A kit for screening colorectal cancer and advanced adenoma

CN116515996BActive Publication Date: 2026-09-01SHANGHAI BIOTECHNOLOGY CORP +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202210065456.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-01-20
Publication Date
2026-09-01
Estimated Expiration
2042-01-20

AI Technical Summary

Technical Problem

目前市场上已有基于SHOX2基因甲基化检测的肺癌检测试剂盒,同时,已有研究证明,SHOX2基因启动子区域甲基化与前列腺癌、卵巢癌和神经胶质瘤等疾病相关,但是目前尚未发现与肠癌相关的报道

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116515996B_ABST
    Figure CN116515996B_ABST
Patent Text Reader

Abstract

This invention discloses a kit for screening colorectal cancer and advanced adenomas, comprising an SDC2-F upstream primer, an SDC2-R downstream primer, and an SDC2-P probe for detecting methylation at the cg25664438 site of the SDC2 gene; and an SHOX2-F upstream primer, an SHOX2-R downstream primer, and an SHOX2-P probe for detecting methylation at the cg18194945 site of the SHOX2 gene. Methylation at the cg25664438 and cg18194945 sites of the SHOX2 gene is correlated with colorectal cancer and advanced adenomas. This invention overcomes the shortcomings of existing early colorectal cancer detection technologies, such as low sensitivity and high false positive rates for single-site detection, and exhibits high sensitivity for advanced adenomas, thus facilitating the promotion of early colorectal cancer screening.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a kit for screening colorectal cancer and advanced adenomas. This kit is used for the combined detection of methylation at two sites in the human SDC2 and SHOX2 genes in fecal samples. Background Technology

[0002] In addition to factors such as lifestyle, diet, psychology and genetics, weak early screening is also an important reason for colorectal cancer (CRC). Only about 20 to 30% of colorectal cancer patients can be diagnosed at an early stage.

[0003] Numerous studies and practices have demonstrated that colorectal cancer screening and early diagnosis and treatment can effectively reduce colorectal cancer mortality. Colorectal cancer grows slowly and has a long latency period; 93% of colorectal cancers evolve from adenomas (a precancerous lesion). Studies show that it takes 5-7 years for an adenoma to develop into cancer, providing a significant timeframe for early diagnosis and treatment. Related data shows that patients with early-stage colorectal cancer (localized and regional colorectal cancer) have a good prognosis, with a 5-year survival rate exceeding 90%; however, the 5-year survival rate for stage IV colorectal cancer (metastatic colorectal cancer) is only 14%. If asymptomatic individuals and high-risk groups can detect cancer in its early stages, or even during precancerous lesions, and receive timely treatment, it will significantly extend their lifespan, reduce related treatment costs, and alleviate the financial burden on ordinary families.

[0004] Currently, the most commonly used methods for screening colorectal cancer in clinical practice include electronic colonoscopy and fecal occult blood test (FOBT). Both of these methods have disadvantages such as being invasive and having low positive detection rates, making them unsuitable for widespread early screening.

[0005] Studies have found that methylation sites associated with colorectal cancer can serve as important evidence for early screening. As early as 2014, the first FDA-approved fecal genetic testing product was included in the US Medicare catalog. The USPSTF has included fecal DNA testing in its new colorectal cancer screening guidelines, listing it alongside fecal occult blood tests and colonoscopy as one of the three recommended screening methods. However, single-site testing has a high false-negative rate and is prone to missed detections. As described in patent CN201510195270.7, the specificity of detecting Septin9 alone in 218 clinical samples (53 samples with no abnormalities in the intestine, 50 samples with non-neoplastic lesions, 39 samples with non-advanced adenomas, 35 high-risk low-grade samples, 12 samples with high-grade lesions, 2 stage I samples, 6 stage II samples, 15 stage III samples, 4 stage IV samples, and 2 samples with unknown stage) was 94.3%, and the sensitivity was 79.3%. However, its sensitivity and specificity for detecting adenomas and early colorectal cancer were not mentioned. Similarly, as described in patent CN201810502387.9, the sensitivity of detecting NDRG4 alone in colorectal cancer was 65.3%, and the specificity was 97.2%; the sensitivity for advanced adenomas was 58.9%, and the specificity was 96.1%. However, its sensitivity for detecting adenomas and early colorectal cancer was relatively low.

[0006] Regarding multi-site combined detection, Cologuard, the first FDA-approved fecal DNA test kit for colorectal cancer, targets seven KRAS gene mutation sites, methylation sites of the NDRG4 and BMP3 genes, β-actin, and hemoglobin. It has a sensitivity of 92% for colorectal cancer detection, but only 87% specificity. This demonstrates that multi-site combined detection can effectively improve detection sensitivity; however, this product requires the detection of 11 molecular targets, making the detection method complex and resulting in relatively low specificity.

[0007] The Syndecan-2 (SDC2) gene, located on human chromosome 8, encodes the Syndecan-2 protein. Studies have found that this protein mediates functions such as adhesion of colorectal cancer cells and is closely related to their proliferation. Research has confirmed that, compared to normal colorectal tissue, the SDC2 gene exhibits high levels of methylation in colorectal cancer at different stages, suggesting its clinical value in colorectal cancer detection. Currently, there are several commercially available SDC2 gene detection kits, but the detection sites are concentrated in known single regions.

[0008] The Short Stature Homobox 2 (SHOX2) gene's expression regulation is closely related to organ development. Currently, there are commercially available lung cancer detection kits based on SHOX2 gene methylation detection. Furthermore, studies have demonstrated that SHOX2 gene promoter region methylation is associated with diseases such as prostate cancer, ovarian cancer, and glioma; however, no reports of its association with colorectal cancer have been found to date. Summary of the Invention

[0009] To address the key challenges of early screening and diagnosis of advanced adenomas and colorectal cancer by developing a combined detection method that utilizes fewer detection sites, is convenient to use, and simultaneously ensures superior sensitivity and specificity, this invention discloses a kit for screening colorectal cancer and advanced adenomas. This kit provides detection of two novel sites strongly associated with colorectal cancer and advanced adenomas. The specific technical solution is as follows:

[0010] A kit for screening colorectal cancer and advanced adenoma comprises an SDC2-F upstream primer, an SDC2-R downstream primer, an SDC2-P probe, an SHOX2-F upstream primer, an SHOX2-R downstream primer, and an SHOX2-P probe. The SDC2-F upstream primer, the SDC2-R downstream primer, and the SDC2-P probe are used to detect methylation at the cg25664438 site of the SDC2 gene. The SHOX2-F upstream primer, the SHOX2-R downstream primer, and the SHOX2-P probe are used to detect methylation at the cg18194945 site of the SHOX2 gene. Methylation at the cg25664438 site of the SDC2 gene and the cg18194945 site of the SHOX2 gene are associated with colorectal cancer and advanced adenoma.

