Unnatural base pairs specifically paired by m3t and tpt3 and derivatives and applications thereof

Abstract

The application discloses a non-natural base pair formed by specific pairing of m3T and TPT3, derivatives and applications thereof, and has a structural general formula as shown in the specification.The application takes N3-methylated thymine in DNA as a target, and utilizes a kinetic method to screen bases capable of being specifically paired with the N3-methylated thymine.TPT3 is screened out and can be specifically paired with the N3-methylated thymine.After specific pairing of TPT3 and m3T, DNA can be effectively elongated and amplified.m3T-TPT3 can be converted into a NaM-TPT3 non-natural base pair in the amplification process, and N3-methylated thymine sites can be determined by comparing sanger sequencing signal termination.The m3T-TPT3 non-natural base pair can recognize and capture low-abundance N3-methylated thymine and N3-alkylated damage in complex biological samples such as plasmids, and has great potential in the application in the detection of DNA alkylated damage.

Description

Technical Field

[0001] This invention belongs to the field of non-natural base technology, specifically relating to a non-natural base pair formed by the specific pairing of m3T and TPT3, its derivatives, and applications. Background Technology

[0002] Base adducts can disrupt the chemical integrity of DNA, leading to complex physiological and biochemical reactions. Among these, 3-alkylthymine or uracil is a known low-abundance and chemically stable base adduct, representing a potent mutagenic alkylation injury. Studies have shown that 3-methylthymine is not an effective substrate for DNA repair enzymes and is not easily repaired by the body. Its accumulation in the genome may be closely related to the development and progression of tumors and genetic diseases. Therefore, studying its distribution in genetic material is crucial for elucidating the role of 3-alkylthymine or 3-alkyluracil in the development and progression of tumors and genetic diseases.

[0003] In recent years, researchers have devoted considerable effort to developing detection methods for DNA and RNA damage. For DNA and RNA adducts, detection strategies can be broadly categorized into four types: 1. Specific removal of adducts using chemical or enzymatic methods, facilitating subsequent sequencing and analysis by inserting short code sequences with enrichment handles at the adduct sites; 2. Direct coupling of chemical reporter groups to damaged DNA or RNA bases, enriching damaged DNA and performing sequencing via the reporter group; 3. Antibody recognition of DNA or RNA adducts, achieving enrichment and sequencing of damaged DNA and RNA; 4. Designing non-natural bases that specifically pair with damaged DNA and RNA bases for recognition, enrichment, and sequencing.

[0004] However, 3-alkylthymidine and 3-alkyluracil are chemically stable DNA adducts. There are no effective chemical methods or repair enzymes that can specifically remove 3-alkylthymidine and 3-alkyluracil from DNA and RNA. Furthermore, there are no specific antibodies for the recognition and enrichment of 3-alkylthymidine and 3-alkyluracil. Sequencing methods for 3-alkylthymidine and 3-alkyluracil in DNA and RNA are significantly lagging behind those for other DNA and RNA adducts. Summary of the Invention

[0005] The technical problem solved by this invention is to provide a non-natural base pair formed by the specific pairing of m3T and TPT3, its derivatives, and applications.

[0006] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: a non-natural base pair formed by the specific pairing of m3T and TPT3 and its derivatives, characterized in that its general structural formula is:

[0007]

[0008] Where R is alkyl, R1 is a chemical group such as hydrogen atom, alkyl, alkenyl, allyl, alkynyl, propargyl, biotin group, radioisotope labeled group or fluorescent group used for bioorthogonal reactions or specific enrichment and reporting, R2 is a chemical group such as hydrogen atom, alkyl, alkenyl, alkynyl, propargyl, biotin group, radioisotope labeled group or fluorescent group used for bioorthogonal reactions or specific enrichment and reporting, and R3 is a chemical group such as hydrogen atom, halogen atom, hydroxyl, alkyl, alkenyl, alkynyl, methoxy, nitrogen-containing group or sulfur-containing group that can be used to improve the stability of the phosphate backbone of DNA or RNA containing the above-mentioned non-natural base pairs and the affinity of biological macromolecules such as proteins.

