Mass spectrometry-based method and kit for red blood cell blood group genotyping

Abstract

The application provides a mass spectrometry-based red blood cell blood type genotyping method and kit, which is based on nucleic acid mass spectrometry, a primer combination is designed, and an amplification reaction condition is improved, so that 61 blood type gene sites in 21 red blood cell blood type systems can be simultaneously detected in 2 reactions, rapid typing of the 21 red blood cell blood type systems is realized, and the identified phenotypes are red blood cell antigen phenotypes with clinical significance, and the application has the characteristics of high sensitivity, strong specificity, simple operation, rapid high throughput, etc. The application can be applied to difficult blood type identification, blood matching, rare blood type screening, scientific research, routine business development and the like in the clinic.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to a method and kit for red blood cell blood type genotyping based on mass spectrometry. Background Technology

[0002] Blood transfusion has a wide range of applications in the medical field and is one of the most effective life-saving support measures. However, while 43 blood group systems and more than 350 blood group antigens have been reported for red blood cells, in my country, only ABO blood group and Rh blood group system D antigen are routinely tested before red blood cell transfusion. Therefore, if incompatible blood group antigens exist between the blood donor and recipient, antibodies may be generated through alloimmunization. Subsequent transfusion of incompatible red blood cell products may cause hemolytic transfusion reactions, which can be life-threatening in severe cases. This is especially true for patients requiring long-term red blood cell transfusions, where the probability of developing single or multiple antibodies increases further, making it difficult to find compatible blood products. Statistics show that the probability of red blood cell sensitization from a single transfusion is about 3%, but this figure can be as high as 60% for patients requiring long-term transfusions. From 2013 to 2017, 17% of transfusion-related deaths reported by the US FDA were caused by hemolytic transfusion reactions due to alloimmunization. Furthermore, red blood cell antibodies generated through immunization are also associated with diseases such as neonatal hemolytic disease. Therefore, comprehensive identification of clinically significant red blood cell antigens in transfusion patients, blood donors, and pregnant women is an effective way to solve complex blood typing problems and improve transfusion efficacy. Rapid, high-throughput blood typing and identification also allows for the pre-screening and stockpiling of rare blood type donors to cope with emergencies.

[0003] Currently, serological methods are routinely used for red blood cell antigen identification in my country. However, most blood group antigens lack commercially available serological testing reagents, or the reagents are too expensive for routine serological testing. Therefore, genotyping methods have become a supplement and alternative to serological methods. Domestic red blood cell antigen genotyping kits are mainly based on low-throughput technologies, such as PCR-SSP. Some laboratories also use self-developed methods, such as PCR-RFLP and sequencing. Internationally, there are already some blood group genotyping products based on medium- and high-throughput technologies, such as gene chip technology, suspension array technology, and mass spectrometry. However, existing medium- and high-throughput blood group genotyping products are mainly targeted at Caucasian populations, and due to differences in the genetic background of different populations, they are not suitable for the Chinese population. my country currently has a significant gap in the development of high- and medium-throughput blood group genotyping methods and kits with independent intellectual property rights. Therefore, to improve the accuracy and breadth of blood group antigen gene diagnosis and increase testing throughput, it is necessary to develop high-throughput blood group genotyping methods suitable for the Chinese population. Nucleic acid mass spectrometry is accurate, rapid, and capable of detecting common mutation types such as SNPs and In / Del, making it suitable for genotyping of blood group antigens.

[0004] CN110079590A provides a method for rare red blood cell antigen genotyping, but it can only detect 29 SNP loci and does not specify the blood group antigens, genotypes, and phenotypes corresponding to the detected loci. Therefore, it cannot be proven to be a clinically applicable method for blood group genotyping. Red blood cell genotypes are very complex; different combinations of different antigen loci result in many blood types, and the same blood type can have multiple genotypes. Therefore, it is necessary to detect more loci simultaneously to achieve higher throughput blood type screening and identification. There is an urgent need to find detection methods and products that can simultaneously detect more red blood cell blood types.

[0005] manual

[0006] To address the problems of existing technologies, this invention provides a mass spectrometry-based method and kit for erythrocyte blood group genotyping. By designing primer combinations and improving amplification reaction conditions, it enables simultaneous detection of 61 blood group gene loci in 21 erythrocyte blood group systems in two reactions, achieving rapid genotyping of these systems. The identified phenotypes are all clinically significant erythrocyte antigen phenotypes, characterized by high sensitivity, strong specificity, ease of operation, and rapid high throughput. This invention can be applied to clinical applications such as difficult blood typing, crossmatching, rare blood type screening, as well as research and routine operations.

[0007] Red blood cell genotypes are highly complex. Different combinations of different antigenic sites result in numerous blood types, and even a single blood type can have multiple genotypes. Therefore, simultaneous detection of more sites is necessary to achieve high-throughput blood type screening and identification. However, detecting more sites simultaneously can lead to low conversion rates in PCR multiplex reactions. Furthermore, due to the presence of highly homologous genes among red blood cell antigen genes, and the presence of GC-rich sequences at some SNP sites, as well as the existence of highly homologous sequences at other SNP sites, mass spectrometry-based simultaneous detection of these SNP sites can result in some sites failing to show peaks or amplifying homologous sequences, leading to erroneous results. This presents a challenge in achieving simultaneous detection of all sites. This invention, through screening numerous primer combinations and adjusting reaction conditions, finally achieves the simultaneous detection of 61 blood group gene sites across 21 red blood cell blood group systems. This enables rapid typing of 21 red blood cell blood group systems with high specificity, sensitivity, and high throughput.

[0008] On one hand, the present invention provides a primer combination for red blood cell blood type genotyping, including amplification primers and extension primers. The amplification primers include forward primers and reverse primers, and the sequences of the amplification primer combination are shown in Table 1:

[0009] Table 1. List of primer combinations for red blood cell blood type genotyping

[0010]

[0011]

[0012] Remark:

[0013] 1) Blood group system names are named according to the International Society of Blood Transfusion (ISBT) Table of blood group systems v.10.0, which lists the system names (system symbols).

[0014] 2) In the phenotype, "blood group system symbol +", such as Co+, I+, etc., indicates that the protein corresponding to the gene encoding the blood group system is wild-type.

[0015] 3) For descriptions of other phenotypes and blood group antigens, refer to The Blood Group Antigen Facts Book (Third Edition).

[0016] Furthermore, the primer combination described above is characterized in that the sequence of the extended primer combination is shown in Table 2:

[0017] Table 2. List of extended primer combinations for erythrocyte blood type genotyping

[0018]

[0019]

[0020]

[0021] The blood type genotype and phenotype information of the 61 blood type gene loci described in this invention are shown in Tables 3 and 4, wherein the sequences in parentheses in Table 4 are polymorphic sites.

