LAMP detection primer set for detecting pseudorabies virus and application thereof

Abstract

The application discloses a LAMP detection primer group for detecting pseudorabies virus and application thereof, and belongs to the technical field of biology. The LAMP detection primer group for detecting the pseudorabies virus comprises F3 shown as SEQ ID NO. 1, B3 shown as SEQ ID NO. 2, FIP shown as SEQ ID NO. 3 and BIP shown as SEQ ID NO. 4. The primer used in the application is designed at a position of a gB segment of the pseudorabies virus, so that amplification failure caused by the primer being located at a high mutation region position can be reduced, and the LAMP is used to amplify the pseudorabies virus, so that detection becomes more simple and convenient, and meanwhile, the LAMP can be applied to detection in the first line of breeding clinics.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a LAMP detection primer set for detecting pseudorabies virus and its application. Background Technology

[0002] Animal vaccines are products used by livestock and poultry to prevent and control infectious diseases. Their production level and quality safety are closely related to maintaining animal health and human safety. Compared with ordinary medicines, vaccines are characterized by complex production processes, long production cycles, and high requirements for the production environment. Only by effectively identifying various risks throughout the entire vaccine production process can we comprehensively control factors affecting vaccine quality and ensure product quality and safety.

[0003] Cross-contamination is the most common production risk in vaccine manufacturing. Throughout the entire vaccine production process, there is a risk of cross-contamination in the use, feeding, preparation, packaging, freeze-drying, handover, and cleaning of materials and strains, which can affect vaccine safety and lead to adverse effects such as product spoilage, increased production costs, and longer production cycles.

[0004] Pseudorabies virus (PRV) is the pathogen of pseudorabies, which can cause abortion, stillbirth, mummified fetuses, and weak piglets in pregnant sows, as well as high morbidity and mortality in newborn piglets. The disease is widespread throughout the world, and its prevalence has been reported in more than 50 countries and regions, posing a significant threat to the global pig industry.

[0005] Currently, there are two main methods for diagnosing exogenous viral contamination during vaccine production: cell culture and molecular biology. Cell culture methods have long detection cycles, significantly impacting vaccine production timelines, and the results are easily influenced by subjective factors. Molecular biology methods include conventional PCR or real-time quantitative PCR, both of which offer accuracy rates exceeding 99%. However, both methods require expensive equipment and specialized personnel for operation and result interpretation; therefore, they are primarily used in universities, research institutions, and professional testing companies.

[0006] Therefore, it is particularly important to obtain a method that can free pseudorabies virus detection from cumbersome experimental procedures and expensive instruments, making pseudorabies virus detection simpler, more convenient, and more flexible, while also being applicable to the rapid detection of pseudorabies virus contamination in the front line of animal vaccine production. Summary of the Invention

[0007] The purpose of this invention is to provide a LAMP detection primer set for detecting pseudorabies virus and its application, so as to solve the problems existing in the prior art. By designing LAMP detection primers and constructing a LAMP detection system, this invention gets rid of the constraints of cumbersome experimental procedures and expensive instruments, making pseudorabies virus detection simpler, more convenient and more flexible, and can also be applied to the rapid detection of pseudorabies virus contamination in the front line of animal vaccine production.

[0008] To achieve the above objectives, the present invention provides the following solution:

[0009] This invention provides a LAMP primer set for pseudorabies virus detection, including primer F3 as shown in SEQ ID NO.1, primer B3 as shown in SEQ ID NO.2, primer FIP as shown in SEQ ID NO.3, and primer BIP as shown in SEQ ID NO.4.

[0010] This invention also provides the application of a LAMP detection primer set in the preparation of products for detecting pseudorabies virus.

[0011] Furthermore, the product is a reagent or kit.

[0012] The present invention also provides a pseudorabies virus detection product, comprising the LAMP detection primer set as described in claim 1.

[0013] Furthermore, the pseudorabies virus detection product also includes reaction buffer, calcein, MnCl2, MgSO4, betaine, DNA polymerase, ddH2O, and dNTPs.