[0009] Further specified, the alkyl groups in R, R1, R2, and R3 are C1-8 alkyl groups, specifically methyl, ethyl, isopropyl, or n-butyl; the alkenyl groups in R1, R2, and R3 are vinyl, propenyl, halovinyl, styryl, or benzene-ring-substituted styryl; the alkynyl groups in R1, R2, and R3 are ethynyl or propynyl; and the biotin groups in R1 and R2 are PEG-biotin, SH-PEG-biotin, N3-PEG-biotin, or alkynyl-PEG-biotin. The biotin, silane-PEG-biotin, aldehyde-PEG-biotin, amine-PEG-biotin, wherein the radioisotope labeling groups in R1 and R2 are 18F, 123I, 77Br, 99mTc, 186Re or radiophosphorus-labeled chemical groups, the fluorescent groups in R1 and R2 are FAM, FITC, Cy2 or Hex, the nitrogen-containing group in R3 is an amino group, an azide group or an imine group, and the sulfur-containing group in R3 is a mercapto group, a thiol or a thioether.

[0010] Furthermore, the non-natural base pairs formed by the specific pairing of m3T and TPT3 and their derivatives exist in the form of nucleosides, nucleotides, or oligonucleotides containing the non-natural base pairs.

[0011] The application of the non-natural base pairs and their derivatives formed by the specific pairing of m3T and TPT3 described in this invention in the preparation of products having at least one of the following functions (1)-8):

[0012] 1) Recognition of thymine modified by N3 alkylation in DNA;

[0013] 2) Detection of thymine modified at the N3 position in DNA;

[0014] 3) Capture or enrichment of DNA fragments containing N3-alkylated thymine DNA fragments;

[0015] 4) Recognition of uracil modified by N3 alkylation in RNA;

[0016] 5) Detection of uracil alkylation at the N3 position in RNA;

[0017] 6) Capture or enrichment of uracil RNA fragments containing N3-alkylated modification;

[0018] 7) During RNA transcription using DNA as a template, one or more non-natural bases from any of the above-mentioned non-natural base pairs and their derivatives are inserted into a specific site on the RNA.

[0019] 8) During the reverse transcription of DNA using RNA as a template, damaged bases in RNA are reverse transcribed into one or more non-natural bases from any of the above-mentioned non-natural base pairs and their derivatives in DNA.

[0020] Further specifying, the product is a reagent kit or a detection product that uses any of the above-mentioned non-natural base pairs and their derivatives as components.

[0021] Compared with existing technologies, this invention has the following advantages and beneficial effects: This invention targets thymine modified at the N3 position of DNA by methylation and uses a steady-state kinetic method to screen for TPT3-type non-natural bases. It identifies TPT3 that can specifically pair with N3-methylated thymine to form the m3T-TPT3 non-natural base pair. The pairing ability of TPT3 with m3T is at least 80 times higher than that of adenine, and after pairing, the DNA can be effectively extended to form a double-stranded DNA product containing the m3T-TPT3 base pair. This double-stranded DNA product containing the m3T-TPT3 base pair will specifically convert to the TPT3-Nam base pair in the presence of TPT3 and Nam, thus allowing the detection of N3 methylation-damaged thymine in DNA using the Sanger sequencing signal termination method. Non-destructive KRAS-native DNA interference experiments show that this method can identify, enrich, and detect KRAS DNA with abundances as low as 1.6 × 10⁻⁶. -6 The N3 position of methylated thymine was determined. Methyl methanesulfonate was used to intervene in the PU19 plasmid in DH5α cells, causing alkylation damage. Using the above method, it can be determined that at least two sites in the PU19 plasmid exhibit N3 alkylation damage of thymine. This non-natural base pair shows broad application prospects in the detection of N3 alkylation damage of thymine in complex biological samples, and is expected to become a novel non-natural base pair for detecting the distribution of N3 alkylation damage in genetic material, possessing great potential in the sequencing of N3 alkylation damage in genetic material. Attached Figure Description

[0022] Figure 1 This is a specific pairing screening diagram of N3-methylated thymine.

[0023] Figure 2 It is the steady-state kinetic parameter of TPT3 type non-natural base pairing with m3T.

[0024] Figure 3 It is primer extension after TPT3 type non-natural bases are paired with m3T.

[0025] Figure 4 It involves amplification and sequencing of KRAS-m3T template.

[0026] Figure 5 This involves the identification, enrichment, and sequencing of thymine with low abundance at the N3 position methylation in KRAS DNA.