[0011] In some embodiments, the corresponding nucleotide sequences of the SDC2-F upstream primer, the SDC2-R downstream primer, and the SDC2-P probe are designed based on the nucleotide sequence of the methylation site after sulfite modification of the SDC2 gene; the nucleotide sequence of the methylation site after sulfite modification of the SDC2 gene is shown in SEQ ID NO.7;

[0012] The corresponding nucleotide sequences of the SHOX2-F upstream primer, the SHOX2-R downstream primer, and the SHOX2-P probe are designed based on the nucleotide sequence of the methylation site after sulfite modification of the SHOX2 gene; the nucleotide sequence of the methylation site after sulfite modification of the SHOX2 gene is shown in SEQ ID NO.8.

[0013] In some embodiments, the primer-probe combination consisting of the upstream primer SDC2-F, the downstream primer SDC2-R, and the probe SDC2-P is selected from any one of combinations a1)-a4): a1) SDC2-F1, SDC2-R2, and SDC2-P1; a2) SDC2-F1, SDC2-R1, and SDC2-P1; a3) SDC2-F1, SDC2-R6, and SDC2-P3; a4) SDC2-F1, SDC2-R7, and SDC2-P3; wherein the nucleotide sequence of SDC2-F1 is as shown in SEQ ID NO.1, the nucleotide sequence of SDC2-R1 is as shown in SEQ ID NO.2, the nucleotide sequence of SDC2-P1 is as shown in SEQ ID NO.3, the nucleotide sequence of SDC2-R2 is as shown in SEQ ID NO.15, and the nucleotide sequence of SDC2-R6 is as shown in SEQ ID NO.15. The nucleotide sequence of SDC2-P3 is shown in NO.16, the nucleotide sequence of SDC2-R7 is shown in SEQ ID NO.17, and the nucleotide sequence of SDC2-R7 is shown in SEQ ID NO.18.

[0014] The primer-probe combination consisting of the SHOX2-F upstream primer, the SHOX2-R downstream primer, and the SHOX2-P probe is selected from any one of combinations b1)-b3): b1) SHOX2-F2, SHOX2-R1, and SHOX2-P2; b2) SHOX2-F2, SHOX2-R2, and SHOX2-P2; b3) SHOX2-F3, SHOX2-R5, and SHOX2-P2; wherein the nucleotide sequence of SHOX2-F3 is shown in SEQ ID NO.4, the nucleotide sequence of SHOX2-R5 is shown in SEQ ID NO.5, the nucleotide sequence of SHOX2-P2 is shown in SEQ ID NO.6, the nucleotide sequence of SHOX2-F2 is shown in SEQ ID NO.19, the nucleotide sequence of SHOX2-R1 is shown in SEQ ID NO.20, and the nucleotide sequence of SHOX2-R2 is shown in SEQ ID NO.21.

[0015] In some embodiments, a positive control is also included; the positive control includes a plasmid containing the nucleotide sequence of the methylation site of the SDC2 gene after sulfite modification and the nucleotide sequence of the methylation site of the SHOX2 gene after sulfite modification, and / or a colorectal cancer cell line; the nucleotide sequence of the methylation site of the SDC2 gene after sulfite modification is shown in SEQ ID NO.7; the nucleotide sequence of the methylation site of the SHOX2 gene after sulfite modification is shown in SEQ ID NO.8.

[0016] In some embodiments, the vector plasmid containing the nucleotide sequences of the methylation sites of the SDC2 gene and the methylation sites of the SHOX2 gene after sulfite modification is selected from pUC57, pUC57-Kan, pUC57-Simple, pUC57-mini, pUC18, and pUC19.

[0017] In some embodiments, the colorectal cell lines are selected from positive cell lines SW48, HCT116, LoVo, SW480, and SW620. All positive cell lines are derived from the American Type Culture Collection (ATCC).

[0018] In some implementations, a negative control is also included; the negative control is normal human genetic DNA.

[0019] In some implementations, primer pairs and probes for a quality control gene are also included; the quality control gene is actin.

[0020] Further, the quality control gene is β-actin. The primer pair for the quality control gene is a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO. 23, the nucleotide sequence of the reverse primer is shown in SEQ ID NO. 24, and the nucleotide sequence of the probe for the quality control gene is shown in SEQ ID NO. 25.

[0021] In some embodiments, the reporter fluorescent group of the quality control gene probe, the reporter fluorescent group of the SDC2-P probe, and the reporter fluorescent group of the SHOX2-P probe are each independently selected from one or more of FAM, VIC, CY5, CY3, JOE, and HEX; the reporter quencher group of the quality control gene probe, the reporter quencher group of the SDC2-P probe, and the reporter quencher group of the SHOX2-P probe are each independently selected from one or more of MGB, BHQ1, BHQ2, and TAMRA.

[0022] In some implementations, the results of qPCR using the SDC2-F upstream primer, the SDC2-R downstream primer, the SDC2-P probe, the SHOX2-F upstream primer, the SHOX2-R downstream primer, and the SHOX2-P probe are further defined as follows: A Ct value ≥ 50 for SDC2 indicates negative methylation at the cg25664438 site; a Ct value < 50 for SDC2 indicates positive methylation at the cg25664438 site; a Ct value ≥ 39.64 for SHOX2 indicates negative methylation at the cg18194945 site; and a Ct value < 39.64 for SHOX2 indicates positive methylation at the cg18194945 site. Samples with positive methylation at site cg18194945 and / or positive methylation at site cg18194945 are classified as positive for combined methylation detection; samples with negative methylation at sites cg25664438 and cg18194945 are classified as negative for combined methylation detection; the evaluation result corresponding to positive combined methylation detection is positive for colorectal cancer and advanced adenoma; the evaluation result corresponding to negative combined methylation detection is negative for colorectal cancer and advanced adenoma.

[0023] In some implementations, the result determination criteria further include: a Ct value ≤ 38 for the quality control gene indicates that the amount of DNA template loaded is within the allowable range, and the result is reliable; a Ct value > 38 for the quality control gene indicates that the amount of DNA template loaded is outside the allowable range, and the result is unreliable. The quality control gene is actin. Further, the quality control gene is β-actin.

[0024] In some embodiments, the qPCR is real-time fluorescent qPCR, with the following reaction conditions: 96°C pre-denaturation for 3 minutes; 15 cycles: 95°C denaturation for 15 seconds, 70°C annealing and extension for 20 seconds, 64°C annealing and extension for 20 seconds, and 72°C extension for 10 seconds; 35 cycles: 95°C denaturation for 15 seconds, 70°C annealing and extension for 20 seconds, 60°C annealing and extension for 34 seconds, and 72°C extension for 10 seconds; and fluorescence signal is detected during annealing in all 35 cycles.

[0025] In some implementations, the final concentration of each primer in the qPCR is 0.2–0.3 μM, and the final concentration of the probe is 0.2 μM.

[0026] In some implementations, the qPCR amplification system is as follows: 20 μl of 2×Premix Ex Taq (Probe qPCR), 0.8 μl of 50×RoxⅡ, final concentration of each primer 0.2–0.3 μM, final concentration of probe 0.2 μM, DNA template >10 ng, and water to a final volume of 40 μl.

