Molecular marker of rice photoreceptor module related to blast resistance and application thereof

Abstract

This invention relates to the genetic identification and molecular marker development of a photosensitive module related to rice blast resistance, belonging to the fields of rice biobreeding and molecular genetics. Pigm Photosensitive combination-derived RIL populations were used to locate photosensitive modules under long-day and short-day conditions using genetic analysis. qHd6 + qHd7 Genotyping of this module's molecular markers can predict the photosensitivity of early-maturing japonica rice offspring in northern China, guide the selection of parental lines for disease-resistant biological breeding, and facilitate marker-assisted selection of disease-resistant, non-photosensitive offspring.

Description

Technical Field

[0001] This invention belongs to the fields of biobreeding and molecular genetics, specifically relating to molecular markers of photosensitive modules related to rice blast resistance and their applications. It is applicable to the biobreeding improvement of rice disease resistance; by identifying these molecular markers of photosensitive modules, the photosensitivity of resistant rice offspring can be predicted, thereby guiding the selection of parental lines for rice blast resistance improvement. Background Technology

[0002] Pigm The gene is a broad-spectrum rice blast resistance gene, widely used in rice disease resistance improvement (Deng Y, Zhai K, Xie Z, Yang D, Zhu X, Liu J, Wang X, Qin P, Yang Y, Zhang G, Li Q, Zhang J, Wu S, Milazzo J, Mao B, Wang E, Xie H, Tharreau D, He Z (2017) Epigenetic regulation of antagonistic receptors confers rice blast resistance with yield balance. Science 355 (6328):962-965. doi:10.1126 / science.aai8898). In their breeding practice, the research group discovered that the introduction of this gene into northern japonica rice... Pigm After the gene is passed, offspring may exhibit photosensitivity exceeding that of their parents. Figure 1 , Figure 2 Previous research has found that, with Pigm Gene alleles Pi-2 Gene introduction causes a slight delay in the heading date of offspring, but no over-parental phenomenon occurs. Therefore, the introduction of genes into northern japonica rice... Pigm The genetic mechanism of the resulting photosensitive hyper-affinity phenomenon remains to be elucidated.

[0003] Heading date is an important agronomic trait, crucial for the regional adaptability of rice varieties. Rice is a short-day crop, and photosensitivity refers to its response to changes in day length during its growth period; that is, short-day conditions promote heading, while long-day conditions delay it. It is currently known that the heading date of rice is mainly influenced by... OsGI - Hd1 - Hd3a / RFT1 and Ghd7 - Ehd1 - Hd3a / RFT1The regulation of these two pathways (Zhou S, Zhu S, Cui S, Hou H, Wu H, Hao B, Cai L, Xu Z, Liu L, Jiang L, Wang H, Wan J (2021) Transcriptional and post-transcriptional regulation of heading date in rice. New Phytol 230 (3):943-956. doi:10.1111 / nph.17158). Among them, Ghd7 encodes a protein with a CCT domain, which, under long-day conditions, interacts with... Hd1 , DTH8 Key gene interactions inhibit downstream Ehd1 gene and delay heading (Zong W, Ren D, Huang M, Sun K, Feng J, Zhao J, Xiao D, Xie W, Liu S, Zhang H, Qiu R, Tang W, Yang R, Chen H, Xie X, Chen L, Liu YG, Guo J (2021) Strong photoperiod sensitivity is controlled by cooperation and competition among Hd1, Ghd7 and DTH8 in rice heading. New Phytol 229 (3):1635-1649. doi:10.1111 / nph.16946). In northern japonica rice Ghd7 It has a significant impact on maturity and yield. Previous researchers have developed a series of molecular markers for... Ghd7 Choose from different function types: RM5436 is a chain mark, related to... Ghd7The greater distance between them makes genetic recombination more likely. Se9151 and Se9153 are enzyme digestion markers (Xue W, Xing Y, Weng X, Zhao Y, Tang W, Wang L, Zhou H, Yu S, Xu C, Li X, Zhang Q (2008) Natural variation in Ghd7 is an important regulator of heading date and yield potential in rice. Nat Genet40 (6):761-767. doi:10.1038 / ng.143), which have high detection costs and certain thresholds for molecular manipulation conditions, making them unsuitable for breeding applications. In addition, existing molecular markers for photosensitive genes are all for single sites, lacking comprehensive evaluation of two or more related sites, i.e., modules, and especially lacking the ability to effectively predict Pigm Genes are involved in the combination of molecular markers for photosensitivity in offspring. Summary of the Invention