[0022] Table 3. Blood type genotype information for 61 blood type gene loci.

[0023]

[0024]

[0025] Remark:

[0026] 1. Some gene polymorphisms are not listed in the genotype-phenotype correspondence because no reports on the corresponding phenotypes of these gene polymorphisms were found.

[0027] 2. ND: Not detected; NA: No information available.

[0028] Table 4. Pre- and post-SNP sequences of 61 blood type gene loci

[0029]

[0030]

[0031]

[0032]

[0033]

[0034] On the other hand, the present invention provides a kit for genotyping, comprising primer combinations as shown in Tables 1 and 2.

[0035] In another aspect, the present invention provides a mass spectrometry chip for genotyping, comprising primer combinations as described in Tables 1 and 2.

[0036] Furthermore, this invention provides a method for genotyping via mass spectrometry detection, comprising the following steps:

[0037] (1) The gene to be tested is amplified by multiplex PCR using the amplification primer mixture in the primer combination as described in claim 1;

[0038] (2) The amplification product obtained in step (1) was purified using alkaline phosphatase;

[0039] (3) Using the extension primer mixture in the primer combination as described in claim 1, the purified product is amplified by single base extension amplification step (2);

[0040] (4) The single-base extension product obtained in step (3) is spotted onto the chip and detected by mass spectrometry.

[0041] Furthermore, in the multiplex PCR reaction described in step (1), the concentration of the amplification primer mixture used is 0.04-0.4 μM (final concentration).

[0042] Furthermore, the amplification reaction system used in the multiplex PCR reaction described in step (1) is shown in Table 5:

[0043] Table 5. Multiplex PCR amplification reaction system

[0044]

[0045] Further, during the multiplex PCR reaction described in step (1), the amplification reaction cycling conditions are: 95℃, 2 minutes; 45 cycles: 95℃, 30 seconds, 56℃, 30 seconds, 72℃, 60 seconds, 72℃, 5 minutes; incubation at 4℃.

[0046] Furthermore, the alkaline phosphatase mentioned in step (2) is shrimp alkaline phosphatase, and the alkaline phosphatase purification treatment premix system mentioned in step (2) is shown in Table 6:

[0047] Table 6. SAP Premixed Liquid System

[0048]

[0049] Furthermore, the single-base extension amplification system described in step (3) is shown in Table 7:

[0050] Table 7. Single-base extension premixed solution system

[0051]

[0052] In another aspect, the present invention provides the use of primer combinations as shown in Tables 1 and 2, or kits as described above, or mass spectrometry chips as described above for genotyping detection of 61 SNP loci in red blood cells simultaneously.

[0053] The beneficial effects of the mass spectrometry-based erythrocyte blood group genotyping method and kit provided by this invention are as follows:

[0054] 1. It can simultaneously detect 61 blood group gene loci in 21 red blood cell blood group systems in 2 reactions;

[0055] 2. Rapid typing of 21 red blood cell blood group systems was achieved, and the identified phenotypes were all clinically significant red blood cell antigen phenotypes;

[0056] 3. High sensitivity, strong specificity, simple operation, fast and high throughput;

[0057] 4. It can be applied to clinical blood type identification, blood matching, rare blood type screening, scientific research, and routine business operations. Attached Figure Description

[0058] Figure 1 The representative detection mass spectrum provided in Example 1;

[0059] Figure 2 The mass spectrum of the rs548254708 site provided in Example 1;

[0060] Figure 3 The mass spectrum of the rs676785 site provided in Example 2 was detected using the initial amplification primers;

[0061] Figure 4 The mass spectrum of homozygous GG→C+c- was obtained by amplifying the primers with the rs676785 site replaced in Example 2.

[0062] Figure 5 The mass spectrum of the heterozygous GC→C+c+ amplified by the amplification primers with the rs676785 site replaced in Example 2 was obtained.

[0063] Figure 6 The mass spectrum of homozygous CC→C-c+ was obtained by amplifying the amplification primers with the rs676785 site replaced in Example 2.

[0064] Figure 7 The mass spectrum of KLF1_19-12996560-T-TG before it was replaced with rs586178 provided in Example 3;

[0065] Figure 8 The mass spectrum of KLF1_19-12996560-T-TG after replacing it with rs586178 provided in Example 3;

[0066] Figure 9 After replacing rs586178 with rs586178 as provided in Example 3, the corresponding amplification primer concentration was adjusted to 3 times, and the detection mass spectrum of KLF1_19-12996560-T-TG was obtained.

[0067] Figure 10 The mass spectrum of rs483352838 before being replaced with rs586178 provided in Example 3;

[0068] Figure 11 The mass spectrum of rs483352838 after replacing rs586178 with rs483352838 provided in Example 3;

[0069] Figure 12 The mass spectrum of rs483352838 was obtained after replacing rs586178 with rs586178 and adjusting the amplification primer concentration to 2 times.

[0070] Figure 13 The mass spectrum of rs7683365 before primer replacement provided in Example 4;

[0071] Figure 14 The mass spectrum of the detection after changing the amplification primers for rs7683365 provided in Example 4;

[0072] Figure 15 The mass spectrum of rs778387354 before primer replacement provided in Example 5;

[0073] Figure 16 The detection mass spectrum of rs778387354 after the amplification primers were changed, as provided in Example 5;

[0074] Figure 17 The detection mass spectrum obtained when performing single-base extension on the extension primer rs483352838-v1 provided in Example 6;

[0075] Figure 18 The detection mass spectrum obtained when performing single-base extension on the extension primer rs483352838-v2 provided in Example 6;

[0076] Figure 19 The detection mass spectrum obtained when performing single-base extension on the extension primer rs483352838-v3 provided in Example 6;

[0077] Figure 20 The detection mass spectrum obtained when performing single-base extension on the extension primer rs483352838-v4 provided in Example 6. Detailed Implementation

[0078] The present invention will be further described in detail below with reference to embodiments. It should be noted that the embodiments described below are intended to facilitate understanding of the present invention and are not intended to limit it in any way. The reagents used in this embodiment are all known products and were obtained by purchasing commercially available products.

[0079] Example 1: Methods and Procedures for Red Blood Cell Blood Type Gene Detection

[0080] This embodiment employs simultaneous detection of 61 blood group gene loci in 21 red blood cell blood group systems on the blood gene DNA of 155 cases, thereby enabling rapid blood group genotyping.

[0081] The genotyping detection in this embodiment includes the following steps:

[0082] 1. Sample preparation:

[0083] Genes were extracted from 155 blood samples and homogenized to a concentration of 5-20 ng / μL before being used in subsequent detection experiments.