[0014] Furthermore, the reaction system of the pseudorabies virus detection product is as follows: 2.5 μL 10×Reaction Buffer, 0.5-4 μL dNTP, 0.5-3 μL betaine, 0.5-2.5 μL MgSO4, 1-2 μL MnCl2, 1-2 μL calcein, 1 μL ddH2O, 0.5-1 μL LF3, 0.5-1 μL LB3, 1-4 μL LFIP, 1-4 μL LBIP, 1 μL DNA Polymerase, and 1 μL template DNA.

[0015] Furthermore, the reaction system comprises: 2.5 μL 10×Reaction Buffer, 2.5 μL dNTP, 2 μL betaine, 1.5 μL MgSO4, 1.5 μL MnCl2, 1.5 μL calcein, 1.5 μL ddH2O, 1 μL each of F3 and B3, 4 μL each of FIP and BIP, 1 μL DNAPolymerase, and 1 μL template DNA.

[0016] The present invention also provides an application of the LAMP detection primer set or the pseudorabies virus detection product described herein in the quality detection of pseudorabies virus vaccines.

[0017] By employing a highly efficient Bst DNA polymerase with strand displacement activity, LAMP can react rapidly under isothermal conditions, thus achieving high efficiency. Through comparisons of sensitivity and specificity, the LAMP method is identical to the PCR method. Furthermore, in the detection of clinical samples, the LAMP method exhibits a higher detection rate, indicating that the LAMP method may have advantages over the PCR method in clinical applications.

[0018] The detection method for the amplified products of this product primarily employs a colorimetric reaction. During the LAMP reaction, along with the synthesis of a large amount of DNA, a byproduct, pyrophosphate ions, is also produced. The working principle of the calcein fluorescent chromogenic agent is that calcein reacts with the byproduct pyrophosphate ions. Initially, calcein binds to the fluorescence quencher manganese ions and does not fluoresce. Because pyrophosphate ions more readily bind to manganese ions, calcein is released. The free calcein then spontaneously fluoresces, and this fluorescence effect is enhanced in the presence of magnesium ions. If the concentrations of calcein and manganese ions are appropriate, the fluorescence colorimetric judgment result can be consistent with the turbidimetric result. The application of the fluorescent chromogenic agent is simpler and more intuitive: it is added directly to the reaction system without the need for additional instruments and equipment; the results can be directly observed with the naked eye, and the color development is obvious. Furthermore, the reaction tube does not need to be opened from the start of the reaction to the interpretation of the results, which can effectively avoid false positives caused by the formation of aerosols.

[0019] The reason for adding betaine to the system is that it helps DNA pass smoothly through certain complex secondary structures of DNA, preventing DNA polymerase from detaching from the template DNA. If a local region of DNA contains multiple complex bases (Py-CG), it can cause DNA polymerase to stop, ultimately leading to the cessation of effective DNA elongation. Betaine can enhance the hydration of guanine and adenine-rich regions in the minor groove of DNA, altering the flexibility of the DNA molecule and helping DNA polymerase elongate along the DNA template. Furthermore, betaine can eliminate the base dependence of denaturation temperature and reduce the impact of high GC content on Tm, making the primer Tm in LAMP more similar.

[0020] The present invention discloses the following technical effects:

[0021] 1. This invention uses LAMP to amplify pseudorabies virus, making detection simpler and more convenient, and can also be applied to clinical detection in animal husbandry.

[0022] 2. The primers used in this invention are designed to be located in the gB segment of pseudorabies virus, which can reduce amplification failure caused by primers being located in highly mutated regions.

[0023] 3. This invention uses two sets of primers, which greatly improves the specificity of this invention against pseudorabies virus.

[0024] 4. This invention uses calcein as a fluorescent colorimetric agent, making the result judgment more direct and observable.