[0027] In some implementations, other reagents required for the qPCR reaction are also included, such as polymerase, buffer, and dNTPs.

[0028] In some embodiments, the polymerase is 2×Premix Ex Taq (Probe qPCR); the buffer is 50×Rox II. 2×Premix Ex Taq (Probe qPCR) contains dNTPs.

[0029] This invention overcomes the shortcomings of existing early colorectal cancer detection technologies, such as low sensitivity and high false positive rates for single-site detection, by providing a set of primers and probes for the combined detection of methylation of the SDC2 and SHOX2 genes. The test sample is a fecal sample, which can be collected non-invasively and is suitable for clinical screening. Its sensitivity for advanced adenomas reaches 71.43%, significantly higher than the sensitivity of existing technologies for advanced adenomas (the traditional fecal occult blood test (FIT) for colorectal cancer clinical screening has a sensitivity of 30.9% for adenomas, and Cologuard, the only colorectal cancer early screening product currently approved by the US FDA (Food and Drug Administration), has a sensitivity of 42.4% for advanced adenomas). Therefore, it is highly beneficial for the promotion of early colorectal cancer screening.

[0030] The beneficial effects of this invention include:

[0031] 1. This invention targets fecal samples, making sample collection convenient, non-invasive, and with good patient compliance;

[0032] 2. The results of the examples show that the combined detection of sites improves the sensitivity of colorectal cancer detection. In stool samples from cancer patients, the sensitivity of the combined detection results is 94.74%, and the specificity is 95.45%.

[0033] 3. The results of the example show that the combined detection of sites also improves the sensitivity of advanced adenomas. In stool samples from patients with advanced adenomas, the sensitivity of the combined detection results was 71.43% and the specificity was 83.33%.

[0034] 4. The test kit takes about 120 minutes to complete. It can be completed using general testing equipment. The procedure is simple and suitable for large-scale sample screening in clinical settings and health check centers.

[0035] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention. Attached Figure Description

[0036] Figure 1 This is the sorting result of all methylation sites of the SDC2 and SHOX2 genes by the random forest algorithm in Embodiment 1 of the present invention.

[0037] Figure 2 This is the ROC curve of the site screening machine learning in Embodiment 1 of the present invention.

[0038] Figure 3 This is a box plot showing the difference in Ct values ​​of the SDC2 gene locus between cancerous and adjacent tissues in Example 3 of this invention.

[0039] Figure 4 This is a box plot showing the difference in Ct values ​​of the SHOX2 gene locus between cancerous and adjacent tissues in Example 3 of this invention.

[0040] Figure 5 This is a box plot showing the difference in Ct values ​​of another preferred site of the SDC2 gene in cancerous and adjacent tissues in Comparative Example 1 of this invention.

[0041] Figure 6 This is a box plot showing the difference in Ct values ​​of another site of the SHOX2 gene in cancerous and adjacent tissues in Comparative Example 2 of this invention.

[0042] Figure 7 This is the qPCR amplification curve for detecting patient fecal samples in Example 4 of the present invention.

[0043] Figure 8 This is the qPCR amplification curve for detecting fecal samples from healthy individuals in Example 4 of this invention. Detailed Implementation

[0044] To make the technical means, inventive features, objectives, and effects of the invention readily understandable, the invention is further illustrated below with reference to specific figures. However, the invention is not limited to the embodiments described below.

[0045] It should be noted that the structures, proportions, sizes, etc., illustrated in the accompanying drawings of this specification are only used to complement the content disclosed in the specification for those skilled in the art to understand and read, and are not intended to limit the conditions under which the present invention can be implemented. Therefore, they have no substantial technical significance. Any modifications to the structure, changes in the proportions, or adjustments to the size, without affecting the effects and objectives that the present invention can produce, should still fall within the scope of the technical content disclosed in the present invention.

[0046] Example 1: Screening for methylation sites in early colorectal cancer screening

[0047] The key and challenge of this invention lies in finding two sites that can both ensure screening specificity and improve detection sensitivity. To determine this combination of sites, during the research and development process, methylation sites from nearly 13,000 samples across 33 tumor types were screened using a database. The specific steps are as follows:

[0048] 1. 453 samples (408 tumor samples and 45 normal samples) from the Colorectal adenocarcinoma (COADREAD) database of The Cancer Genome Atlas (TCGA) were selected. A Wilcoxon rank-sum test was performed on 485,578 loci, with threshold conditions set as follows: p-value < 0.01, mean β ≥ 0.2, and Δβ ≥ 0.2. 19,862 loci met the threshold conditions.

[0049] 2. Differential analysis was performed on sample data (751 normal samples) from the population blood methylation databases (GSE40279 and GSE41169), and sites with methylation differences greater than 25%, i.e., 15,404 sites, were retained.

[0050] 3. Based on descending order of β difference (Δβ) ≥ 0.5, β difference (Δβ) ≥ 0.3, and β difference (Δβ) ≥ 0.2, CpG sites (cytosine-phosphate-guanine sites, i.e., sites in the DNA sequence where cytosine is immediately followed by guanine) with high methylation levels, associated with genes of interest, were screened from 453 TCGA database samples. DNA methylation in vertebrates generally occurs at CpG sites.

[0051] 4. To improve the sensitivity and specificity of methylation sites, differential analysis was performed with different types of cancer, and 17 CpG sites were selected for joint prediction detection, including SDC2 and SHOX2.

[0052] 5. To further enhance clinical relevance and streamline CpG loci, the random forest algorithm package in R language was used for loci sorting. Figure 1 The joint ROC curve was calculated to evaluate the site. Figure 2 One CpG site was selected from each of the SDC2 and SHOX2 genes (Table 1): cg18194945 (SHOX2) and cg25664438 (SDC2).

[0053] Table 1. SDC2 and SHOX2 sites selected in this invention.

[0054]

[0055] Example 2: Probe and Primer Design and Screening

[0056] This invention utilizes plasmids containing nucleotide sequences of methylation sites in the SDC2 and SHOX2 genes after sulfite modification, and DNA from the positive cell line SW48, as templates to construct a real-time fluorescent qPCR detection system for SDC2 and SHOX2 gene methylation. FAM and VIC are used as the fluorescent signal detection targets. Through optimized combinations of primers for SDC2 and SHOX2 gene methylation and optimization of the fluorescent probe detection system, rapid and accurate detection is achieved. The specific steps are as follows:

[0057] The plasmid is a synthetic plasmid obtained by inserting a pre-designed target gene sequence fragment into a molecular cloning vector plasmid via GenScript. The target gene sequence includes the nucleotide sequences of the methylation sites of the SDC2 gene and the SHOX2 gene after sulfite modification.