[0084] 2. Primer design

[0085] This embodiment targets clinically significant blood group antigens, especially difficult blood types that may occur in clinical practice in my country. Based on their genetic background in the Chinese population, PCR amplification primers and single-base extension probes were designed. The primer sequences are shown in Table 8.

[0086] Table 8. Primer Combination List

[0087]

[0088]

[0089] Remark:

[0090] 1) Blood group system names are named according to the International Society of Blood Transfusion (ISBT) Table of blood group systems v.10.0, which lists the system names (system symbols).

[0091] 2) In the phenotype, "blood group system symbol +", such as Co+, I+, etc., indicates that the protein corresponding to the gene encoding the blood group system is wild-type.

[0092] 3) For descriptions of other phenotypes and blood group antigens, refer to The Blood Group Antigen Facts Book (Third Edition).

[0093] 3. Testing Steps

[0094] 1) PCR amplification

[0095] Using all the amplification primer combinations shown in Table 8 (including forward and reverse primers), the test sample obtained in step 1 was amplified by multiplex PCR to obtain the target sequence amplification product of the test sample.

[0096] The PCR amplification reaction system is shown in Table 9:

[0097] Table 9. Multiplex PCR amplification reaction system

[0098]

[0099] The PCR amplification reaction cycling conditions were: 95℃, 2 minutes; 45 cycles: 95℃, 30 seconds, 56℃, 30 seconds, 72℃, 60 seconds, 72℃, 5 minutes; incubation at 4℃.

[0100] 2) Shrimp alkaline phosphatase (SAP) treatment

[0101] The remaining dNTPs were treated with shrimp alkaline phosphatase (SAP) to prevent interference with subsequent base extension. The SAP premix system is shown in Table 10.

[0102] Table 10. SAP Premixed Liquid System

[0103]

[0104] After PCR amplification in step 1), add 2 μl of SAP premixed solution to each well of the 96-well plate, bringing the total volume to 7 μl. Then, perform the SAP reaction in the amplification instrument. The reaction program is as follows: 37°C for 40 minutes; 85°C for 5 minutes; and incubate at 4°C.

[0105] 3) Base extension

[0106] Using all the extension primer combinations shown in Table 8, the purified product from step 2) was amplified via single-base extension. In this round of amplification, a sequence-specific single base was extended to the 3' end of the extension probe as a molecular weight marker. The single-base extension premix system is shown in Table 11.

[0107] Table 11. Extended Premixed Liquid System

[0108]

[0109] In step 2), 2 μl of extension premix was added to each well of the 96-well plate after treatment with shrimp alkaline phosphatase (SAP), and the total volume after adding the premix was 9 μl. The extension reaction was then carried out in the amplification instrument.

[0110] The single-base extension reaction procedure is as follows: 95℃, 30 seconds; (95℃, 5 seconds; (52℃, 5 seconds, 80℃, 5 seconds; 5 cycles) 40 cycles); 72℃, 3 minutes; 4℃, hold.

[0111] 4) Resin desalination

[0112] Add 41 μl of HPLC water to each sample well, and use resin to desalt the sample and purify the extended reaction product.

[0113] 5) Mass spectrometry detection

[0114] The sample was spotted onto the chip (manufacturer: Agena Bioscience, model: SpectroCHIP CPM96), and the molecular weight was detected by mass spectrometry to determine the specific base types and the type of the sample to be tested.

[0115] 6) Results Analysis

[0116] Mass spectrometry was performed on 155 samples, and all loci showed good results in all samples (mass spectrometry software rating: A (Conservative) or B (Mordarate)). Representative mass spectra obtained are shown below. Figure 1 As shown, the mass spectrum for detecting site rs548254708 is as follows. Figure 2As shown. Serological verification was performed on 36 randomly selected samples to identify the antigen gene loci from which corresponding blood type antibodies could be obtained. The blood type antibodies used included: anti-C, -c, -E, -e, -S, -s, -K, -k, and -Fy. a -Fy b , -Jk a , -Jk b -Lu a , -Lu b And -CD59. Sequencing verification was performed on antigen gene loci for which no blood group antibodies were found. Mass spectrometry-based erythrocyte blood typing results were completely consistent with serological or sequencing results. Sensitivity = true positive result / (true positive result + false negative result) * 100% = 100%, Specificity = number of true negatives / (number of true negatives + number of false positives) * 100% = 100%.

[0117] Table 12. Statistical analysis of serological verification results

[0118]

[0119] Table 13. Statistics of sequencing validation results

[0120]

[0121]

[0122]

[0123] Example 2: Exploration of a method for detecting the C locus of blood type

[0124] The initial target for detecting blood type C / c in this embodiment was rs676785. During preliminary validation, it was found that rs676785 did not yield good detection results. This may be because the DNA region containing the rs676785 site contains highly homologous sequences. After incorporating it into the RBC panel (erythrocyte ensemble), mass spectrometry-based detection of rs676785 could result in some sites not showing peaks and thus not being detected, or it could easily amplify homologous sequences within the rs676785 site's DNA region, leading to erroneous results. After extensive experimental screening, rs586178 was finally selected as the detection target.

[0125] Initial primers for amplification and extension of rs676785:

[0126] Upstream: ACGTTGGATGCGAAACTCCGTCTCAAAAAA

[0127] Downstream: ACGTTGGATGCTTGGGCTTCCTCACCTCAAA

[0128] UEP (Extension Primer): CTGAGCCAGTTCCCT

[0129] The primers were used to amplify and extend rs676785, and the results were obtained by mass spectrometry. Figure 3 As shown.

[0130] The amplification and extension primers were then replaced with rs586178 primers:

[0131] Upstream: ACGTTGGATGAGGCCAGCACAGCCAGCCTTG (SEQ ID NO: 10)

[0132] Downstream: ACGTTGGATGATTTGCTCCTGTGACCACTG (SEQ ID NO: 11)

[0133] UEP: TaTGTCCGGCCGCTGCCTGCCCCTCTG (SEQ ID NO: 12)

[0134] The primers were used to amplify and extend rs586178, and the results were obtained by mass spectrometry. Figure 4 , 5 As shown in Figures 6 and 6, Figure 4 The homozygous GG→C+c- form ellipsees at 8113. Figure 5 It is a heterozygous GC→C+c+, with peaks at 8113 and 8153. Figure 6 It is a homozygous CC→C-c+, with a peak at 8153.

[0135] Depend on Figure 3 It is evident that when targeting blood type C / c using the rs676785 locus in multiplex PCR, the presence of highly homologous sequences resulted in no peak and undetectable results. However, replacing the rs586178 locus yielded stable and accurate results. Before switching to the rs586178 locus, the inventors experimented with many other loci, all of which exhibited unstable results, no peak, and undetectable results when incorporated into the RBC panel for multiplex PCR. The rs586178 locus was the only site that finally resolved the genotyping problem for blood type C / c.