[0025] 5. The experimental steps have been optimized based on the original technology, omitting the intermediate heat shock step and reducing the probability of aerosol contamination caused by repeated opening of the lid. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 The fluorescence reaction was validated for the LAMP system, where 1: pMD19T-gB, 2: blank control;

[0028] Figure 2 The gel electrophoresis diagram is used to validate the LAMP system, where 1: pMD19T-gB, 2: blank control;

[0029] Figure 3 The fluorescence reaction of LAMP after omitting the heat shock step is shown in the figures: 1: blank control, 2: heat shock, 3: heat shock omitted.

[0030] Figure 4 To determine the fluorescence reaction of LAMP after varying primer amounts, the following values ​​were used: 1: 1 μL, 1 μL, 1 μL, 1 μL; 2: 1 μL, 1 μL, 2 μL, 2 μL; 3: 1 μL, 1 μL, 3 μL, 3 μL; 4: 1 μL, 1 μL, 4 μL, 4 μL.

[0031] Figure 5 To measure the fluorescence reaction of LAMP after varying the amount of dNTPs, the values ​​were: 1: 0.5 μL, 2: 1 μL, 3: 1.5 μL, 4: 2 μL, 5: 2.5 μL, 6: 3 μL, 7: 4 μL, and 8: blank control.

[0032] Figure 6 To measure the fluorescence reaction of LAMP after varying the amount of Betaine, the following values ​​were used: 1: 0.5 μL; 2: 1 μL; 3: 1.5 μL; 4: 2 μL; 5: 2.5 μL; 6: 3 μL; 7: blank control.

[0033] Figure 7 To measure the fluorescence reaction of LAMP after varying the amount of MgSO4 used, the values ​​were: 1: 0.5 μL, 2: 1 μL, 3: 1.5 μL, 4: 2 μL, 5: 2.5 μL, and 6: blank control.

[0034] Figure 8 The figure shows the optimized dosage results of Calein and MnCl2, where 1: ddH2O, 2: Calein 1μL, MnCl2 1μL, 3: Calein 1.5μL, MnCl2 0.75μL, 4: Calein 1.5μL, MnCl2 1μL, 5: Calein 1.5μL, MnCl2 2.5μL, and 6: Calein 2μL, MnCl2 2μL.

[0035] Figure 9 The image shows the results of LAMP-specific detection, where 1: ddH2O, 2: pseudorabies virus Bartha-K61 strain, 3: pseudorabies virus HB-98 strain, 4: porcine reproductive and respiratory syndrome virus JXA1-R strain, 5: porcine epidemic diarrhea virus CV777 strain, 6: porcine circovirus type 2 SH strain, 7: classical swine fever virus C strain, and 8: porcine transmissible gastroenteritis virus attenuated strain.

[0036] Figure 10 This is a graph showing the results of LAMP universal detection, where 1 represents ddH2O and 2-9 represent nucleic acids from PRV-positive samples.

[0037] Figure 11 This is a graph showing the LAMP sensitivity detection results, where 1: ddH2O, 2: 10⁻⁰, 3: 10⁻⁰. -1 4:10 -2 5:10 -3 6:10 -4 7:10 -5 8:10 -6 9:10 -7 10:10 -8 11:10 -9 12:10 -10 13:10 -11 14:10 -12 15:10 -13 16:10 -14 17:10 -15 18:10 -16 ;

[0038] Figure 12 This is an electrophoresis image of the products for LAMP sensitivity detection, where M: Marker; 1: Negative control; 2: 10⁻⁶. -0 3:10-1 4:10 -2 5:10 -3 6:10 -4 7:10 -5 8:10 -6 9:10 -7 10:10 -8 11:10 -9 12:10 -10 13:10 -11 14:10 -12 15:10 -13 16:10 -14 17:10 -15 18:10 -16 . Detailed Implementation

[0039] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0040] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0041] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0042] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0043] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0044] Example 1

[0045] 1. Primer design

[0046] The known PRV genome sequence was downloaded from NCBI, the gB fragment was aligned, conserved regions were selected, and primers were designed using the Lamp online primer design software PrimerExplorer v5. Two primer pairs were then selected for subsequent synthesis. The primer sequences are shown in Table 1.