[0027] Figure 6 This involves the enrichment and sequencing of N3-methylated thymine in the PU19 plasmid. Detailed Implementation

[0028] The following examples further illustrate the above-described content of the present invention, but it should not be construed as limiting the scope of the subject matter of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention.

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used in the following examples are commercially available unless otherwise specified.

[0030] Example 1

[0031] Screening for N3-methylated thymine bases in DNA that specifically pair and recognize them.

[0032] Currently, methods for detecting and sequencing DNA damage mainly rely on four strategies. The first is based on chemical reactions or repair enzymes to specifically remove DNA damage, followed by inserting short code sequences with reporter groups or enrichment handles at the damage sites for subsequent sequencing and analysis. The second involves directly coupling chemical reporter groups to damaged DNA or RNA bases, enriching the damaged DNA through the reporter group, and then sequencing. The third is based on antibodies recognizing DNA or RNA adducts to achieve enrichment and sequencing of damaged DNA and RNA. The fourth involves designing non-natural bases that specifically pair with these bases for recognition, enrichment, and sequencing. However, because N3-methylated thymine is a chemically stable DNA alkylation damage, there are currently no effective chemical reactions or repair enzymes to specifically remove N3-methylated thymine from DNA, no effective reporter groups to couple with alkylated thymine, and no effective antibodies to recognize or enrich alkylated thymine. Therefore, this invention, based on the principle of shape complementarity and the design principle of hydrophobic bases, uses a kinetic method to select TPT3 and its analogues in order to discover bases that specifically pair with N3-methylated thymine.

[0033] I. Mononucleotide Insertion Experiment

[0034] 1. A 45-mer DNA template containing N3-methylated thymine at position 24 is annealed and bound to a 23-mer primer with a fluorescent label at the 5' end to form a template / primer complex (2.25 pmol).

[0035] 2. The template / primer complex was combined with 4.5U KF (exo - Mix DNA polymerase and pre-stabilize at 37°C for 1 min.

[0036] 3. Add TPT3 or its analogues of triphosphate to initiate the reaction, and the reaction time is 15s.

[0037] 4. Add 0.05M pH8.0 EDTA to stop the reaction, and then evaporate the water by rotary evaporation.

[0038] 5. Add the reaction residue to 4 μL of 1× single-stranded loading buffer, perform 15 wt% deformed polyacrylamide gel electrophoresis, image with Amersham Imager 680, and perform quantitative analysis using AI600 imaging analysis software.

[0039] 6. Calculate the proportion of the n+1 product (primer 24 polymer product) to the total amount of primers, i.e., the yield of the n+1 product.

[0040] The pairing efficiency of dATP with N3-methylthymine in natural nucleotides is only 13%, while the pairing efficiencies of dCTP, dTTP, and dGTP are all less than 5%. In contrast, the pairing efficiencies of TPT3, TPT4, and 4TFP with N3-methylated thymine in DNA can reach 78%, 75%, and 41%, respectively. No n+1 product band was detected by TDC. See attached results. Figure 1 TPT3, TPT4, and 4TFP, which can effectively insert into the para position, were selected as candidate bases, and their pairing ability with N3-methylated thymine was further examined.

[0041] II. Measurement of Steady-State Dynamic Parameters

[0042] To further investigate the pairing ability of TPT3 and its analogues with N3-methylated thymine in DNA, the kinetic parameters of single nucleotide insertion were determined. All kinetic parameter determinations were performed under steady-state conditions.

[0043] 1. Dissolve 9 pmol of template and primer in 1× reaction buffer, and anneal and bind to form template / primer complex.

[0044] 2. Mix the template / primer complex with 0.225U KF (exo - Mix DNA polymerase and pre-stabilize at 37°C for 1 min.

[0045] 3. Add nucleotides of different concentrations to start the reaction, and the reaction time is 10 seconds.

[0046] 4. Immediately add 0.05M pH8.0 EDTA to stop the reaction, and then evaporate the water by rotary evaporation.

[0047] 5. Add the reaction residue to 4 μL of 1× single-stranded loading buffer, perform 15 wt% deformed polyacrylamide gel electrophoresis, image with Amersham Imager 680, and perform quantitative analysis using AI600 imaging analysis software.