[0136] Example 3: Selection of primer concentration and determination of 61 blood group gene loci

[0137] This embodiment designs an RBC panel based on the rs586178 locus detection for blood group C / c determined in Example 2. The initial design targeted 62 loci (in addition to the 61 loci listed in the specification, it also included rs75731670). Results showed that replacing rs586178 affected the detection of blood group Lu (ab-), causing unstable peaks for KLF1_19-12996560-T-TG and rs483352838, and also affecting the detection of the rs75731670 locus. In this embodiment, the concentrations of the amplification primers for these three sites were adjusted (the concentrations of each primer before adjustment were all between 0.04-0.4 μM (final concentration)). It was found that when the concentration of the amplification primer KLF1_19-12996560-T-TG was adjusted to three times its original concentration (0.04-0.4 μM), and the concentration of rs483352838 was adjusted to twice its original concentration (0.04-0.4 μM), detection results could be obtained. However, after multiple concentration adjustments to the primer rs75731670, stable detection results could not be obtained. Therefore, the detection of rs75731670 was removed from the system, resulting in an RBC panel of 61 sites.

[0138] The detection spectra of KLF1_19-12996560-T-TG before and after the replacement with rs586178 are as follows: Figure 7 and Figure 8 As shown, before replacing with rs586178, KLF1_19-12996560-T-TG had a high peak at 7782, while after replacing with rs586178, the peak at 7782 of KLF1_19-12996560-T-TG decreased significantly. The detection spectrum after adjusting the amplification primer concentration of KLF1_19-12996560-T-TG to three times the original concentration is shown below. Figure 9 As shown, KLF1_19-12996560-T-TG shows a significantly increased peak at 7782, which can be used for genotyping detection.

[0139] The detection spectra of rs483352838 before and after replacing it with rs586178 are as follows: Figure 10 and Figure 11 As shown, before replacing rs483352838 with rs586178, the peak value at 7076 was relatively high. However, after replacing it with rs586178, the peak value of rs483352838 at 7076 decreased significantly. The detection spectrum after adjusting the amplification primer concentration of rs483352838 to twice the original concentration (0.04-0.4 μM) is shown in the figure. Figure 12As shown, rs483352838 shows a significant increase in peak value at 7076, which can be used for genotyping detection.

[0140] Example 4: The effect of adjusting the amplification primers for the blood group S / s locus rs7683365 on the detection results

[0141] Based on Example 3, the RBC panel was further optimized. During subsequent validation, it was found that the two peak values ​​of the heterozygous peak at the rs7683365 site of blood group S / s differed significantly, easily leading to misjudgment. Multiple experiments were conducted on the amplification primers, and they were subsequently replaced with a more suitable set of primers.

[0142] Initial rs7683365 amplification primers:

[0143] Upstream: ACGTTGGATGGAAACCCGCAGAACAGTTTG

[0144] Downstream: ACGTTGGATGACAGTGAAACGATGGACAAG

[0145] Finally, it was changed to:

[0146] Upstream: ACGTTGGATGTGATTAAGAAAAGGAAACCCG (SEQ ID NO: 151)

[0147] Downstream: ACGTTGGATGGGCTTGGCCTCCCAAAATTAT (SEQ ID NO: 152)

[0148] Stable results can be obtained after replacement. The detection spectrum is as follows: Figure 13 and Figure 14 As shown. Among them. Figure 13 The image shows the detection pattern of rs7683365 before primer replacement. Figure 14 The detection spectrum after changing the amplification primers for rs7683365. Although Figure 17 The two peaks (at 4839 and 4855) of the heterozygote are still not of equal height. However, by adjusting the angle of the dividing lines of each region according to the position distribution of multiple specific samples in the result graph, the true experimental value can be defined and the correct result can be obtained.

[0149] Example 5 Blood type P k The effect of adjusting the extension primer at the + / p site rs778387354 on detection results

[0150] Based on Example 4, to further verify the system's accuracy, an RBC panel was designed, and blood type P was discovered. kThe detection result for the rs778387354 site (+ / p) was not displayed correctly. Analysis of the results revealed that the extension primers for rs778387354 were prone to errors when using existing RBC panels. After several primer adjustments, the extension primers for rs778387354 were replaced.

[0151] Initial rs778387354 extension primer:

[0152] UEP: cccagtCCACGTCCAGGGCAC

[0153] Finally, it was changed to:

[0154] UEP: TGGAACAAGAAGAGCCAGGGCAC (SEQ ID NO: 141)

[0155] The results have been verified to be correct. The test results are as follows: Figure 15 and Figure 16 As shown. Among them. Figure 15 To extend the detection spectrum before primer replacement, no peak was observed at the expected peak position of 6624 (a non-specific peak was observed at 6664). Figure 16 To extend the detection spectrum after primer replacement, a peak was observed at 7428, which can be used for blood typing P. k Detection of genotyping at the rs778387354 locus with + / p.

[0156] Example 6: Detection method and primer screening for the rs483352838 locus

[0157] Based on Example 5, the accuracy of the system was further verified and the RBC panel was further optimized. After analyzing the rs483352838 site of the Lu(ab-) blood type, it was found that this detection site is a GC-rich region containing repetitive sequences. This caused the UEP extension primers targeting this site to bind to sequences other than the SNP site to be detected. Subsequently, multiple UEP primers were used to detect this site, and it was found that none of the primers could stably display results.

[0158] UEP (extension primer) sequence of rs483352838:

[0159] rs483352838-v1:gCCCGAGGAGgCGGCGCCGGGC (SEQ ID NO: 117)

[0160] rs483352838-v2:aGAGCCCGGCGCCGGGCGCCGGG

[0161] rs483352838-v3:aaGTGTACCCGGGGCCCGGCGCC

[0162] rs483352838-v4:ttattGAGCCCGGCGCCGGGCGCCGGG (SEQ ID NO: 114)

[0163] When single-base extension was performed using four extension primers, the detection spectra obtained were as follows: Figures 17-20 As shown, where Figure 17 The detection mass spectrum obtained when performing single-base extension of the extension primer rs483352838-v1; Figure 18 The detection mass spectrum obtained when performing single-base extension of primer rs483352838-v2; Figure 19 The detection mass spectrum obtained when performing single-base extension of primer rs483352838-v3; Figure 20 The detection mass spectrum obtained when performing single-base extension of primer rs483352838-v4.