[0004] In view of the above research background, this invention first utilizes Pigm Genetic analysis was conducted on RIL populations derived from photosensitive combinations to pinpoint disease resistance-related […]. qHd6 + qHd7 The photosensitive module. Based on this, a set of […] was designed. qHd6 + qHd7 Molecular markers for the photosensitive module were developed, including a new, practical, and economical PCR-based marker, ZLM7-1. This marker set was validated in RIL population progeny and genotyped in 120 randomly selected breeding materials (70 from Heilongjiang and 50 from Jilin). From these, 35 materials (16 from Heilongjiang and 19 from Jilin) ​​were randomly selected for pairing and validation of the photosensitive phenotype. The results showed that the molecular marker set [M80410+ZLM7-1] can effectively […]. qHd6 + qHd7 Auxiliary identification of photosensitive modules, from Pigm The offspring of the combined strains were screened for disease-resistant and non-photosensitive breeding materials, with an overall prediction accuracy of 91.4%, of which the accuracy rate was 81.2% for materials from Heilongjiang and 100% for materials from Jilin. This invention is thus completed.

[0005] This invention first provides a molecular marker for a disease-resistant photosensitive module, characterized in that it is located in the region of chromosome 7 from 8,556,052 to 11,072,552 bp, referred to as the molecular marker target. qHd7 .

[0006] Furthermore, this invention provides a combination of molecular markers for disease resistance-related photosensitive modules, which includes a combination of two molecular marker target sites, namely the region 8,665,233-9,600,319 bp on rice chromosome 6, referred to as the molecular marker target site. qHd6, The region located at 8,556,052-11,072,552 bp on chromosome 7 is called the molecular marker target. qHd7 .

[0007] Specifically, the molecular marker target qHd6 and molecular marker targets qHd7 Identification was performed using PCR primer pairs.

[0008] Preferably, the PCT primer pair for the molecular marker target qHd6 is the molecular marker M80410, with the forward primer sequence being: GGATTGTCTTGTCTCTCTCGC and the reverse primer sequence being: CAGGACTTAGGGTTTCTCTCTTT; the PCR primer pair for the molecular marker target qHd7 is the molecular marker ZLM7-1, with the forward primer sequence being: TCCCCCAAACATTTTCAGAACAC and the reverse primer sequence being: TAGGTGCAGTTGCAGTAGGT.

[0009] This invention provides a method for predicting the photosensitivity of early-maturing japonica rice offspring in northern China based on molecular markers of the disease-resistance-related photosensitive module. The method is characterized in that the molecular marker target qHd6 identifies the genotype as A_ or aa (where A_ represents AA or Aa, as this marker is dominant and cannot distinguish between the two, and their effects are the same, hence this representation, hereinafter the same); the molecular marker target qHd7 identifies the genotype as BB, bb, or Bb, that is, when the […] in the rice genome is detected… qHd6 + qHd7 When the genotype of the photosensitive module is A_B_, its photosensitivity is the strongest, exhibiting a photosensitive super affinity phenomenon, while the photosensitivity of other genotypes is relatively weak.

[0010] Specifically, when the M80410 marker primer is used for PCR amplification of the rice genome template to be tested, if a band of about 500 bp is amplified, the detected genotype is A_; when the ZLM7-1 marker primer is used for PCR amplification of the rice genome template, if a band of 223 bp is amplified, the detected genotype is BB; if a band of about 202 bp is amplified, the detected genotype is bb. Therefore, through the above detection, it is found that when the genotype of the rice genome to be tested is A_B_, its photosensitivity is the strongest, exhibiting a photosensitivity super-affinity phenomenon.

[0011] More preferably, agarose gel electrophoresis or polyacrylamide gel electrophoresis is used to detect the bands. Preferably, agarose gel electrophoresis is used for PCR amplification products of M80410 labeled primers, and polyacrylamide gel electrophoresis is used for PCR amplification products of ZLM7-1.