[0048] 6. Calculate the proportion of the n+1 product (primer 24-mer product) to the total amount of primers, i.e., the yield of the n+1 product, and calculate the initial velocity of the single-base insertion reaction of nucleotides with different concentrations.

[0049] 7. Michaelis-Menten curve fitting was performed using GraphPad Prism 8, and the kinetic parameters of the reaction, such as Vmax, Km, and Vmax / Km, were calculated.

[0050] The results are shown in Table 1 and Figure 2As shown, the Km of TPT3, TPT4, and 4TFP paired with N3-methylated thymine was 87, 43, and 9.7 times lower than that of dATP, respectively, while their Vmax / Km was 82, 42, and 8 times higher than that of dATP. The results indicate that TPT3 has the strongest pairing ability with N3-methylated thymine and can form a specific pair with it.

[0051] Table 1 Steady-state dynamic parameters

[0052]

[0053] a no detectable reaction even if the dNTP concentration was increased to 1.6mM

[0054] Example 2

[0055] TPT3 extension after pairing with N3-methylated thymine in DNA and PCR amplification

[0056] I. Primer Extension Detection

[0057] To investigate the primer extension ability of TPT3 and its analogues after pairing with N3-methylated thymine in DNA, a primer extension experiment was conducted after pairing.

[0058] 1. A 45-mer DNA template containing N3-methylated thymine at position 24 is annealed and bound to a 23-mer primer with a fluorescent label at the 5' end to form a template / primer complex (2.25 pmol).

[0059] 2. The template / primer complex was combined with 4.5U KF (exo - Mix DNA polymerase and pre-stabilize at 37°C for 1 min.

[0060] 3. Add TPT3 or its analogues of triphosphate to initiate the reaction, and the reaction time is 15s.

[0061] 4. Immediately add dCTP to a final concentration of 3 μM, and initiate the primer extension reaction (n+2) for 15 seconds.

[0062] 5. Add 0.05M pH8.0 EDTA to terminate the reaction, and then evaporate the water by rotary evaporation.

[0063] 6. Add the reaction residue to 4 μL of 1× single-stranded loading buffer, perform 15 wt% deformed polyacrylamide gel electrophoresis, image with Amersham Imager 680, and perform quantitative analysis using AI600 imaging analysis software.

[0064] 6. Calculate the proportion of the n+2 (primer 25 polymer product) product to the total amount of primers, i.e., the yield of the n+2 product.

[0065] The results are as follows Figure 3 As shown, when N3-methylated thymine in DNA pairs with TPT3, TPT4, and 4TFP, the elongation efficiency is greater than 50%.

[0066] II. Full-length detection of TPT3 paired with N3-methylated thymine

[0067] 1. A 45-mer DNA template containing N3-methylated thymine at position 24 is annealed and bound to a 23-mer primer with a fluorescent label at the 5' end to form a template / primer complex (2.25 pmol).

[0068] 2. The template / primer complex was combined with 4.5U KF (exo - Mix DNA polymerase and pre-stabilize at 37°C for 1 min.

[0069] 3. The reaction was initiated by adding dNTPs and TPT3, while a control group was prepared by adding dNTPs. The reactions were carried out for 30 s, 60 s, and 120 s, respectively.

[0070] 4. Immediately add 0.05M pH8.0 EDTA to stop the reaction, and then evaporate the water by rotary evaporation.

[0071] 5. Add the reaction residue to 4 μL of 1× single-stranded loading buffer, perform 15 wt% deformed polyacrylamide gel electrophoresis, image with Amersham Imager 680, and perform quantitative analysis using AI600 imaging analysis software.

[0072] 6. Calculate the proportion of the full-length product (primer 45 polymer product) to the total amount of primers, i.e., the yield of the full-length product.

[0073] The results are as follows Figure 3 As shown, when only dNTPs are added to the reaction system, DNA synthesis stops at the N3-methylated thymine site, and only a weak full-length band is observed after 120 s. When TPT3 is added to the reaction system, the efficiency of full-length product formation increases, and 23% of the full-length product is present after 30 s.