[0058] The nucleotide sequence of the methylation site after sulfite modification of the SDC2 gene (SEQ ID No. 7, containing the cg25664438 site):

[0059] GGAAGGATTTGGGAGAATGGGAAATATTTTTATTATATATTTATTATATTAA TTATTTTTTTTTTTAAAATGTAATTTTTATGAATTGGCGATTTATGAATATTTTATATTGTTTGAAAGTATTTTATATTTTTTTTTTTTTTTAATTTAAGTAGTTTTTT TTTATTGGTCGAATTTTTAAGGTAGAAAAGTTATATACGTTTTTCGTTTTTTTATTAATTGTTTTTTAGAAAAGGGAAAGTGAAGAAGGGAAAGAGAAAAGATAAC GGGGAAGAAAAGAGTATAGAGGAGAGGAAAAGTGGGGAGAGAAAGGAAGAAAAGGATTGAGAAAACGTAGGAGTTTTGGTTTGTCGG

[0060] The nucleotide sequence of the methylation site after sulfite modification of the SHOX2 gene (SEQ ID No. 8, containing the cg18194945 site):

[0061] ATTAGATATTAGAAGTATTATTTTTCGAGTGTGTTTTTTAAGTTTTTTTTTA ATTTTAGGTTTTTTGTTTTTTGGGTTTTCGATTTTTTGGTAGTTGGGTATTTGTATTCGGGTTTTCGATAGGTTTAGTCGTTGGTTTAGTTTTTTTTCGTATGAAGGC GTCGGGATAGTGGGTTTCGTTAAAAAGTTTTTTTAGTTTATTGAGTTGTTTTAGGGTGAAATTGGTTCGATTTCGTTTTTGTTTGATTTTGGTTTGGTTTTCGTTTTT TATTTTTTTCGTATTTTTTTTGCGATTTTTTAGTTTCGGGGATATTGGAGGGGGT ATTTTAGCGGGGTTATACGTGTATTTATACGAATAT

[0062] The molecular cloning vector plasmid used was pUC57.

[0063] The positive cell line SW48 was obtained from the American Type Culture Collection (ATCC).

[0064] 1. For the detection of SDC2 and SHOX2 gene methylation, 21 primer pairs and 3 probes were designed using Primer 5 software. For positive cell lines, tissues, or feces (e.g., Examples 2, 3, 4 and Comparative Examples 1 and 2), actin was used as a quality control gene (or internal reference gene). Primers Actin-F and Actin-R were used as quality control primers, and probe Actin-P was used as a quality control probe. Commonly used actins include β-actin, but are not limited to β-actin; α-actin, γ-actin, etc., can also be used.

[0065] Quality control gene forward primer (Actin-F): 5'-GGTATTGTCGATAGGA-3' (SEQ ID NO.23)

[0066] Quality control gene reverse primer (Actin-R): 5'-GTAGGAAAGATATTTATT-3' (SEQ ID NO.24)

[0067] The quality control gene probe (Actin-P) is:

[0068] 5'-ATTTCGTAAGGAGATTATTGTTTTGTAGTG-3'(SEQ ID NO.25)

[0069] 2. Using 1×10 4 Using the synthesized plasmid as a template, real-time fluorescence qPCR amplification (total volume 40 μl) was performed using different primer and probe combinations according to the following amplification system:

[0070] 20 μl of 2×Premix Ex Taq (Probe qPCR), 0.8 μl of Rox II (50×), final concentration of each primer 0.2–0.3 μM, final concentration of probe 0.2 μM, DNA template, and water to bring the total volume to 40 μl.

[0071] The 2×Premix Ex Taq (Probe qPCR) and Rox II (50×) used in the real-time fluorescence qPCR amplification were from TAKARA.

[0072] The reaction conditions for real-time fluorescence qPCR are as follows:

[0073] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0074] The primer-probe combinations and detection results are shown in Table 3. Four sets of primer-probe combinations for SDC2 and four sets for SHOX2 were selected for a second round of probe and primer screening in positive cell lines.

[0075] Table 3. Probe and primer combinations and screening results for synthetic plasmids.

[0076]

[0077]

[0078] 3. Using 10 ng of DNA from the positive cell line SW48 as a template, qPCR amplification was performed using the four sets of primer and probe combinations for SDC2 and four sets of primer and probe combinations for SHOX2 selected in the previous step. The qPCR system and reaction conditions were the same as in the previous step.

[0079] The primer-probe combination and detection results are shown in Table 4.

[0080] Table 4. Probe and primer combinations and screening results for positive cell lines.

[0081]

[0082] Based on the Ct value and whether the amplification curve is S-shaped, SDC2-F1, SDC2-R1, and SDC2-P1 are preferred primers and probes for the SDC2 gene; SHOX2-F3, SHOX2-R5, and SHOX2-P2 are preferred primers and probes for the SHOX2 gene. The probe and primer sequences are as follows:

[0083] Preferred probe primers for SDC2:

[0084] SDC2-F1: 5'-GTAATTTTTATGAATTGGCGATTTATGA-3' (SEQ ID NO.1)

[0085] SDC2-R1: 5'-TCTTTCCCTTCTTCACTTTCCCT-3' (SEQ ID NO.2)

[0086] SDC2-P1: (SEQ ID NO.3, cg25664438 is circled in a box)

[0087] Preferred probe primers for SHOX2:

[0088] SHOX2-F3: 5'-TGAAGGCGTCGGGATAGTG-3' (SEQ ID NO.4)

[0089] SHOX2-R5: 5'-GAAAACCAAACCAAAATCAAACA-3' (SEQ ID NO.5)

[0090] SHOX2-P2: (SEQ ID NO.6, cg18194945 is circled in a box)

[0091] The other sequences in Table 4 are as follows:

[0092] SDC2-R2: 5'-TCCCTCTCTCCTCTATACTCTTTTCTTCC-3' (SEQ ID NO.15)

[0093] SDC2-R6: 5'-CCCGTTATCTTTCTCTTCC-3' (SEQ ID NO.16)

[0094] SDC2-P3: 5'-AGTTATATACGTTTTTC-3' (SEQ ID NO.17)

[0095] SDC2-R7: 5'-CCGTTATCTTTCTCTTCCCT-3' (SEQ ID NO.18)

[0096] SHOX2-F2: 5'-GGATAGTGGGTTTCGTTAAAAAGTTT-3' (SEQ ID NO.19)

[0097] SHOX2-R1: 5'-CCTCCAATATCCCCGAAACTAA-3' (SEQ ID NO.20)

[0098] SHOX2-R2: 5'-CGAAAACCAAACCAAAATCAAAC-3' (SEQ ID NO.21)

[0099] SHOX2-R6: 5'-AACGAAAACCAAACCAAAATCA-3' (SEQ ID NO.22)

[0100] 4. Sensitivity analysis: The synthesized plasmid was diluted from 2000 copies to 5 copies, and then used as a template for detection. The results (expressed as Ct values) show that the real-time fluorescent qPCR method of the present invention has high sensitivity. The primers can detect different copy numbers of the corresponding synthesized plasmid, and 5 copies / 40 μL can be detected (as shown in Table 5).