[0012] The molecular markers [M80410+ZLM7-1] of this invention are used in combination to detect offspring of a photosensitive combination population represented by TH886 / XQ62. When [ qHd6 + qHd7 The molecular marker detection of the photosensitive module showed that the genotype A_B_ exhibited the strongest photosensitivity, displaying a photosensitivity super affinity phenomenon; while other genotypes showed relatively weaker photosensitivity. Figure 9 When used for [ qHd6 + qHd7 Molecular markers in photosensitive modules are used to predict the presence of [carriers / substances]. Pigm When early japonica background materials, such as XQ62, are used in combinations, the average effectiveness can reach 88.6%, and the efficiency in Jilin breeding materials can even reach 100% (Table 1).

[0013] Therefore, the present invention [ qHd6 + qHd7 Molecular marker primers for photosensitive modules can be used to utilize... Pigm In the process of improving disease-resistant organisms through gene-based breeding, the genotype identification of molecular markers in this module can predict the photosensitivity of early-maturing japonica rice offspring in northern China, guide the selection of parental lines for disease-resistant organism breeding, and facilitate marker-assisted selection of disease-resistant non-photosensitive offspring.

[0014] Therefore, the present invention provides the application of the disease resistance-related photosensitive module molecular markers in marker-assisted selection of disease-resistant non-photosensitive breeding progeny of rice, preferably the rice being Northern Early Japonica.

[0015] Preferably, the molecular markers of the disease-resistant photosensitive module are used to predict the photosensitivity of the offspring of early-maturing japonica rice in northern China, while the photosensitivity of other genotypes is relatively weak, thus guiding the selection of parent lines for disease-resistant biological breeding.

[0016] The photosensitive module of the present invention [ qHd6 + qHd7 Molecular markers, specifically the combination [M80410+ZLM7-1], can be used to... Pigm In disease-resistant biological breeding using gene-based methods, genotype screening of offspring can be performed to obtain disease-resistant and photosensitive breeding materials. On the other hand, genotype-based prediction of the photosensitivity of combined offspring can be conducted, providing a reference for parental selection. The molecular markers [M80410+ZLM7-1] of this invention, used in combination, can... Pigm Screening for disease-resistant, non-photosensitive breeding materials from the offspring of gene-involved combinations can accelerate the breeding process.

[0017] In addition, ZLM7-1 and qHd7 Tight linkage makes recombination difficult, resulting in excellent performance in marker-assisted breeding of rice. The molecular marker ZLM7-1 of this invention, used alone, can pre-identify parents. qHd7 Genotype, thereby selecting suitable breeding parents and carriers Pigm Genes are used to mate materials for resistance. Attached Figure Description

[0018] Figure 1 Jilin breeding material TH886 is compared with Heilongjiang early japonica background. Pigm The photosensitivity of the F1 generation of the near-isogenic lines XQ62 and XQ10 under long-day conditions.

[0019] Figure 2 The photosensitivity of F1 generations of hybrids of Jilin breeding material TH899 with Heilongjiang early japonica background Pigm near-isogeninverse lines XQ62 and XQ10 under long-day conditions.

[0020] Figure 3 Results of RIL population localization in Beijing under long-day conditions using TH886 and XQ62 photosensitive combination.

[0021] Figure 4 Results of RIL population localization in Beijing under long-day conditions using the TH899 and XQ62 photosensitive combination.

[0022] Figure 5 Results of short-day localization of RIL populations derived from the TH886 and XQ62 photosensitive combination in Hainan.

[0023] Figure 6 Results of short-day localization of RIL populations derived from the TH899 and XQ62 photosensitive combination in Hainan.

[0024] Figure 7 [ qHd6 + qHd7 The amplified genotype of the photosensitive module molecular marker M80410, of which the band of about 500 bp is the disease-resistant photosensitive genotype A_.

[0025] Figure 8 [ qHd6 + qHd7 Amplified genotypes of the photosensitive module molecular marker ZLM7-1; among them, the band around 223bp represents the photosensitive genotype BB, and the band around 202bp represents the non-photosensitive genotype bb.

[0026] Figure 9 The progeny of the TH886 / XQ62 combination RIL population [ qHd6 + qHd7Performance of different genotypes of photosensitive module molecular markers during the heading stage under long-day conditions in Beijing.