[0047] Table 1 Primer sequences

[0048]

[0049] 2. Extraction of viral nucleic acid from experimental template and control group

[0050] The plasmid gB-19T was constructed in the laboratory. Using the genome of a wild-type PRV strain from the South China tiger preserved in the laboratory as a template, the full sequence of the gB gene was amplified in vitro using the PRV gB protein expression primers “GGAATTCCATATGCCCGCTGGTGGCGGTCTTTG (SEQ ID NO.5)” and “CGCGGATCCCTAGGGGGCGTCGGGGTCCTCG (SEQ ID NO.6)”. After purification and recovery, the plasmid was ligated with pMD19-T (TAKARA) overnight, chemically transformed into DH5α competent cells, and cultured at 37°C for 1 hour. The cells were then evenly spread on LB (Amp+) agar plates and cultured overnight at 37°C. The next day, suspected clones were picked, identified by PCR, and confirmed by sequencing before being used in this experiment.

[0051] According to the plasmid extraction kit instructions, the gB-19T plasmid was extracted. The specific procedure is briefly described below: Take 5 mL of overnight cultured bacterial culture, add it to a centrifuge tube, centrifuge at 10000 rpm, discard the culture medium, and invert the tube onto absorbent paper to remove excess liquid. Add 250 μL of Buffer P1 to the bacterial pellet, gently mix using a pipette, then add 250 μL of Buffer P2, mix by inverting, then add 350 μL of Buffer P3, mix again by inverting until white flocculent matter appears, and centrifuge at 13000 rpm for 10 min. After centrifugation, aspirate the supernatant and add it to an adsorption column, centrifuge at 13000 rpm for 1 min, and discard the filtrate. Add 600 μL of Buffer PW2 (PW2 diluted with anhydrous ethanol), let stand for 1 min, then centrifuge at 13000 rpm for 1 min. Repeat twice. Remove the centrifuged strain, open the cap and place it in a clean bench for 10 min. Then add 30 μL of RNase-free ddH2O, centrifuge for 1 min to obtain the plasmid, and store it at -20℃.

[0052] Following the instructions of the viral DNA / RNA extraction kit, nucleic acids were extracted from pseudorabies virus (Bartha-K61 strain, HB-98 strain), porcine circovirus type 2 SH strain, porcine epidemic diarrhea virus CV777 strain, porcine reproductive and respiratory syndrome virus JXA1-R strain, classical swine fever live vaccine CVCCAV1412 strain, porcine transmissible gastroenteritis virus (TGE) strain, and pseudorabies virus-positive clinical samples. The procedure was briefly described as follows: 200 μL of diluted vaccine was placed in a 1.5 mL RNase-free centrifuge tube, 400 μL of lysis buffer LB was added, and the mixture was vortexed for 15 s, then incubated at room temperature for 10 min. Then, 450 μL of cooled anhydrous ethanol was added and mixed. The premixed solution was transferred to an adsorption column and centrifuged at 12000 rpm for 1 min, discarding the waste liquid. 500 μL of protein removal buffer PL was added, and the mixture was centrifuged at 12000 rpm for 1 min. Then, 500 μL of wash buffer Wb was added, and the mixture was centrifuged at 12000 rpm for 1 min. Centrifuge the adsorption column to remove excess liquid, then open the cap and let it stand at room temperature for 2 minutes. Add 40 μL of N-ase-free ddH2O, centrifuge at 12000 rpm for 1 minute to obtain viral nucleic acid. Store the DNA virus nucleic acid at -20℃ for later use.

[0053] Following the instructions of the Yisheng Reverse Transcription Kit, the nucleic acid of the RNA virus was synthesized into cDNA and stored at -80℃.

[0054] 3. Construction of the LAMP system

[0055] Referring to Table 2, add all substances except DNAPolymerase to the PCR tubes. Place the PCR tubes in a metal bath and incubate at 95°C for 1 min (heat shock), then remove and place in an ice box to cool for 2 min. Add 1 μL of DNAPolymerase and mix thoroughly by pipetting. Place in a metal bath and incubate at 60°C for 1 h. After removal, observe the presence or absence of fluorescence reaction with the naked eye.