[0101] Table 5 Results of gradient dilution of synthesized plasmids

[0102]

[0103]

[0104] Example 3: Tissue Sample Detection

[0105] The preferred primer-probe combination and real-time fluorescence qPCR reaction system of this invention are used to detect cancerous tissue and its paired adjacent normal tissue samples.

[0106] The steps are as follows:

[0107] 1. Sample processing, DNA extraction and transformation:

[0108] DNA was extracted from tissue cells using a cell DNA extraction kit (purchased from QIAGEN). For specific procedures, please refer to the kit's instruction manual.

[0109] 2. Sulfite modification:

[0110] The extracted cellular DNA was modified with sulfite using the EZ DNA methylation kit (purchased from ZYMO RESEARCH). For specific procedures, please refer to the kit instructions.

[0111] 3. Perform qPCR amplification according to the following amplification system (total volume 40 μl).

[0112] 20 μl of 2×Premix Ex Taq (Probe qPCR), 0.8 μl of Rox II (50×), final concentrations of each primer (0.2–0.3 μM), final probe concentration (0.2 μM), and DNA template (>10 ng) were added, and water was added to bring the volume to 40 μl. The sulfite-modified cellular DNA obtained in step 2 was used as the template.

[0113] The 2×Premix Ex Taq (Probe qPCR) and Rox II (50×) used in the qPCR amplification were from TAKARA.

[0114] The reaction conditions for real-time fluorescence qPCR are as follows:

[0115] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0116] 4. Detect the fluorescence signal and use the Ct value as the standard for judging the result.

[0117] In real-time fluorescence qPCR amplification, the fluorescence signal of the reaction system was detected. If the number of cycles (Ct) required for the fluorescence signal of the internal reference gene (actin) to reach the set threshold was ≤38, it indicated that the amount of sampled DNA was within the allowable range, and the result was reliable. The number of cycles (Ct) required for the fluorescence signals of SDC2 and SHOX2 to reach the set threshold was used as the standard for judging positive and negative results. Specifically, for SDC2, a Ct value ≥50 was considered negative, and a Ct value <50 was considered positive. For SHOX2, a Ct value ≥39.64 was considered negative, and a Ct value <39.64 was considered positive. In this example, the detection results of 8 colorectal cancer tissues are shown in Table 6, all of which were positive.

[0118] 5. The test results (Table 6) show that the sensitivity of individual site detection in the tissue samples of the present invention is 100%, and the sensitivity of combined detection results is 100%. Figure 3 This indicates that there are significant differences in methylation expression of the SDC2 gene between cancerous and adjacent normal tissues. Figure 4 This indicates that there are significant differences in methylation expression of the SHOX2 gene between cancerous and adjacent tissues.

[0119] Table 6. Results of tissue sample testing

[0120] Tissue sample number Actin SDC2 SHOX2 Result determination 1 30.77 36.68 36.08 Positive 2 29.78 32.67 34.59 Positive 3 29.95 31.37 33.44 Positive 4 30.45 35.71 34.65 Positive 5 29.60 34.06 32.39 Positive 6 32.09 35.10 34.47 Positive 7 30.20 31.73 33.46 Positive 8 31.24 28.90 31.66 Positive

[0121] Comparative Example 1

[0122] The ranking results are based on the importance of machine learning features. Figure 1 Primers and probes were also optimized for the second-ranked site cg04261408 of the SDC2 gene, and the optimized sequences are as follows:

[0123] SDC2-1408-F: 5'-AGGGTGTTTGAAGTTACGAGAGGA-3' (SEQ ID NO.9)

[0124] SDC2-1408-R: 5'-AAATAACCGAACGAACGCAT-3' (SEQ ID NO.10)

[0125] SDC2-1408-P: (SEQ ID NO.11)

[0126] The optimal primer-probe combination and real-time fluorescence qPCR reaction system were used to detect cancerous tissue and its paired adjacent normal tissue samples.

[0127] The steps are as follows:

[0128] 1. Sample processing, DNA extraction and transformation:

[0129] DNA was extracted from tissue cells using a cell DNA extraction kit (purchased from QIAGEN). For specific procedures, please refer to the kit's instruction manual.

[0130] 2. Sulfite modification:

[0131] The extracted cellular DNA was modified with sulfite using the EZ DNA methylation kit (purchased from ZYMO RESEARCH). For specific procedures, please refer to the kit instructions.

[0132] 3. Perform qPCR amplification according to the following amplification system (total volume 40 μl).

[0133] 20 μl of 2×Premix Ex Taq (Probe qPCR), 0.8 μl of Rox II (50×), final concentrations of each primer (0.2–0.3 μM), final probe concentration (0.2 μM), and DNA template (>10 ng) were added, and water was added to bring the volume to 40 μl. The sulfite-modified cellular DNA obtained in step 2 was used as the template.

[0134] The 2×Premix Ex Taq (Probe qPCR) and Rox II (50×) used in the qPCR amplification were from TAKARA.

[0135] The reaction conditions for real-time fluorescence qPCR are as follows:

[0136] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0137] 4. Detect the fluorescence signal and use the Ct value as the standard for judging the result.

[0138] The fluorescence signal of the reaction system in the fluorescent qPCR amplification was detected. When the fluorescence signal of the internal reference gene (β-actin) reached a set threshold (Ct≤38), it indicated that the amount of DNA loaded was within the allowable range and the result was reliable. A Ct value ≥50 for SDC2 was considered negative; a Ct value <50 was considered positive.

[0139] In this comparative study, the test results of 8 colorectal cancer tissues are shown in Table 7, with 7 cases being positive and 1 case being negative.

[0140] 5. The detection results (Table 7) show that the sensitivity of site-specific detection in tissue samples according to the present invention is 87.5%, although its box plot ( Figure 5 The differences are too large, so it is not considered a preferred site at this time.

[0141] Table 7. Tissue sample test results (cg04261408)

[0142] Tissue sample serial number Actin cg04261408 Result determination 1 29.73 No Ct Negative 2 28.72 28.29 Positive 3 26.57 27.65 Positive 4 28.42 28.92 Positive 5 28.88 31.57 Positive 6 28.62 30.78 Positive 7 27.98 28.87 Positive 8 26.89 32.99 Positive

[0143] Comparative Example 2

[0144] The ranking results are based on the importance of machine learning features. Figure 1 Primers and probes were also optimized for the second-ranked site cg12993163 of the SHOX2 gene, and the optimized sequences are as follows:

[0145] SHOX2-3163-F:5'-TTTCGTTTCGTTTGTTCGA-3'(SEQ ID NO.12)

[0146] SHOX2-3163-R:5'-CCTACCTTCTAACCCGACTTGA-3'(SEQ ID NO.13)

[0147] SHOX2-3163-P: (SEQ ID NO.14)

[0148] The optimal primer-probe combination and real-time fluorescence qPCR reaction system were used to detect cancerous tissue and its paired adjacent normal tissue samples.