[0027] Figure 10 according to[ qHd6 + qHd7 Photosensitive module molecular marker prediction in breeding parents Pigm The photosensitivity of the F1 hybrid generation under long-day conditions. Among them, (1) is the breeding parent, and (3) is XQ62 (carrier). Pigm (5) is XQ10 (without carrying) Pigm (2) are the F1 of the breeding parent / XQ62, and (4) are the F1 of the breeding parent / XQ10. Detailed Implementation

[0028] The invention will be further illustrated below with specific implementation examples. Unless otherwise specified, all methods used are conventional methods.

[0029] (one) qHd7 and qHd6 Location results and resource material verification 1. Selection of test materials like Figure 1 and Figure 2 As shown, the initial goal was to bring the precocious background from Heilongjiang... Pigm We combined these two high-quality, high-yield Jilin materials TH886 and TH899 for breeding improvement. During the crossbreeding process, we discovered that these two Jilin materials, along with XQ62 (an early-maturing variety from Heilongjiang), showed promising results. Pigm After pairing (genes), the F1 generation showed significant photosensitive hyper-affinity, while these two materials, along with XQ10 (a precocious material from Heilongjiang without genetic predisposition), exhibited significant photosensitive hyper-affinity. Pigm If the genes are matched, there will be no hypersensitive photosensitivity phenomenon.

[0030] Therefore, by using Jilin materials TH886 and TH899 with the background of early japonica rice from Heilongjiang, respectively... Pigm Material XQ62 was used to create hybrid combinations, and two RIL populations were derived through single-seed propagation. TH886 / XQ62 contained 226 F7 families, and TH899 / XQ62 contained 231 F7 families. Seventy breeding materials from Heilongjiang and 50 breeding materials from Jilin (excluding TH886 and TH899, but including those listed in Table 1) were randomly selected as marker validation materials.

[0031] 2. QTLMapping Genomic DNA was extracted from the RIL population lines, and genotypic data were obtained using a 40K liquid chromatography-mass spectrometry (LC-MS) chip. The number of days in the heading stage, collected under long / short day conditions (in this experiment, long day refers to natural long daylight in Beijing, and short daylight refers to natural short daylight in Sanya during winter), was used as the phenotypic value. Genetic mapping analysis was performed using ICIMapping V3.2 software, with a LOD significance threshold set to 5.0. Major gene loci with significant effects were identified.

[0032] 3. Parental candidate gene haplotype analysis Haplotype analysis was performed on candidate genes within the intervals of the two major-effect QTLs located. This analysis was conducted on four parents from Jilin materials: TH886, TH899, XQ10, and XQ62. qHd6 and qHd7 Haplotype analysis was performed on the CDS sequences of candidate genes.

[0033] 4. Testcross Verification The two near-isogenic lines XQ62 and XQ10 were used to perform testcrosses with 35 materials randomly selected from 120 breeding materials (16 materials from Heilongjiang and 19 materials from Jilin, excluding TH886 and TH899) (Table 1), and the performance of F1 was observed under long and short day conditions.

[0034] surface . [ qHd6 + qHd7 Predictive effect of photosensitive module genotypes in disease resistance improvement pairing of 35 randomly selected breeding materials 5. Molecular marker development and primer design Using Nipponbare as a reference genome, primers were designed approximately 100 bp before and after the candidate region on https: / / www.ncbi.nlm.nih.gov / .

[0035] 6. DNA extraction and polyacrylamide gel electrophoresis Following the DNA extraction method described by Temnykh et al. (2001), genomic DNA was extracted from representative single plants of 226 families of the Jilin material TH886 / XQ62 and from 120 rice varietal seedlings. Polymerase chain reaction (PCR) was performed using the genomic DNA as a template. The PCR products were separated by polyacrylamide gel electrophoresis, stained with ethidium bromide, and imaged using a gel imaging system. The banding patterns of the offspring lines were discriminated and recorded by referring to the amplified bands of the parents.

[0036] (II) Results Analysis 1. Location Results Using the two RIL populations TH886 / XQ62 and TH899 / XQ62, under long-day conditions, QTLs with relatively high LOD values ​​were located in the intervals of 8,665,233-9,600,319 bp on chromosome 6 and 8,556,052-11,072,552 bp on chromosome 7. Figure 3 , Figure 4 ), respectively named qHd6 and qHd7 Under short-day conditions, the two RIL populations TH886 / XQ62 and TH899 / XQ62 also mapped the same QTLs on chromosomes 6 and 7 as those under long-day conditions. Figure 5 , Figure 6 Therefore, qHd6 and qHd7 As an important candidate gene.