[0056] Tube 1 was used as a template for LAMP reaction with plasmid gB-19T, and the results are as follows. Figure 1 As shown: After treatment at 60℃ for 1 hour, tube 1 showed a visible fluorescence reaction, changing from yellow to fluorescent green. Tube 2, the control tube, only had ddH2O added as a template, and no visible fluorescence reaction was observed; the color remained yellow.

[0057] To further verify the accuracy of the results, 2% agarose gel electrophoresis was used to detect the products after the reaction in tubes 1 and 2. The results are as follows: Figure 2 As shown: the product in tube 1 showed obvious gradient bands after gel running, while the product in tube 2 did not show gradient bands.

[0058] Table 2 LAMP System Composition

[0059]

[0060] 4. LAMP reaction optimization

[0061] 4.1 Optimization of the reaction procedure

[0062] To verify whether the heat shock step affected the experimental results, referring to Table 2, 2.5 μL of 10×Reaction Buffer, 3 μL of dNTP, 2 μL of Betaine, 1.5 μL of MgSO4, 1.5 μL of LMnCl2, 1.5 μL of Calcein, 1 μL of ddH2O, 1 μL each of F3 and B3, 4 μL each of FIP and BIP, 1 μL of DNA Polymerase, and 1 μL of template were added to the PCR tubes. The heat shock step (i.e., incubation at 95℃ for 1 min) was omitted, and the tubes were directly placed in a metal bath at 60℃ for 1 h. After removal, the presence or absence of fluorescence reaction was observed visually.

[0063] Tube 1, using ddH2O as a template, served as a negative control. Tubes 2 and 3, using plasmid gB-19T as a template, served as the experimental group. Tubes 1 and 2 were run with a program including the heat shock step, while tube 3 was run with a program omitting the heat shock step. The LAMP results after removing the heat shock step were verified as follows. Figure 3 As shown, after omitting the heat shock step, tube 1 did not show a fluorescent reaction after the reaction, proving that no contamination occurred. Tubes 2 and 3 both showed fluorescent reactions. This proves that omitting the heat shock step has no impact on the establishment of the entire LAMP system.

[0064] 4.2 Optimization of primer dosage

[0065] To verify the optimal primer usage, the primer dosage was optimized. 1 μL of LF3 / B3 primers and 1 μL, 2 μL, 3 μL, and 4 μL of LFIP / BIP primers were added to the reaction system, respectively, and the mixture was placed directly in a metal bath at 60°C for 1 h, with fluorescence intensity observed. The optimized primer usage ratios are shown below. Figure 4 As shown, from tube 1 to tube 4, the fluorescence reaction becomes more pronounced with increasing F3 / B3 and FIP / BIP ratios and amounts. Tube 4 exhibits the highest fluorescence intensity, and its product bands are also the clearest in the electrophoresis diagram.

[0066] The optimal usage amounts for F3 / B3 Primers and FIP / BIP primers are 1 μL and 4 μL, respectively.

[0067] 4.3 Optimization of dNTP dosage

[0068] To verify the optimal amount of dNTPs used, 0.5 μL, 1 μL, 1.5 μL, 2 μL, 2.5 μL, 3 μL, 3.5 μL, and 4 μL of dNTPs were added to the reaction system, which was then placed directly in a metal bath and incubated at 60 °C for 1 h. After amplification, the optimal amount of dNTPs was determined based on the fluorescence reaction.

[0069] Tube 8, using ddH2O as a template, served as a negative control; tubes 1-7, using plasmid gB-19T as a template, served as the experimental group. The optimization results for the amount of dNTPs are as follows: Figure 5 As shown, tube 8 did not exhibit fluorescence after the reaction and remained yellow, indicating no contamination. Tubes 1-5 changed from yellow to a visible fluorescent green, demonstrating that the fluorescence increased with increasing dNTP concentration. However, when the NTP concentration exceeded 2.5 μL (i.e., tubes 5-7), there was no significant difference in color change, and the brightness of the product bands observed in the electrophoresis images showed no significant difference. Therefore, the optimal dNTP concentration is set at 2.5 μL.