[0074] III. PCR amplification and sequencing of DNA containing m3T-TPT3 base pairs

[0075] To further investigate whether TPT3 can be amplified after pairing with N3-methylated thymine in the DNA template, the 64-mer KRAS-m3T sequence was used as a template. PCR amplification and sequencing were performed using Taq, OneTaq, LaTaq, DeepVent, and KOD-plus enzymes. The template and primer sequences are as follows:

[0076] KRAS-m3T:

[0077] CAGGAAACAGCTATGACACTCTTGCCTACGCCAm3TCAGCTCCAACTACACTGGCCGTCGTTTTAC;

[0078] KRP-dF:

[0079] TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAGGAAACAGCTA TGAC;

[0080] KRP-dR:

[0081] TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTAAAACGACGGCCAGT;

[0082] A 400 pM KRAS-m3T template was amplified in a 25 μL reaction system containing 100 μM dTPT3TP, 100 μM dNaMTP, 400 nM primers, and sufficient dNTPs.

[0083] The thermal cycling conditions were: 96℃ for 3 min, (96℃ for 10 s, 50℃ for 15 s, 68℃ or 72℃ for 1 min) × 36 cycles, 68℃ for 6 min. The extension temperature for Taq, LaTaq, and DeepVent was 72℃, and the extension temperature for OneTaq and KOD-plus was 68℃.

[0084] When extension begins, TPT3 first catalyzes the pairing of N3-methylated thymine in the antisense template to form the m3T-TPT3 non-natural base pair. Once the full-length product is generated, NaM is inserted into the sense strand in the subsequent extension reaction to pair with TPT3 in the antisense strand. Thus, the N3-methylated thymine in the template first forms the m3T-TPT3 base pair, and then transforms into the TPT3-NaM base pair at the N3-methylated thymine site. The double-stranded DNA containing the TPT3-NaM base pair undergoes subsequent amplification, producing sufficient amplified products for Sanger sequencing. The sudden termination of the sequencing signal during sequencing of DNA containing the TPT3-NaM base pair is used to determine the N3 methylation modification site.

[0085] The results are shown in Table 2. Common commercial DNA polymerases can effectively amplify KRAS-m3T, and the sequencing results are as follows. Figure 4 As shown, the sequencing signal terminates at the N3-methylated thymine site, suggesting that this method has great potential and universality for the detection of N3-alkylated thymine.

[0086] Table 2. Amplification fold of KRAS-m3T template

[0087]

[0088] Example 3

[0089] Application of m3T-TPT3 novel non-natural base pairs in the detection of low-abundance N3-methylated thymine in DNA

[0090] I. Enrichment capacity and detection limit test

[0091] 1. PCR amplification of low-abundance N3-methylated thymine

[0092] 1) KRAS-m3T was diluted with KRAS-native and genomic fragments at different ratios to enrich N3-methylated thymine to 3.1 × 10⁻⁶. -5 Up to 1.6×10 -6 The obtained sample was used as a DNA template for subsequent PCR amplification.

[0093] 2) Amplification will be carried out in a 25 μL reaction system, co-catalyzed by 0.018 U OneTaq and 0.014 U Deepvent, using biotinylated TPT3 (dTPT3). biotin dNaMTP (final concentration 16 μM) specifically identifies and captures DNA samples with low abundance of N3 methylation damage. The final concentration of dNaMTP is 50 μM. 2+ The concentration was 2.2 mM.

[0094] 3) The thermal cycling conditions are 96℃ for 3 min, (96℃ for 30 s, 55℃ for 20 s, 68℃ for 4 min) × 20 cycles, and 68℃ for 6 min.

[0095] 4) The PCR products were purified using a DNA gel extraction kit and quantified using NanoDrop.

[0096] 2.TPT3 Biotin Enrichment of dsDNA with labeled magnetic beads

[0097] 1) Place 5 μL of magnetic beads into a 100 μL EP tube, place the EP tube on a magnetic separator, and carefully remove the supernatant.

[0098] 2) Resuspend the magnetic beads in 25 μL of adsorption buffer (prepared according to the streptavidin magnetic bead manufacturer's requirements), shake for 15 s, place on a magnetic separator, and carefully aspirate the supernatant.

[0099] 3) Repeat step 2) twice and aspirate the supernatant.

[0100] 4) Take the TPT3 obtained in the previous step Biotin Approximately 1 μg of labeled dsDNA was redissolved in adsorption buffer and added to the magnetic beads obtained in step 3). The beads were resuspended by shaking for 15 seconds and incubated at 37°C for 30 minutes.