[0037] Using Nipponbare as a reference genome, at https: / / www.ncbi.nlm.nih.gov / , qHd7 The candidate region is designed with upstream and downstream primers within approximately 100 bp before and after it, and is called ZLM7-1. The forward primer is: TCCCCAAACATTTTCAGAACAC; the reverse primer is: TAGGTGCAGTTGCAGTAGGT.

[0038] In the location qHd6 The physical location of the known primer M80410 (Deng Y, Zhai K, Xie Z, Yang D, Zhu X, Liu J, Wang X, Qin P, Yang Y, Zhang G, Li Q, Zhang J, Wu S, Milazzo J, Mao B, Wang E, Xie H, Tharreau D, He Z (2017) Epigenetic regulation of antagonistic receptors confers rice blast resistance with yield balance. Science 355 (6328):962-965. doi:10.1126 / science.aai8898) was found near the site. Its forward primer sequence is: GGATTGTCTTGTCTCTCTCGC; and its reverse primer sequence is: CAGGACTTAGGGTTTCTCTCTTT, which can be used for simultaneous identification. Pigm Resistance genes and their linkage qHd6 The existence of the site.

[0039] 2. Testcross and Marker Verification Using the obtained [ qHd6 + qHd7 The molecular marker combination [M80410+ZLM7-1] of the photosensitive module was used for marker genotyping in the F6 lines of the Jilin material TH886 / XQ62 population. When the M80410 marker primer was used to amplify the rice genome template, the PCR amplification products were subjected to agarose gel electrophoresis. If a band of approximately 500 bp was amplified, it was detected. qHd6 The locus genotype is represented as A_, otherwise as aa ( Figure 7 When ZLM7-1 labeled primers were used to amplify the rice genome template, the PCR amplification products were subjected to polyacrylamide gel electrophoresis. qHd7 The ZLM7-1 marker primer amplification product corresponding to the AA genotype is 21 bp longer than that corresponding to the aa genotype. Therefore, if a band of approximately 223 bp is amplified, detection... qHd7 The genotype is represented as BB. If a band of approximately 202 bp is amplified, detection... qHd7 Genotype is represented as bb ( Figure 8 The combined use of this set of molecular markers [M80410+ZLM7-1] was effective in detecting offspring of the photosensitive combination population represented by TH886 / XQ62 when [ qHd6 + qHd7 The molecular marker detection of the photosensitive module showed that the genotype A_B_ exhibited the strongest photosensitivity, displaying a photosensitivity super affinity phenomenon; while other genotypes showed relatively weaker photosensitivity. Figure 9 ).

[0040] This invention also involves the [development of] early-maturing japonica rice breeding materials from Heilongjiang and Jilin provinces. qHd6 + qHd7 [Molecular marker [M80410+ZLM7-1] for photosensitivity prediction of the photosensitive module. Thirty-five materials were randomly selected from 120 breeding materials and testcrossed with XQ62 and XQ10 respectively. Nineteen of these materials were from Jilin and 16 from Heilongjiang (Table 1). The near-isogenic lines XQ10 and XQ62 were testcrossed with the 19 Jilin materials, and the F1 generation was planted in Changping, Beijing, to observe the heading date. The results showed that in three of the 19 materials, the heading date of the F1 generation was not significantly delayed regardless of whether it was testcrossed with XQ10 or XQ62. In the remaining 16 materials, the F1 generation after the testcross with XQ62 showed strong photosensitivity, but the offspring after the testcross with XQ10 did not exhibit this (…). Figure 10 Sixteen mature materials from Heilongjiang Province were testcrossed, and their offspring and parents were planted in the suburbs of Jiamusi City, Heilongjiang Province. The results showed that some of the offspring were photosensitive to higher parental values.

[0041] use[ qHd6 + qHd7 The molecular marker [M80410+ZLM7-1] of the photosensitive module was used for marker genotyping. The results showed that the average agreement between the predicted F1 photosensitivity intensity and the actual observation reached 88.6%. For breeding materials with maternal parent from Heilongjiang, the prediction reached 75.0%, and for breeding materials with maternal parent from Jilin, it even reached 100% (Table 1).