[0164] Depend on Figures 17-20 As can be seen, rs483352838-v1 correctly displayed the results for all wild-type samples (peak at 7076), while rs483352838-v4 correctly displayed the results for all mutant samples (peak at 8292). However, rs483352838-v2 and rs483352838-v3 failed to produce stable results. Therefore, we amplified and extended the two primers separately in two reaction wells and then performed detection. By combining the detection results from the two wells for the same site, we were able to perform genotyping on the samples and finally obtain stable results for simultaneously detecting both wild-type and mutant samples at the rs483352838 site.

[0165] While the present invention has been disclosed above, it is not limited thereto. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the invention; therefore, the scope of protection of the present invention should be determined by the scope defined in the claims. sequence list <110> Shanghai Blood Center <120> A mass spectrometry-based method and kit for red blood cell blood typing <160> 186 <170> SIPOSequenceListing 1.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <400> 1 acgttggatg attggggatgt ttccagccgt 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <400> 2 acgttggatg tggaaacctg tggcatcctc 30 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <400> 3 aaggtgctgc tgcctgcg 18 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <400> 4 acgttggatg agccatgaag aagatgaacc 30 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <400> 5 acgttggatg tgctgtgcaa cattaagccc 30 <210> 6 <211> 17 <212> DNA <213> Artificial Sequence <400> 6 ccctgactgt ggtcttc 17 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <400> 7 acgttggatg tgttctcggt tttccctggc 30 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <400> 8 acgttggatg aagagcctga ggaggcctat 30 <210> 9 <211> 15 <212> DNA <213> Artificial Sequence <400> 9 gttcctgccc ccagc 15 <210> 10 <211> 31 <212> DNA <213> Artificial Sequence <400> 10 acgttggatg aggccagcac agccagcctt g 31 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <400> 11 acgttggatg atttgctcct gtgaccactg 30 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <400> 12 tatgtccggc gctgcctgcc cctctg 26 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <400> 13 acgttggatg ccctcttctt gtggatgttc 30 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <400> 14 acgttggatg acatggcatt cttcctttgg 30 <210> 15 <211> 17 <212> DNA <213> Artificial Sequence <400> 15 aggacttctc agcagag 17 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <400> 16 acgttggatg tgacttaggg atgaaggctc 30 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <400> 17 acgttggatg tggtgggaca tccttatcag 30 <210> 18 <211> 17 <212> DNA <213> Artificial Sequence <400> 18 tggtgactcc atttctg 17 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <400> 19 acgttggatg aactgtccta acccaactgc 30 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <400> 20 acgttggatg gctttggtaa tgagacacgc 30 <210> twenty one <211> twenty one <212> DNA <213> Artificial Sequence <400> twenty one caatcagatg aacaattgac g 21 <210> twenty two <211> 30 <212> DNA <213> Artificial Sequence <400> twenty two acgttggatg ccagcgagtt caagaagaag 30 <210> twenty three <211> 30 <212> DNA <213> Artificial Sequence <400> twenty three acgttggatg cagaaccgat gctgatgaag 30 <210> twenty four <211> 20 <212> DNA <213> Artificial Sequence <400> twenty four caatgctgat gaagacaaag 20 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <400> 25 acgttggatg caaaccatct ctgaggacac 30 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <400> 26 acgttggatg gcttgactca cttggttctg 30 <210> 27 <211> 17 <212> DNA <213> Artificial Sequence <400> 27 tcgaggggtg ggacaag 17 <210> 28 <211> 29 <212> DNA <213> Artificial Sequence <400> 28 acgttggatg tgatgtggcc cacactctg 29 <210> 29 <211> 30 <212> DNA <213> Artificial Sequence <400> 29 acgttggatg aatacccggt ggggaacaac 30 <210> 30 <211> 15 <212> DNA <213> Artificial Sequence <400> 30 ggaacaacca gacgg 15 <210> 31 <211> 30 <212> DNA <213> Artificial Sequence <400> 31 acgttggatg aaattcctgg cgagaaggac 30 <210> 32 <211> 30 <212> DNA <213> Artificial Sequence <400> 32 acgttggatg tgaagaactt acgattgcag 30 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <400> 33 tgcagaactc ttcaatatct 20 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <400> 34 acgttggatg tgaagaactt acgattgcag 30 <210> 35 <211> 30 <212> DNA <213> Artificial Sequence <400> 35 acgttggatg aaattcctgg cgagaaggac 30 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <400> 36 cgccttaagg gcagtcaatg 20 <210> 37 <211> 30 <212> DNA <213> Artificial Sequence <400> 37 acgttggatg agaaatcatg ccctaatccg 30 <210> 38 <211> 30 <212> DNA <213> Artificial Sequence <400> 38 acgttggatg tgagaaggag atggttgcac 30 <210> 39 <211> twenty one <212> DNA <213> Artificial Sequence <400> 39 ctacatcaat ctgaccattt c 21 <210> 40 <211> 30 <212> DNA <213> Artificial Sequence <400> 40 acgttggatg tttaaaagat gttggaattg 30 <210> 41 <211> 30 <212> DNA <213> Artificial Sequence <400> 41 acgttggatg taatggtcac gttccccttg 30 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <400> 42 ggtgtcaatt tgtggtggtg 20 <210> 43 <211> 30 <212> DNA <213> Artificial Sequence <400> 43 acgttggatg acgttcctga agatgagcgg 30 <210> 44 <211> 30 <212> DNA <213> Artificial Sequence <400> 44 acgttggatg agtgctgtgg gtggtgaagt 30 <210> 45 <211> twenty one <212> DNA <213> Artificial Sequence <400> 45 aggtggtggt gaagtccacg c 21 <210> 46 <211> 30 <212> DNA <213> Artificial Sequence <400> 46 acgttggatg agagtcatcc agcaggttac 30 <210> 47 <211> 30 <212> DNA <213> Artificial Sequence <400> 47 acgttggatg tgattccttcccagatggag 30 <210> 48 <211> 18 <212> DNA <213> Artificial Sequence <400> 48 gcccagatgg agactatg 18 <210> 49 <211> 30 <212> DNA <213> Artificial Sequence <400> 49 acgttggatg ctgacctcag attcttgtcc 30 <210> 50 <211> 30 <212> DNA <213> Artificial Sequence <400> 50 acgttggatg acaatgtcca ttatggtggg 30 <210> 51 <211> 17 <212> DNA <213> Artificial Sequence <400> 51 ctccattctg ccatccg 17 <210> 52 <211> 30 <212> DNA <213> Artificial Sequence <400> 52 acgttggatg tctgaagtca cggcagtttc 30 <210> 53 <211> 29 <212> DNA <213> Artificial Sequence <400> 53 acgttggatg tctgcctcca ccacaatgc 29 <210> 54 <211> twenty three <212> DNA <213> Artificial Sequence <400> 54 ttcccccacc acaatgcata cta 23 <210> 55 <211> 30 <212> DNA <213> Artificial Sequence <400> 55 acgttggatg atgcatcctg