[0070] 4.4 Optimization of Betaine Dosage

[0071] To verify the optimal dosage of Betaine, 0.5 μL, 1 μL, 1.5 μL, 2 μL, 2.5 μL, and 3 μL of Betaine were added to the reaction system and placed directly in a metal bath at 60 °C for 1 h. After amplification, the dosage of Betaine was determined by the fluorescence reaction after amplification.

[0072] Tube 7, using ddH2O as a template, served as a negative control; tubes 1-6, using plasmid gB-19T as a template, served as the experimental group. The optimization results for the Betaine dosage are as follows: Figure 6 As shown, tube 7 did not exhibit fluorescence after the reaction and remained yellow, indicating no contamination. For tubes 1-6, the amount of Betaine was changed sequentially. Visual observation showed no significant color difference in tube 6, and electrophoresis revealed no significant difference in the brightness of the product bands, demonstrating that adding 0.5 μL-3 μL of Betaine effectively promoted the LAMP reaction.

[0073] 4.5 Optimization of MgSO4 dosage

[0074] To verify the optimal amount of MgSO4, 0.5 μL, 1 μL, 1.5 μL, 2 μL, and 2.5 μL of MgSO4 were added to the reaction system, placed directly in a metal bath, and incubated at 60 °C for 1 h. After amplification, the amount of MgSO4 was determined by the fluorescence reaction after amplification.

[0075] Tube 6, using ddH2O as a template, served as a negative control; tubes 1-5, using plasmid gB-19T as a template, served as the experimental group. The optimization results for the amount of MgSO4 are as follows: Figure 7 As shown, tube 6 did not exhibit fluorescence after the reaction and remained yellow, indicating no contamination. For tubes 1-5, the amount of MgSO4 was changed sequentially. Visual observation showed no significant color difference in tube 5, and electrophoresis revealed no significant difference in the brightness of the product bands, demonstrating that adding 0.5 μL-2.5 μL of MgSO4 effectively promoted the LAMP reaction.

[0076] 4.6 Optimization of Calcein and MnCl2

[0077] To verify the optimal amounts of Calcein and manganese ions, 1 μL, 1.5 μL, 1.5 μL, 1.5 μL, and 2 μL of Calcein and 1 μL, 0.75 μL, 1 μL, 2.5 μL, and 2 μL of MnCl2 were added to the reaction system, which was then placed directly in a metal bath and incubated at 60 °C for 1 h. After amplification, the amounts of both were determined by observing the fluorescence reaction after amplification.

[0078] Tube 1, using ddH2O as a template, served as a negative control; tubes 2-6, using plasmid gB-19T as a template, served as the experimental group. The optimization results for the fluorescence reaction are as follows: Figure 8 As shown, tube 1 did not exhibit fluorescence after the reaction, remaining yellow, indicating no contamination. Tubes 2, 3, 4, and 6 all showed significant fluorescence, changing from yellow to green. Tube 5 showed no significant fluorescence, remaining yellow. This indicates that when the MnCl2 content exceeds that of Calcein, MnCl2 inhibits the fluorescence reaction. Based on fluorescence intensity, the optimal ratio of Calcein to MnCl2 is 1:1.

[0079] 5. LAMP reaction specificity detection

[0080] To verify the specificity of this product, DNA or cDNA of PRV, porcine circovirus type 2, and other viral vaccine strains were used as templates for LAMP with optimized DNA, and the results were observed visually.

[0081] Tube 1, using ddH2O as a template, served as a negative control. Tubes 2-8, using the nucleic acids extracted in 1.3 as templates, served as the experimental groups, and LAMP reactions were performed. The reaction system and conditions were the same as in 4.2. The specificity results of LAMP are as follows: Figure 9As shown, tube 1 did not show a fluorescent reaction after the reaction, and the color remained yellow, indicating no contamination. Both reactions using pseudorabies virus Bartha-K61 and pseudorabies virus HB-98 as templates showed fluorescent reactions, changing from yellow to green. Reactions using other viral vaccine strains as templates did not show fluorescent reactions, and the color remained yellow. This demonstrates that the product has sufficient accuracy in detecting pseudorabies virus.