[0042] In summary, this demonstrates the use of [ qHd6 + qHd7 Molecular markers [M80410+ZLM7-1] in the photosensitive module assist in the development of early japonica rice. Pigm Photosensitive-assisted selection of gene-mediated rice blast resistance-improved progeny and selection of disease-resistant biological breeding parents for early japonica rice are effective.

[0043] The above embodiments do not limit the invention in any way.

Claims

1. A method for predicting the photosensitivity of early-maturing japonica rice offspring in northern China based on disease-resistance-related photosensitive module molecular markers, characterized in that, The disease resistance related photosensitive module molecular marker comprises two molecular marker target point combinations, which are respectively the interval of 8,665,233-9,600,319 bp of chromosome 6 of rice, referred to as molecular marker target point qHd6, and the interval of 8,556,052-11,072,552 bp of chromosome 7, referred to as molecular marker target point qHd7 ; The molecular marker target point qHd6 identifying the genotype as A_ or aa; the molecular marker target point qHd7 identification The genotype is BB, bb or Bb, when the genotype of the light-sensitive module is A_B_ in the genome of the rice to be tested, qHd6 + qHd7 The light sensitivity of the light-sensitive module is the strongest and presents the light-sensitivity over-parent phenomenon when the genotype is A_B_, and the light sensitivity of other genotypes is relatively weak.

2. The method as described in claim 1, characterized in that, The molecular marker target qHd6 and molecular marker targets qHd7 Identification was performed using PCR primer pairs.

3. The disease-resistant photosensitive module molecular marker as described in claim 2, characterized in that, The molecular marker target qHd6 The forward primer sequence of the PCT primer pair is: GGATTGTCTTGTCTCTCTCGC, and the reverse primer sequence is: CAGGACTTAGGGTTTCTCTCTTT; the molecular marker target site qHd7 The forward primer sequence of the PCR primer pair is: TCCCCAAACATTTTCAGAACAC, and the reverse primer sequence is: TAGGTGCAGTTGCAGTAGGT.

4. The method as described in claim 3, characterized in that, When the molecular marker target is used qHd6 The PCT primer pair was used to amplify the rice genome template to be tested by PCR. If a 500bp band was amplified, the genotype was detected as A_. When the molecular marker target was used... qHd7 The PCR primer pair was used to amplify the rice genome template. If a 223bp band was amplified, the genotype was detected as BB; if a 202bp band was amplified, the genotype was detected as bb. Therefore, the rice genome genotype to be tested was A_B_, which showed the strongest photosensitivity and exhibited photosensitivity super-affinity.

5. The method as described in claim 4, characterized in that, The bands are detected using agarose gel electrophoresis or polyacrylamide gel electrophoresis, preferably targeting the molecular marker sites. qHd6 The PCR amplification products of the PCT primer pair were subjected to agarose gel electrophoresis targeting the molecular marker. qHd7 The PCR amplification products of the PCR primer pairs were subjected to polyacrylamide gel electrophoresis.

6. Application of a disease resistance-related photosensitive module molecular marker in marker-assisted selection of disease-resistant, non-photosensitive rice offspring, wherein the rice is a carrier of... Pigm Furthermore, the early-maturing japonica rice from the north has weak photosensitivity; The disease resistance-related photosensitive module molecular markers include a combination of two molecular marker target sites, namely the region 8,665,233-9,600,319 bp on rice chromosome 6, referred to as the molecular marker target site. qHd6, The region located at 8,556,052-11,072,552 bp on chromosome 7 is called the molecular marker target. qHd7 .

7. The application as described in claim 6, characterized in that, Using the method described in any one of claims 1 to 5, when the genome of the rice to be tested in the offspring of the Northern Early Japonica rice combination is detected, […]. qHd6 + qHd7 When the genotype of the photosensitive module is A_B_, its photosensitivity is the strongest, exhibiting a photosensitivity super affinity phenomenon, while other genotypes have relatively weaker photosensitivity, thus predicting... Pigm The photosensitivity of the offspring of the Northern Early Japonica rice combination is used to guide the selection of biological breeding parents for improving rice blast resistance.

Images