gactggaaac 30 <210> 56 <211> 30 <212> DNA <213> Artificial Sequence <400> 56 acgttggatg tagaagcatg gaacgagagc 30 <210> 57 <211> twenty four <212> DNA <213> Artificial Sequence <400> 57 cttttgtctg tcttccatgt cact 24 <210> 58 <211> 30 <212> DNA <213> Artificial Sequence <400> 58 acgttggatg gcttggtgaa ttaaccagcc 30 <210> 59 <211> 30 <212> DNA <213> Artificial Sequence <400> 59 acgttggatg ttcttttgca ggccactatg 30 <210> 60 <211> 25 <212> DNA <213> Artificial Sequence <400> 60 tatgtacatg gtatttgtatctatg 25 <210> 61 <211> 29 <212> DNA <213> Artificial Sequence <400> 61 acgttggatg ctgcctcctg accatgcaa 29 <210> 62 <211> 30 <212> DNA <213> Artificial Sequence <400> 62 acgttggatggatgtggagg tgaagttttc 30 <210> 63 <211> twenty three <212> DNA <213> Artificial Sequence <400> 63 gctcttggtg gacatattta gtt 23 <210> 64 <211> 30 <212> DNA <213> Artificial Sequence <400> 64 acgttggatg tagaagcatg gaacgagagc 30 <210> 65 <211> 30 <212> DNA <213> Artificial Sequence <400> 65 acgttggatg atgcatcctg gactggaaac 30 <210> 66 <211> 25 <212> DNA <213> Artificial Sequence <400> 66 ctagtagcct caccgtggca gcctc 25 <210> 67 <211> 30 <212> DNA <213> Artificial Sequence <400> 67 acgttggatg gacataggcc aaagggaatg 30 <210> 68 <211> 30 <212> DNA <213> Artificial Sequence <400> 68 acgttggatg tgtcccttgc aaggattacc 30 <210> 69 <211> 19 <212> DNA <213> Artificial Sequence <400> 69 cggattacct gacccagaa 19 <210> 70 <211> 30 <212> DNA <213> Artificial Sequence <400> 70 acgttggatg tgagcttaat acctaccccc 30 <210> 71 <211> 30 <212> DNA <213> Artificial Sequence <400> 71 acgttggatg gggttgtatc gcagtttcac 30 <210> 72 <211> 18 <212> DNA <213> Artificial Sequence <400> 72 tgattgaggg ttctttcg 18 <210> 73 <211> 30 <212> DNA <213> Artificial Sequence <400> 73 acgttggatg gcaaggtgct attgaaagcc 30 <210> 74 <211> 30 <212> DNA <213> Artificial Sequence <400> 74 acgttggatg acgtggagaa aaatggtcgc 30 <210> 75 <211> twenty three <212> DNA <213> Artificial Sequence <400> 75 aagtggtcgc tacagcatct ctc 23 <210> 76 <211> 30 <212> DNA <213> Artificial Sequence <400> 76 acgttggatg catctacttt ggactctggg 30 <210> 77 <211> 30 <212> DNA <213> Artificial Sequence <400> 77 acgttggatg aagagccagg aggtgggttt 30 <210> 78 <211> 16 <212> DNA <213> Artificial Sequence <400> 78 gagcgccatg aacatt 16 <210> 79 <211> 30 <212> DNA <213> Artificial Sequence <400> 79 acgttggatg aaatgtccgt gctgtgtctc 30 <210> 80 <211> 30 <212> DNA <213> Artificial Sequence <400> 80 acgttggatg tggcattgta gccatagagc 30 <210> 81 <211> 19 <212> DNA <213> Artificial Sequence <400> 81 cccagatgct attaatgac 19 <210> 82 <211> 30 <212> DNA <213> Artificial Sequence <400> 82 acgttggatg ctcctgtctt aacaggactc 30 <210> 83 <211> 30 <212> DNA <213> Artificial Sequence <400> 83 acgttggatg cagagagctg ttgaaacccc 30 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <400> 84 ccagagtcca aagtagatgt 20 <210> 85 <211> 29 <212> DNA <213> Artificial Sequence <400> 85 acgttggatg tgacttagta ttgtctcac 29 <210> 86 <211> 30 <212> DNA <213> Artificial Sequence <400> 86 acgttggatg atatcgaggc tgatgaatgg 30 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <400> 87 aatggagaag atgattgttc 20 <210> 88 <211> 30 <212> DNA <213> Artificial Sequence <400> 88 acgttggatg cacaaccatt gcatcttggc 30 <210> 89 <211> 30 <212> DNA <213> Artificial Sequence <400> 89 acgttggatg cagacaagga agacataccg 30 <210> 90 <211> twenty two <212> DNA <213> Artificial Sequence <400> 90 agacataccg taaatccata tc 22 <210> 91 <211> 30 <212> DNA <213> Artificial Sequence <400> 91 acgttggatg cgacctgcca atttcaaatg 30 <210> 92 <211> 30 <212> DNA <213> Artificial Sequence <400> 92 acgttggatg atcagccaaa gcacttaccc 30 <210> 93 <211> twenty two <212> DNA <213> Artificial Sequence <400> 93 gcaaacccac taatacttac tt 22 <210> 94 <211> 30 <212> DNA <213> Artificial Sequence <400> 94 acgttggatg ggaaatggcc atactgactc 30 <210> 95 <211> 30 <212> DNA <213> Artificial Sequence <400> 95 acgttggatg cgcatctctg gtaaatggac 30 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <400> 96 ttccttaaac tttaaccgaa 20 <210> 97 <211> 30 <212> DNA <213> Artificial Sequence <400> 97 acgttggatg gaacggtggt aacttaccag 30 <210> 98 <211> 30 <212> DNA <213> Artificial Sequence <400> 98 acgttggatg ctggtgcaat atattgaccg 30 <210> 99 <211> 15 <212> DNA <213> Artificial Sequence <400> 99 ttgaccgttc tccca 15 <210> 100 <211> 30 <212> DNA <213> Artificial Sequence <400> 100 acgttggatg agggctcaga ttacctgtag 30 <210> 101 <211> 30 <212> DNA <213> Artificial Sequence <400> 101 acgttggatg tccttgattg ccacaggttg 30 <210> 102 <211> twenty two <212> DNA <213> Artificial Sequence <400> 102 gagagggcac ctacattatc ca 22 <210> 103 <211> 30 <212> DNA <213> Artificial Sequence <400> 103 acgttggatg tgtggctgct tgtcgtggag 30 <210> 104 <211> 30 <212> DNA <213> Artificial Sequence <400> 104 acgttggatg ctgaacttga tccagatgcc 30 <210> 105 <211> 19 <212> DNA <213> Artificial Sequence <400> 105 tcgatgccca ttgccagac 19 <210> 106 <211> 30 <212> DNA <213> Artificial Sequence <400> 106 acgttggatg caagttctca gctgcaaacg 30 <210> 107 <211> 30 <212> DNA <213> Artificial Sequence <400> 107 acgttggatg tctggatcaa gttcaggcac 30 <210> 108 <211> 16 <212> DNA <213> Artificial Sequence <400> 108 ctggtctcct gctcct 16 <210> 109 <211> 29 <212> DNA <213> Artificial Sequence <400> 109 acgttggatg tacaccggtt gcagcgcca 29 <210> 110 <211> 29 <212> DNA <213> Artificial Sequence <400> 110 acgttggatg ggctcccgac gccttcgtg 29 <210> 111 <211> 25 <212> DNA <213> Artificial Sequence <400> 111 ggctccagcc ccggccccccg agccc 25 <210> 112 <211> 29 <212> DNA <213> Artificial Sequence <400> 112 acgttggatg aaggcgctgg cgctgcaac 29 <210> 113 <211> 29 <212> DNA <213> Artificial Sequence <400> 113 acgttggatg aggcactgaa agcccggtc 29 <210> 114 <211> 26 <212> DNA <213> Artificial Sequence <400> 114 ttattgagcc ggcgccgggc gccggg 26 <210> 115 <211> 29 <212> DNA <213> Artificial Sequence <400> 115 acgttggatg aaggcgctgg cgctgcaac 29 <210> 116 <211> 29 <212> DNA <213> Artificial Sequence <400> 116 acgttggatg aggcactgaa agcccggtc 29 <210> 117 <211> twenty two <212> DNA <213> Artificial Sequence <400> 117 gcccgaggag gcggcgccgg gc 22 <210> 118 <211> 29 <212> DNA <213> Artificial Sequence <400> 118 acgttggatg acagaccgac cgctcggga 29 <210> 119 <211> 30 <212> DNA <213> Artificial Sequence <400> 119 acgttggatg gtgtcgtgca ttgtgacctg 30 <210> 120 <211> 19 <212> DNA <213> Artificial Sequence <400> 120 gatatcagcc gaggctagg 19 <210> 121 <211> 30 <212> DNA <213> Artificial Sequence <400> 121 