[0101] 5) After 30 min, discard the supernatant, resuspend the magnetic beads in 25 μL of adsorption buffer, shake for 15 s, and discard the supernatant.

[0102] 6) Repeat step 5) 3 times.

[0103] 7) Rinse the magnetic beads three times with sterile deionized water.

[0104] 8) Resuspend the magnetic beads in 15 μL of water, heat at 95°C for 3 min, immediately place on a magnetic separator, and collect the supernatant to obtain TPT3. Biotin The labeled dsDNA was stored at 4°C for later use.

[0105] 3. Take the TPT3 obtained in step 2. Biotin Labeled dsDNA was used as a template for PCR amplification in a 25 μL reaction system containing 100 μM dTPT3TP, 100 μM dNaMTP, 400 nM primers, and sufficient dNTPs, catalyzed by OneTaq enzyme. The thermal cycling conditions were: 96℃ for 3 min, (96℃ for 10 s, 50℃ for 15 s, 68℃ for 1 min) × 36 cycles, followed by 68℃ for 6 min.

[0106] The amplified products were used for Sanger sequencing; the results are shown below. Figure 5This method can specifically identify and enrich items with abundance as low as 1.6 × 10⁻⁶. -6 The N3-methylated thymine site is the sequencing signal termination site.

[0107] II. Determination of methyl methanesulfonate-induced thymine alkylation damage in PU19 plasmids of DH5α cells

[0108] 1. Methyl methanesulfonate-induced plasmid alkylation damage

[0109] 1) Transfect DH5α cells with PU19 plasmid and culture them to the logarithmic growth phase.

[0110] 2) DH5α cells containing PU19 plasmid were seeded into freshly prepared LB medium, and methyl methanesulfonate was added to make the final concentration of methyl methanesulfonate 50 μM. The cells were cultured at 37°C until the logarithmic growth phase, and an equal amount of methyl methanesulfonate was added to continue the intervention for 2 hours.

[0111] 3) Harvest the cells obtained in 2) and extract plasmids using the TIANprep Mini Plasmid Kit.

[0112] 4) The plasmid obtained in 3) was digested into mononucleotides using Nucleoside Digestion Mix and analyzed by HPLC with a C18 reversed-phase column. The mobile phase was 0.1M TEAB and acetonitrile (0-20%: 0-40 min, 20-80%: 40-50 min). The eluent was detected at 268 nm.

[0113] 2. Recognition, amplification, and detection of thymine N3-methylated PU19 plasmid induced by methyl methanesulfonate.

[0114] 1) Perform PCR amplification on the plasmid obtained in step 1.

[0115] The primer sequences are as follows:

[0116] PUC-1F: TCACTGGCCGTCGTTTTACA

[0117] PCU-1R: CCGGCGTCAATACGGGATAA

[0118] PUC-2F: TTCCGTGTCGCCCTTATTCC

[0119] PUC-2R: CT GACGCTCAGTGGAACGAA

[0120] PUC-3F:ATCTACACGACGGGGAGTCA

[0121] PUC-3R: CCGCTTACCGGATACCTGTC

[0122] PUC-4F: AGTTACCGGATAAGGCGCAG

[0123] PUC-4R: CGTTGTAAAACGACGGCCAG

[0124] The amplification will be carried out in a 25 μL reaction system, co-catalyzed by 0.018 U OneTaq and 0.014 U Deepvent, using biotinylated TPT3 (dTPT3). biotin dNaMTP (final concentration 16 μM) specifically identifies and captures DNA samples with low abundance of N3 methylation damage. The final concentration of dNaMTP is 50 μM. 2+ The concentration was 2.2 mM.

[0125] The thermal cycling conditions were 96℃ for 3 min, (96℃ for 30 s, 55℃ for 20 s, 68℃ for 4 min) × 20 cycles, and 68℃ for 6 min.

[0126] PCR products were purified using a DNA gel extraction kit and quantified using NanoDrop.

[0127] 2) Enrichment based on streptavidin-biotin band shift

[0128] The PCR amplification product obtained in step 1) was incubated with 10 μg streptavidin at 37°C for 30 min, detected by 6 wt% non-deformable polyacrylamide gel electrophoresis, and stained with Yeared nucleic acid dye. Specific enrichment bands were found in PUC-3 and PUC-4 covering the plasmid replication initiation region.