[0082] 6. Universality detection of LAMP reactions

[0083] To verify the universality of this product, the nucleic acid of 8 PRV positive clinical samples was used as a template, and the optimized LAMP system was used to detect these 8 positive samples. The detection method was the same as in 4.2, and the results were observed by visual inspection.

[0084] Tube 1 used ddH2O as a template and served as a negative control. Tubes 2-8 used nucleic acid from laboratory-preserved pseudorabies virus-positive samples as templates and served as the experimental groups. The general applicability of LAMP experiments is as follows: Figure 10 As shown, tube 1 did not show any fluorescence after the reaction and remained yellow, indicating no contamination. Tubes 2-9, using laboratory-preserved clinical positive samples as templates, all showed visible fluorescence, changing from yellow to green, demonstrating the product's suitability for most positive samples.

[0085] 7. LAMP response sensitivity detection

[0086] To verify the sensitivity of the LAMP method established by this product, plasmid gB-19T, initially at a concentration of 2.085 mg / μL, was serially diluted 10-fold to a final concentration of 10. -16 Take 10 respectively 0 -10 -16 The diluted sample was used as a template for LAMP sensitivity detection, and the detection method was the same as in 4.2.

[0087] Tube 1 used ddH2O as a template and served as a negative control. Tubes 2-18 used plasmids of gB-19T diluted 10-fold serially as templates and served as the experimental groups. The sensitivity of LAMP was verified as follows: Figure 11 As shown, the electrophoresis pattern of the product is as follows. Figure 12 As shown, tube 1 did not exhibit fluorescence after the reaction and remained yellow, indicating no contamination. Tubes 2 through 16 all showed visible fluorescence, changing from yellow to green. This demonstrates the high sensitivity of the product.

[0088] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A LAMP primer set for detecting pseudorabies virus, characterized in that, It consists of primer F3 as shown in SEQ ID NO.1, primer B3 as shown in SEQ ID NO.2, primer FIP as shown in SEQ ID NO.3, and primer BIP as shown in SEQ ID NO.

4.

2. The application of the LAMP detection primer set as described in claim 1 in the preparation of a product for detecting pseudorabies virus.

3. The application according to claim 2, characterized in that, The product is a reagent or kit.

4. A pseudorabies virus detection product, characterized in that, Includes the LAMP detection primer set as described in claim 1.

5. The pseudorabies virus detection product according to claim 4, characterized in that, The pseudorabies virus detection product also includes reaction buffer, calcein, MnCl2, MgSO4, betaine, DNA polymerase, ddH2O, and dNTPs.

6. The pseudorabies virus detection product according to claim 5, characterized in that, The reaction system for the pseudorabies virus detection product is as follows: 2.5µL 10×Reaction Buffer, 0.5-4µL dNTP, 0.5-3µL betaine, 0.5-2.5µL MgSO4, 1-2µL MnCl2, 1-2µL calcein, 1µL ddH2O, 0.5-1µL F3, 0.5-1µL B3, 1-4µL FIP, 1-4µL BIP, 1µL DNA Polymerase, and 1µL template DNA.

7. The pseudorabies virus detection product according to claim 6, characterized in that, The reaction system consisted of: 2.5 µL 10× Reaction Buffer, 2.5 µL dNTP, 2 µL betaine, 1.5 µL MgSO4, 1.5 µL MnCl2, 1.5 µL calcein, 1.5 µL ddH2O, 1 µL each of F3 and B3, 4 µL each of FIP and BIP, 1 µL DNA Polymerase, and 1 µL template DNA.

8. The application of the LAMP detection primer set as described in claim 1 or the pseudorabies virus detection product as described in any one of claims 4-7 in the quality testing of pseudorabies virus vaccines.

Images