acgttggatg caaagtactt cttccagtcc 30 <210> 122 <211> 30 <212> DNA <213> Artificial Sequence <400> 122 acgttggatg aagaagtggt gttccatccg 30 <210> 123 <211> 16 <212> DNA <213> Artificial Sequence <400> 123 tcaccaccct gccccc 16 <210> 124 <211> 30 <212> DNA <213> Artificial Sequence <400> 124 acgttggatg tacattttca tggcctcgtg 30 <210> 125 <211> 30 <212> DNA <213> Artificial Sequence <400> 125 acgttggatg tccacgtgtg gaacaagaag 30 <210> 126 <211> 19 <212> DNA <213> Artificial Sequence <400> 126 tcatgcccgc tactgcccc 19 <210> 127 <211> 29 <212> DNA <213> Artificial Sequence <400> 127 acgttggatg tgcacggccg cgtaccagt 29 <210> 128 <211> 30 <212> DNA <213> Artificial Sequence <400> 128 acgttggatg tcacttctga gctgcttccc 30 <210> 129 <211> twenty two <212> DNA <213> Artificial Sequence <400> 129 tctgagctgc ttcccgaatg tc 22 <210> 130 <211> 30 <212> DNA <213> Artificial Sequence <400> 130 acgttggatg tcacttctga gctgcttccc 30 <210> 131 <211> 29 <212> DNA <213> Artificial Sequence <400> 131 acgttggatg tgcacggccg cgtaccagt 29 <210> 132 <211> 16 <212> DNA <213> Artificial Sequence <400> 132 gtcggccagg ggtgtg 16 <210> 133 <211> 30 <212> DNA <213> Artificial Sequence <400> 133 acgttggatg agaagtgaga tgcccaggtg 30 <210> 134 <211> 30 <212> DNA <213> Artificial Sequence <400> 134 acgttggatg acttcctgtt catgtgctcg 30 <210> 135 <211> 15 <212> DNA <213> Artificial Sequence <400> 135 tgctcggtgg agtcg 15 <210> 136 <211> 30 <212> DNA <213> Artificial Sequence <400> 136 acgttggatg agaagtgaga tgcccaggtg 30 <210> 137 <211> 30 <212> DNA <213> Artificial Sequence <400> 137 acgttggatg acttcctgtt catgtgctcg 30 <210> 138 <211> twenty two <212> DNA <213> Artificial Sequence <400> 138 atcccacgtg ctggtcctga tg 22 <210> 139 <211> 30 <212> DNA <213> Artificial Sequence <400> 139 acgttggatg tacattttca tggcctcgtg 30 <210> 140 <211> 30 <212> DNA <213> Artificial Sequence <400> 140 acgttggatg tccacgtgtg gaacaagaag 30 <210> 141 <211> twenty three <212> DNA <213> Artificial Sequence <400> 141 tggaacaaga agagccaggg cac 23 <210> 142 <211> 30 <212> DNA <213> Artificial Sequence <400> 142 acgttggatg ggtcataatg gtgtggttgc 30 <210> 143 <211> 30 <212> DNA <213> Artificial Sequence <400> 143 acgttggatg tgtgacgttt gctggcgatg 30 <210> 144 <211> 15 <212> DNA <213> Artificial Sequence <400> 144 caccgtggaa agact 15 <210> 145 <211> 30 <212> DNA <213> Artificial Sequence <400> 145 acgttggatg tcttcccgaa ggtggtcgtg 30 <210> 146 <211> 30 <212> DNA <213> Artificial Sequence <400> 146 acgttggatg actttcttcc accatctccg 30 <210> 147 <211> 18 <212> DNA <213> Artificial Sequence <400> 147 gggaacagat ccgcagag 18 <210> 148 <211> 29 <212> DNA <213> Artificial Sequence <400> 148 acgttggatg aagaggcgca gagtgtgct 29 <210> 149 <211> 30 <212> DNA <213> Artificial Sequence <400> 149 acgttggatg gcataacctg cagatagtcc 30 <210> 150 <211> 19 <212> DNA <213> Artificial Sequence <400> 150 ttccgatagt ccccacggc 19 <210> 151 <211> 31 <212> DNA <213> Artificial Sequence <400> 151 acgttggatg tgattaagaa aaggaaaccc g 31 <210> 152 <211> 31 <212> DNA <213> Artificial Sequence <400> 152 acgttggatg ggcttggcctcccaaaattat 31 <210> 153 <211> 15 <212> DNA <213> Artificial Sequence <400> 153 tggacaagtt gtccc 15 <210> 154 <211> 30 <212> DNA <213> Artificial Sequence <400> 154 acgttggatg ttgatctccc caccgagaag 30 <210> 155 <211> 30 <212> DNA <213> Artificial Sequence <400> 155 acgttggatg agcgtgaggc ctcttctgtg 30 <210> 156 <211> 16 <212> DNA <213> Artificial Sequence <400> 156 gctgctgccg tcctcc 16 <210> 157 <211> 30 <212> DNA <213> Artificial Sequence <400> 157 acgttggatg agcgtgaggc ctcttctgtg 30 <210> 158 <211> 29 <212> DNA <213> Artificial Sequence <400> 158 acgttggatg acagcatgca gccccagga 29 <210> 159 <211> twenty four <212> DNA <213> Artificial Sequence <400> 159 atcatgcagc cccaggagag ccac 24 <210> 160 <211> 30 <212> DNA <213> Artificial Sequence <400> 160 acgttggatg agcgtgaggc ctcttctgtg 30 <210> 161 <211> 30 <212> DNA <213> Artificial Sequence <400> 161 acgttggatg ttgatctccc caccgagaag 30 <210> 162 <211> 19 <212> DNA <213> Artificial Sequence <400> 162 aggcagcagg gacggagtc 19 <210> 163 <211> 29 <212> DNA <213> Artificial Sequence <400> 163 acgttggatg gagacaccag cctgctatg 29 <210> 164 <211> 30 <212> DNA <213> Artificial Sequence <400> 164 acgttggatg ctgtgtccag cacagaagag 30 <210> 165 <211> 25 <212> DNA <213> Artificial Sequence <400> 165 cagcacagaa gaggcctcac gctgc 25 <210> 166 <211> 30 <212> DNA <213> Artificial Sequence <400> 166 acgttggatg cacctccagt tggttctcac 30 <210> 167 <211> 30 <212> DNA <213> Artificial Sequence <400> 167 acgttggatg aagatgatcc agaagagggc 30 <210> 168 <211> 25 <212> DNA <213> Artificial Sequence <400> 168 caaggccacgccgcccagcaccttc 25 <210> 169 <211> 30 <212> DNA <213> Artificial Sequence <400> 169 acgttggatg agcgtgaggc ctcttctgtg 30 <210> 170 <211> 30 <212> DNA <213> Artificial Sequence <400> 170 acgttggatg ttgatctccc caccgagaag 30 <210> 171 <211> 18 <212> DNA <213> Artificial Sequence <400> 171 catcccgctg cagcccca 18 <210> 172 <211> 31 <212> DNA <213> Artificial Sequence <400> 172 acgttggatg ggtgtaaccc ctctcttctc c 31 <210> 173 <211> 30 <212> DNA <213> Artificial Sequence <400> 173 acgttggatg cggtccgacc actcattaga 30 <210> 174 <211> twenty four <212> DNA <213> Artificial Sequence <400> 174 ctactcctcc accagcttct cctc 24 <210> 175 <211> 30 <212> DNA <213> Artificial Sequence <400> 175 acgttggatg atgcagagct gctggtgacg 30 <210> 176 <211> 30 <212> DNA <213> Artificial Sequence <400> 176 acgttggatg atgcccagga aagcagagac 30 <210> 177 <211> 20 <212> DNA <213> Artificial Sequence <400> 177 aataagagac agggcccccg 20 <210> 178 <211> 29 <212> DNA <213> Artificial Sequence <400> 178 acgttggatg agcctcccca tgggtgaag 29 <210> 179 <211> 30 <212> DNA <213> Artificial Sequence <400> 179 acgttggatg caggtgtaac ccctctcttc 30 <210> 180 <211> 15 <212> DNA <213> Artificial Sequence <400> 180 ctcggaggct cccag 15 <210> 181 <211> 30 <212> DNA <213> Artificial Sequence <400> 181 acgttggatg gaagagaggg gttacacctg 30 <210> 182 <211> 29 <212> DNA <213> Artificial Sequence <400> 182 acgttggatg cttctggaac cgcttcctc 29 <210> 183 <211> 19 <212> DNA <213> Artificial Sequence <400> 183 ggggcgcttc ctccccaaa 19 <210> 184 <211> 30 <212> DNA <213> Artificial Sequence <400> 184 acgttggatg tcttccggtt ctccttcgtg 30 <210> 185 <211> 30 <212> DNA <213> Artificial Sequence <400> 185 acgttggatg agctagccac tagttacctg 30 <210> 186 <211> 17 <212> DNA <213> Artificial Sequence <400> 186 agttacctgc aggccgt 17