[0129] 3) Cut the shift band obtained in 2) and place it in a 1.5 mL EP tube. Add 30 μL of sterile deionized water and extract TPT3Biotin-labeled dsDNA using the shaking method. Store at 4 °C for later use.

[0130] 3. TPT3 Biotin-labeled dsDNA amplification and sequencing

[0131] 1) The TPT3Biotin-labeled dsDNA obtained in step 2 was amplified using OneTaq enzyme in the presence of TPT3 and NaM. Simultaneously, a normal plasmid was used as a template for amplification under the same conditions as a control.

[0132] 2) The amplified products were used for Sanger sequencing.

[0133] The results are as follows Figure 6As shown, PUC-3 and PUC-4, which cover the plasmid replication initiation region, have specific enrichment bands. After recovering the DNA from the enriched bands, they were used for PCR amplification. Sequencing results showed that the sequencing signal gradually decreased, and the site where the signal suddenly decreased was the N3 methylated thymine site.

[0134] The above embodiments describe the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are only illustrative of the principles of the present invention. Various changes and modifications can be made to the present invention without departing from the scope of the principles of the present invention, and all such changes and modifications fall within the protection scope of the present invention.

[0135]

[0136]

Claims

1. A non-natural base pair formed by the specific pairing of m3T and TPT3, characterized in that... Its general structural formula is: Where R is an alkyl group, R1 is a hydrogen atom, alkyl, alkenyl, allyl, ynyl, propargyl, biotin group, radioactive isotope-labeled group or fluorescent group, R2 is a hydrogen atom, alkyl, alkenyl, ynyl, propargyl, biotin group, radioactive isotope-labeled group or fluorescent group, and R3 is a hydrogen atom, halogen atom, hydroxyl group, alkyl, alkenyl, ynyl, methoxy group, nitrogen-containing group or sulfur-containing group.

2. The non-natural base pair formed by the specific pairing of m3T and TPT3 according to claim 1, characterized in that: The alkyl groups in R, R1, R2, and R3 are C1-8 alkyl groups, specifically methyl, ethyl, isopropyl, or n-butyl; the alkenyl groups in R1, R2, and R3 are vinyl, propenyl, halovinyl, styryl, or benzene-ring-substituted styryl; the alkynyl groups in R1, R2, and R3 are ethynyl or propynyl; and the biotin groups in R1 and R2 are PEG-biotin, SH-PEG-biotin, N3-PEG-biotin, alkynyl-PEG-biotin, etc. The formulation includes silane-PEG-biotin, aldehyde-PEG-biotin, and amine-PEG-biotin. The radioisotope labeling groups in R1 and R2 are 18F, 123I, 77Br, 99mTc, 186Re, or radiophosphorus-labeled chemical groups. The fluorescent groups in R1 and R2 are FAM, FITC, Cy2, or Hex. The nitrogen-containing group in R3 is an amino group, an azide group, or an imine group. The sulfur-containing group in R3 is a mercapto group, a thiol, or a thioether.

3. The non-natural base pair formed by the specific pairing of m3T and TPT3 according to claim 1, characterized in that: The non-natural base pair formed by the specific pairing of m3T and TPT3 exists in the form of nucleosides, nucleotides, or oligonucleotides containing the non-natural base pair.

4. The use of the non-natural base pair formed by the specific pairing of m3T and TPT3 as described in any one of claims 1-3 in the preparation of products having at least one of the following functions: 1)-8) 1) Recognition of thymine modified by N3 alkylation in DNA; 2) Detection of thymine modified at the N3 position in DNA; 3) Capture or enrichment of DNA fragments containing N3-alkylated thymine DNA fragments; 4) Recognition of uracil modified by N3 alkylation in RNA; 5) Detection of uracil alkylation at the N3 position in RNA; 6) Capture or enrichment of uracil RNA fragments containing N3-alkylated modification; 7) During RNA transcription using DNA as a template, inserting one or more non-natural bases from any pair of non-natural bases in claims 1-3 into a specific site on the RNA; 8) During the reverse transcription of DNA using RNA as a template, damaged bases in the RNA are reverse transcribed into one or more non-natural bases from any pair of non-natural bases in claims 1-3 of the DNA.

5. The application according to claim 4, characterized in that: The product is a reagent kit or a detection product that uses one of the above-mentioned non-natural bases as a component.

Images