[0149] The steps are as follows:

[0150] 1. Sample processing, DNA extraction and transformation:

[0151] DNA was extracted from tissue cells using a cell DNA extraction kit (purchased from QIAGEN). For specific procedures, please refer to the kit's instruction manual.

[0152] 2. Sulfite modification:

[0153] The extracted cellular DNA was sulfite-modified using the EZ DNA methylation kit (purchased from ZYMO RESEARCH). Specific procedures were followed according to the kit's instruction manual. The sulfite-modified cellular DNA obtained in step 2 was used as a template.

[0154] 3. Perform qPCR amplification according to the following amplification system (total volume 40 μl).

[0155] 20 μl of 2×Premix Ex Taq (Probe qPCR), 0.8 μl of Rox II (50×), final concentration of each primer 0.2–0.3 μM, final concentration of probe 0.2 μM, DNA template >10 ng, and water to bring the total volume to 40 μl.

[0156] The 2×Premix Ex Taq (Probe qPCR) and Rox II (50×) used in the qPCR amplification were from TAKARA.

[0157] The reaction conditions for real-time fluorescence qPCR are as follows:

[0158] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0159] 4. Detect the fluorescence signal and use the Ct value as the standard for judging the result.

[0160] The fluorescence signal of the reaction system in real-time fluorescent qPCR amplification is detected. When the fluorescence signal of the internal reference gene (β-actin) reaches a set threshold (Ct≤38), it indicates that the amount of DNA loaded is within the allowable range and the result is reliable. A Ct value ≥39.64 for SHOX2 is considered negative; a Ct value <39.64 is considered positive.

[0161] In this comparative study, the test results of 8 colorectal cancer tissues are shown in Table 8, all of which were positive.

[0162] 5. The detection results (Table 8) show that although the sensitivity of individual site detection in the tissue samples of this invention is 100%, the difference in methylation expression at the cg12993163 site of the SHOX2 gene between cancerous and adjacent tissues is not significant. Figure 6 Therefore, it is not considered a preferred site.

[0163] Table 8. Tissue sample test results (cg12993163)

[0164]

[0165]

[0166] Example 4

[0167] The primer-probe combination and real-time fluorescence qPCR reaction system of the present invention were used to detect fecal samples from 133 clinical colorectal cancer patients, 42 patients with advanced adenoma, and 33 healthy individuals (see Tables 9-11).

[0168] Table 9 Clinical diagnostic information from fecal samples for colorectal cancer

[0169]

[0170]

[0171]

[0172]

[0173] Table 10 Clinical diagnostic information from stool samples of advanced adenomas

[0174] serial number Clinical diagnosis Sample type AF-001 Sigmoid colon tubular adenoma fecal samples AF-002 Precancerous lesions fecal samples AF-003 tubular adenoma of the right colon fecal samples AF-004 Rectal adenoma with moderate dysplasia fecal samples AF-005 Precancerous lesions fecal samples AF-006 High-grade intraepithelial neoplasia fecal samples AF-007 Precancerous lesions fecal samples AF-008 Precancerous lesions fecal samples AF-009 Precancerous lesions fecal samples AF-010 Precancerous lesions fecal samples AF-011 Precancerous lesions fecal samples AF-012 Transverse colonic tubular adenoma with mild dysplasia fecal samples AF-013 Low-grade intraepithelial neoplasia of rectal adenoma fecal samples AF-014 Precancerous lesions fecal samples AF-015 High-grade intraepithelial neoplasia of the right colon fecal samples AF-016 Mild dysplasia of tubular adenoma epithelium in the left colon fecal samples AF-017 Moderate to severe dysplasia of the epithelium of sigmoid colon adenoma fecal samples AF-018 Precancerous lesions fecal samples AF-019 Precancerous lesions fecal samples AF-020 Rectal adenoma, high-grade intraepithelial neoplasia fecal samples AF-021 Precancerous lesions fecal samples AF-022 Precancerous lesions fecal samples AF-023 benign diseases fecal samples AF-024 Precancerous lesions fecal samples AF-025 Precancerous lesions fecal samples AF-026 Precancerous lesions fecal samples AF-027 Precancerous lesions fecal samples AF-028 Precancerous lesions fecal samples AF-029 Precancerous lesions fecal samples AF-030 benign diseases fecal samples AF-031 benign diseases fecal samples AF-032 benign diseases fecal samples AF-033 benign diseases fecal samples AF-034 benign diseases fecal samples AF-035 benign diseases fecal samples AF-036 benign diseases fecal samples AF-037 benign diseases fecal samples AF-038 benign diseases fecal samples AF-039 Precancerous lesions fecal samples AF-040 Precancerous lesions fecal samples AF-041 Precancerous lesions + Post-rectal cancer surgery fecal samples AF-042 Benign disease (hyperplastic polyps) fecal samples

[0175] Table 11 Clinical Diagnostic Information from Fecal Samples of Healthy Individuals

[0176] serial number Clinical diagnosis Sample type NF-001 healthy people fecal samples NF-002 healthy people fecal samples NF-003 healthy people fecal samples NF-004 healthy people fecal samples NF-005 healthy people fecal samples NF-006 healthy people fecal samples NF-007 healthy people fecal samples NF-008 healthy people fecal samples NF-009 healthy people fecal samples NF-010 healthy people fecal samples NF-011 healthy people fecal samples NF-012 healthy people fecal samples NF-013 healthy people fecal samples NF-014 healthy people fecal samples NF-015 healthy people fecal samples NF-016 healthy people fecal samples NF-017 healthy people fecal samples NF-018 healthy people fecal samples NF-019 healthy people fecal samples NF-020 healthy people fecal samples NF-021 healthy people fecal samples NF-022 healthy people fecal samples NF-023 healthy people fecal samples NF-024 healthy people fecal samples NF-025 healthy people fecal samples NF-026 healthy people fecal samples NF-027 healthy people fecal samples NF-028 healthy people fecal samples NF-029 healthy people fecal samples NF-030 healthy people fecal samples NF-031 healthy people fecal samples NF-032 healthy people fecal samples NF-033 healthy people fecal samples

[0177] The steps are as follows:

[0178] 1. Sample processing and DNA extraction:

[0179] Collect 5 g of fecal sample into fecal preservation solution (ZYMO RESEARCH, R1101), vortex to mix, centrifuge at 5000 rpm for 10 min, collect the supernatant, and perform a second centrifugation. Take 200 μL of the processed fecal supernatant for use. The Stool and Soil Genomic DNA Kit (EC801-11) is used for nucleic acid extraction from fecal samples. The procedure should be performed according to the kit instructions.

[0180] 2. Sulfite modification:

[0181] The extracted DNA was sulfite-modified using the EZ DNA methylation kit (purchased from ZYMO RESEARCH). Specific procedures were performed according to the kit's instruction manual.

[0182] 3. Perform qPCR amplification according to the following amplification system (total volume 40 μl).