Claims

1. A kit for red blood cell blood type genotyping, characterized in that, This includes amplification primers and extension primers. The amplification primers include forward primers and reverse primers. The sequences of the amplification primers are shown in the table below: ； The sequences of the extension primers are shown in the table below: 。 2. A mass spectrometry chip for red blood cell blood type genotyping, characterized in that, Includes the amplification primers and extension primers in the kit as described in claim 1.

3. A method for red blood cell blood type genotyping using mass spectrometry, characterized in that, For non-disease diagnostic purposes, the following steps are included: (1) The gene to be tested is amplified by multiplex PCR using the amplification primers in the kit as described in claim 1; (2) The amplification product obtained in step (1) of alkaline phosphatase purification treatment; (3) Using the extension primers in the kit as described in claim 1, the purified product is amplified by single-base extension step (2); (4) The single-base extension product obtained in step (3) is spotted onto the chip and detected by mass spectrometry.

4. The method as described in claim 3, characterized in that, The amplification reaction system used in the multiplex PCR reaction described in step (1) is shown in the table below: 。 5. The method as described in claim 4, characterized in that, In step (1), the amplification reaction cycle conditions for the multiplex PCR reaction are: 95℃, 2 minutes; 45 cycles: 95℃, 30 seconds, 56℃, 30 seconds, 72℃, 60 seconds, 72℃, 5 minutes; and incubation at 4℃.

6. The method according to any one of claims 3-5, characterized in that, The premixed solution system for alkaline phosphatase purification in step (2) is shown in the table below: 。 7. The method according to any one of claims 3-5, characterized in that, The single-base extension amplification system described in step (3) is shown in the table below: 。 8. The use of the kit as described in claim 1 or the mass spectrometry chip as described in claim 2 for genotyping detection of 61 SNP loci on red blood cells simultaneously, characterized in that, For non-disease diagnostic purposes.

Images