selected from pHY-P43, pHY300PLK, pBE2R(cm)-mCitrine, pBE2R(cm), pBE2R-mCitrine, pBE2R-P43-EGFP-HpaII-Signal-Hyg, pBE2R-EGFP, pBE2R, pMA0911, pHT43-SUMO-GFP, pWB980, pHT43-His, pHT43, pET-37b(+), pET-27b(+), pET-26b(+), pET-25b(+), pET-22b(+) or pNCMO2.

4. A recombinant Bacillus licheniformis carrying the expression vector according to any one of claims 1 to 3, wherein the expression vector is transcribed, translated and expressed by the Bacillus licheniformis during its growth using phosphoribosyltransferase.

5. A recombinant Bacillus subtilis strain carrying the expression vector according to any one of claims 1 to 3, wherein the expression vector is transcribed, translated and expressed by the Bacillus subtilis during its growth using phosphoribosyltransferase.

6. A recombinant Bacillus amyloliquefaciens carrying the expression vector according to any one of claims 1 to 3, wherein the expression vector is transcribed, translated and expressed by the Bacillus amyloliquefaciens during its growth process using phosphoribosyltransferase.

7. A method for constructing an expression vector, wherein the expression vector is as described in any one of claims 1 to 3, and the construction method comprises: Obtain nucleic acid molecules of the first coding gene and the second coding gene; Obtain the basic vector fragment of the expression vector; The nucleic acid molecule of the second encoding gene is ligated to the basic vector fragment, transformed into Escherichia coli, and screened to obtain a second positive transformant. The vector carrying the second encoding gene is then isolated from the second positive transformant. The vector carrying the second coding gene is amplified to obtain a linear vector fragment carrying the second coding gene. The nucleic acid molecule encoding the first gene was ligated to the linear vector fragment, transformed into E. coli, and the first positive transformant was obtained by screening.

8. A method for constructing recombinant Bacillus, comprising: Obtain the expression vector as described in any one of claims 1 to 3; The expression vector was transferred into Bacillus, and positive clones were obtained by screening, which are the recombinant Bacillus.

9. A method for producing phosphoribosyltransferase by fermentation, comprising: To obtain the recombinant Bacillus licheniformis as described in claim 4, or the recombinant Bacillus subtilis as described in claim 5, or the recombinant Bacillus amyloliquefaciens as described in claim 6; as well as Phosphoribotransferase is harvested from the fermentation broth of the recombinant Bacillus licheniformis as described in claim 4, or the recombinant Bacillus subtilis as described in claim 5, or the recombinant Bacillus amyloliquefaciens as described in claim 6.

10. A method for biosynthesizing nicotinamide ribose, comprising: To obtain the recombinant Bacillus licheniformis as described in claim 4, or the recombinant Bacillus subtilis as described in claim 5, or the recombinant Bacillus amyloliquefaciens as described in claim 6; Inoculated into a fermentation medium containing nicotinamide for fermentation culture; and Nicotinamide ribose was harvested from the supernatant of the fermentation broth.

Images