[0183] 20 μl of 2×Premix Ex Taq (Probe qPCR), 0.8 μl of Rox II (50×), final concentrations of each primer (0.2–0.3 μM), final probe concentration (0.2 μM), and DNA template (>10 ng) were added, and water was added to bring the total volume to 40 μl. The sulfite-modified DNA obtained in step 2 was used as the template.

[0184] The 2×Premix Ex Taq (Probe qPCR) and Rox II (50×) used in the qPCR amplification were from TAKARA.

[0185] The qPCR reaction conditions are as follows:

[0186] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0187] 4. Detect the fluorescence signal and use the Ct value as the standard for judging the result.

[0188] The fluorescence signal of the reaction system in fluorescent PCR amplification was detected. When the fluorescence signal of the internal reference gene (β-actin) reached a set threshold (Ct≤38), it indicated that the amount of DNA loaded was within the allowable range, and the result was reliable. The number of cycles (Ct) required for the fluorescence signals of SDC2 and SHOX2 to reach the set thresholds was used as the standard for judging positive and negative results. Specifically, a Ct value ≥50 for SDC2 was considered negative, and a Ct value <50 was considered positive. A Ct value ≥39.64 for SHOX2 was considered negative, and a Ct value <39.64 was considered positive. A positive result for combined detection (SDC2+SHOX2) meant that either SDC2 or SHOX2 was positive, or both were positive. A negative result for combined detection (SDC2+SHOX2) meant that both SDC2 and SHOX2 were negative.

[0189] 5. The detection results (Table 12) show that the sensitivity of the SDC2 gene alone was 38.10% (advanced adenoma) and 88.72% (cancer patients), with a specificity of 100% for both. The sensitivity of the SHOX2 gene alone was 66.67% (advanced adenoma) and 86.47% (cancer patients), with specificities of 82.35% and 95.04%, respectively. The sensitivity of the two genes combined was 71.43% (advanced adenoma) and 94.74% (cancer patients), with specificities of 83.33% and 95.45%, respectively.

[0190] Figure 7 The amplification curves of qPCR methylation genes of SDC2 and SHOX2 in stool samples from cancer patients are shown. Figure 8 The amplification curves of qPCR for SDC2 and SHOX2 methylation genes in fecal samples from healthy individuals are shown. The results indicate that the combined detection method has good specificity.

[0191] Table 12 Detection results of fecal samples

[0192]

[0193]

[0194] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims. sequence list <110> Shanghai Bio-Tech Co., Ltd. Chongqing Bohao Diagnostic Technology Co., Ltd. <120> A kit for screening colorectal cancer and advanced adenoma <130> WHYY-NP-21-101014 <160> 25 <170> PatentIn version 3.5 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <400> 1 gtaattttta tgaattggcg atttatga 28 <210> 2 <211> twenty three <212> DNA <213> Artificial Sequence <400> 2 tctttccctt cttcactttc cct 23 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <400> 3 ggtagaaaag ttatatacgt ttttcgtt 28 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <400> 4 tgaaggcgtc gggatagtg 19 <210> 5 <211> twenty three <212> DNA <213> Artificial Sequence <400> 5 gaaaaccaaa ccaaaatcaa aca 23 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <400> 6 tcgatttcgt tttgtttga tt 22 <210> 7 <211> 359 <212> DNA <213> Artificial Sequence <400> 7 ggaaggattt gggagaatgg gaaatatttt tattatat ttattatatt aattattttt 60 ttttttaaaa tgtaattttt atgaattggc gatttatgaa tattttatat tgtttgaaag 120 tattttatt tttttttttt ttttaattta taaagtagtt tttttttat ggtcgaattt 180 ttaaggtaga aaagttatat acgtttttcg tttttttat aattgttttt tagaaaaggg 240 aaagtgaaga agggaaagag aaaagataac ggggaagaaa agagtataga ggagagagga 300 aaagtgggga gagaaaggaa gaaaaggatt gagaaacgt aggagttttg gtttgtcgg 359 <210> 8 <211> 360 <212> DNA <213> Artificial Sequence <400> 8 attagatatt agaagtatta tttttcgagt gtgtttttta agtttttttt taattttagg 60 ttttttttgt tttttgggtt ttcgattttt tggtagttgg gtatttgtat tcgggttttc 120 gataggttta gtcgttggtt tagttttttt cgtatgaagg cgtcgggata gtgggtttcg 180 ttaaaaagtt tttttagttt attgagttgt tttagggtga aattggttcg atttcgtttt 240 tgtttgattt tggtttggtt ttcgtttttt atttttttcg tatttttttt gcgatttttt 300 agtttcgggg atattggagg gggtatttta gcggggttat acgtgtattt atacgaatat 360 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <400> 9 agggtgtttg aagttacgag agga 24 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <400> 10 aaataaccga acgaacgcat 20 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <400> 11 agtttttaag tatatatcgg ag 22 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <400> 12 tttcgtttcg tttgttcga 19 <210> 13 <211> twenty two <212> DNA <213> Artificial Sequence <400> 13 cctaccttct aacccgactt ga 22 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <400> 14 gagtataggc gtttacgtt 19 <210> 15 <211> 28 <212> DNA <213> Artificial Sequence <400> 15 tcctctctcc tctatactcttttcttcc 28 <210> 16 <211> twenty one <212> DNA <213> Artificial Sequence <400> 16 cccgttatct tttctctttc c 21 <210> 17 <211> 17 <212> DNA <213> Artificial Sequence <400> 17 agttatatac gtttttc 17 <210> 18 <211> twenty two <212> DNA <213> Artificial Sequence <400> 18 ccgttatctt ttctctttcc ct 22 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <400> 19 ggatagtggg tttcgttaaa aagttt 26 <210> 20 <211> twenty two <212> DNA <213> Artificial Sequence <400> 20 cctccaatat ccccgaaact aa 22 <210> twenty one <211> twenty three <212> DNA <213> Artificial Sequence <400> twenty one cgaaaaccaa accaaaatca aac 23 <210> twenty two <211> twenty two <212> DNA <213> Artificial Sequence <400> twenty two aacgaaaacc aaaccaaaat ca 22 <210> twenty three <211> 16 <212> DNA <213> Artificial Sequence <400> twenty three ggtattgtcg atagga 16 <210> twenty four <211> 18 <212> DNA <213> Artificial Sequence <400> twenty four gtaggaaaga tatttatt 18 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <400> 25 atttcgtaag gagattattg ttttgtagtg 30

Claims

1. A kit for screening colorectal cancer and advanced adenoma, characterized in that, This invention comprises an SDC2-F upstream primer, an SDC2-R downstream primer, an SDC2-P probe, an SHOX2-F upstream primer, an SHOX2-R downstream primer, and an SHOX2-P probe. The SDC2-F upstream primer, the SDC2-R downstream primer, and the SDC2-P probe are used to detect methylation at the cg25664438 site of the SDC2 gene. The SHOX2-F upstream primer, the SHOX2-R downstream primer, and the SHOX2-P probe are used to detect methylation at the cg18194945 site of the SHOX2 gene. Methylation at the cg25664438 and cg18194945 sites of the SHOX2 gene is associated with colorectal cancer and advanced adenoma. The primer-probe combination consisting of the upstream primer SDC2-F, the downstream primer SDC2-R, and the probe SDC2-P is SDC2-F1, SDC2-R1, and SDC2-P1; wherein, the nucleotide sequence of SDC2-F1 is shown in SEQ ID NO.1, the nucleotide sequence of SDC2-R1 is shown in SEQ ID NO.2, and the nucleotide sequence of SDC2-P1 is shown in SEQ ID NO.3; The primer-probe combination consisting of the SHOX2-F upstream primer, the SHOX2-R downstream primer, and the SHOX2-P probe is SHOX2-F3, SHOX2-R5, and SHOX2-P2; wherein the nucleotide sequence of SHOX2-F3 is shown in SEQ ID NO.4, the nucleotide sequence of SHOX2-R5 is shown in SEQ ID NO.5, and the nucleotide sequence of SHOX2-P2 is shown in SEQ ID NO.

6.

2. The kit for screening colorectal cancer and advanced adenoma as described in claim 1, characterized in that, It also includes positive controls; the positive controls include plasmids containing nucleotide sequences of methylation sites of the SDC2 gene after sulfite modification and SHOX2 gene after sulfite modification, and / or colorectal cancer cell lines; the nucleotide sequence of the methylation site of the SDC2 gene after sulfite modification is shown in SEQ ID NO.7; the nucleotide sequence of the methylation site of the SHOX2 gene after sulfite modification is shown in SEQ ID NO.

8.

3. The kit for screening colorectal cancer and advanced adenoma as described in claim 2, characterized in that, The vector plasmid containing the nucleotide sequences of the methylation sites of the SDC2 gene and the SHOX2 gene after sulfite modification is selected from pUC57, pUC57-Kan, pUC57-Simple, pUC57-mini, pUC18, and pUC19.

4. The kit for screening colorectal cancer and advanced adenoma as described in claim 1, characterized in that, It also includes primer pairs and probes for the quality control gene; the quality control gene is actin.

5. The application of a set of primers and probes for the combined detection of methylation of the SDC2 and SHOX2 genes in the preparation of a kit for screening colorectal cancer and advanced adenomas, characterized in that, The primers and probes for the combined detection of methylation of the SDC2 and SHOX2 genes are used to detect methylation at the cg25664438 site of the SDC2 gene and the cg18194945 site of the SHOX2 gene; methylation at the cg25664438 site of the SDC2 gene and the cg18194945 site of the SHOX2 gene are associated with colorectal cancer and advanced adenoma; Samples with positive methylation at cg25664438 and / or cg18194945 are classified as having positive methylation in combination; samples with negative methylation at both cg25664438 and cg18194945 are classified as having negative methylation in combination; the evaluation result corresponding to positive methylation in combination is positive for colorectal cancer and advanced adenoma; the evaluation result corresponding to negative methylation in combination is negative for colorectal cancer and advanced adenoma.

6. The application as described in claim 5, characterized in that, The result interpretation criteria for qPCR using the SDC2-F upstream primer, SDC2-R downstream primer, SDC2-P probe, SHOX2-F upstream primer, SHOX2-R downstream primer, and SHOX2-P probe are as follows: A Ct value ≥ 50 for SDC2 indicates negative methylation at the cg25664438 site; a Ct value < 50 indicates positive methylation at the cg25664438 site; a Ct value ≥ 39.64 for SHOX2 indicates negative methylation at the cg18194945 site; and a Ct value < 39.64 indicates positive methylation at the cg18194945 site. The SDC2-F upstream primer, the SDC2-R downstream primer, and the SDC2-P probe are used to detect cg25664438 of the SDC2 gene. Methylation at the site; the SHOX2-F upstream primer, the SHOX2-R downstream primer, and the SHOX2-P probe are used to detect methylation at the cg18194945 site of the SHOX2 gene; the primer-probe combination consisting of the SDC2-F upstream primer, the SDC2-R downstream primer, and the SDC2-P probe is SDC2-F1, SDC2-R1, and SDC2-P1; wherein, the nucleotide sequence of SDC2-F1 is shown in SEQ ID NO.1, the nucleotide sequence of SDC2-R1 is shown in SEQ ID NO.2, and the nucleotide sequence of SDC2-P1 is shown in SEQ ID NO.3; The primer-probe combination consisting of the SHOX2-F upstream primer, the SHOX2-R downstream primer, and the SHOX2-P probe is SHOX2-F3, SHOX2-R5, and SHOX2-P2; wherein the nucleotide sequence of SHOX2-F3 is shown in SEQ ID NO.4, the nucleotide sequence of SHOX2-R5 is shown in SEQ ID NO.5, and the nucleotide sequence of SHOX2-P2 is shown in SEQ ID NO.

6.

7. The application as described in claim 6, characterized in that, The result determination criteria also include: Ct≤38 for the quality control gene indicates that the amount of DNA template loaded is within the allowable range and the result is reliable; Ct>38 for the quality control gene indicates that the amount of DNA template loaded is outside the allowable range and the result is unreliable; primers Actin-F and Actin-R are used as primers for the quality control gene, and probe Actin-P is used as a probe for the quality control gene, with sequences shown in SEQ ID NO.23, SEQ ID NO.24, and SEQ ID NO.25, respectively; the quality control gene is actin.

8. The application as described in claim 6, characterized in that, The qPCR described is a real-time fluorescent qPCR, and its reaction conditions are as follows: 96℃ pre-denaturation for 3 minutes; 15 cycles: 95℃ denaturation for 15 seconds, 70℃ annealing and extension for 20 seconds, 64℃ annealing and extension for 20 seconds, and 72℃ extension for 10 seconds; 35 cycles: 95℃ denaturation for 15 seconds, 70℃ annealing and extension for 20 seconds, 60℃ annealing and extension for 34 seconds, and 72℃ extension for 10 seconds; and fluorescence signal is detected during annealing in all 35 cycles.

9. The application as described in claim 6, characterized in that, The qPCR amplification system is as follows: 20 μl of 2×Premix Ex Taq (Probe qPCR), 0.8 μl of 50×RoxⅡ, final concentration of each primer 0.2~0.3 μM, final concentration of probe 0.2 μM, DNA template >10 ng, and water to make up to 40 μl.

Citation Information

Patent Citations

  • Reagent kit for detecting Septin9 gene methylation and application of reagent kit

    CN106148501A

  • Applications of products that detect NDRG4 gene methylation sites in the preparation of products for early detection of colorectal cancer.

    CN108676878B

  • Primer probe set and kit for early diagnosis, detection or screening of colorectal cancer and precancerous lesions thereof

    CN109811056A

  • Genome-scale analysis of aberrant DNA methylation in colorectal cancer

    WO2012167145A2