Recombinant humanized type iii collagen, preparation method and application thereof

Abstract

The application discloses a kind of recombinant humanized type III collagen, preparation method and application thereof.The recombinant humanized type III collagen contains 480 amino acids, theoretical molecular weight is about 44kd, and the constructed pichia pastoris gene engineering bacteria can effectively and stably express recombinant humanized type III collagen in large quantities.The recombinant humanized collagen of the application is rich in multiple integrin binding motifs, has good hydrophilicity, is 100% identical with the corresponding part of natural collagen gene sequence, and has better cell adhesion, proliferation and migration activity, and has potential application prospect in the field of biological medical materials, cosmetics and the like.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology and relates to a recombinant humanized type III collagen, its preparation method, and its application. Background Technology

[0002] Collagen is the most abundant protein family in the extracellular matrix (ECM), accounting for approximately 25-30% of total protein. It plays a variety of biological functions, including delivering growth factors and cytokines, maintaining tissue integrity, and influencing cell adhesion and proliferation. Collagen possesses unparalleled advantages over other synthetic materials, such as biocompatibility, biodegradability, and scalability for mass production. It can be used not only in health foods, beauty products, and packaging materials, but also as a food additive, making it another ingredient with applications spanning medicine, aesthetics, cosmetics, and food, following hyaluronic acid.

[0003] Currently, the main methods for producing collagen include traditional extraction, chemical synthesis, and biosynthesis. Traditional collagen, extracted from animal skin and tendons, has a wide range of raw material sources but suffers from drawbacks such as viral risks, low purity, and immune reactions. Chemical synthesis cannot achieve mass production and has high costs. Biosynthesis utilizes genetic engineering to express recombinant collagen, offering advantages such as low cost and high efficiency. It can also achieve large-scale industrial production through microbial fermentation, showing great promise. The Pichia pastoris expression system combines the advantages of prokaryotic expression systems (ease of cultivation, rapid propagation, and high expression levels) with the post-translational modification features of eukaryotic expression systems. Currently, over 500 exogenous proteins have been successfully expressed in Pichia pastoris. In the Pichia pastoris expression system, the exogenous gene is not present in the autonomously replicating expression vector, but is integrated into the yeast chromosome along with the expression vector through homologous recombination. It replicates and is inherited along with the chromosome, and there is no loss of the exogenous gene. Pichia pastoris has a strong preference for aerobic growth, which can achieve high-density cell culture and is conducive to large-scale industrial production. Pichia pastoris can secrete and express exogenous proteins at a high level, and the accumulation of fermentation products will not produce toxic side effects. Moreover, the amount of protein secreted by Pichia pastoris into the culture medium is very small, which facilitates purification.

[0004] Integrins are a large family of cell adhesion molecules, widely distributed adhesion receptors on the cell surface. They participate in cell-cell and cell-extracellular matrix interactions, mediating cell proliferation, differentiation, adhesion, and migration. Collagen can bind to various cell surface receptors, such as integrins and discoid protein domains, regulating various cellular life activities. Summary of the Invention

[0005] This invention provides a recombinant humanized type III collagen, its preparation method, and its applications. This recombinant humanized type III collagen is rich in multiple integrin-binding motifs (GER, GEK, and RGD) and exhibits excellent hydrophilicity.

[0006] The recombinant humanized type III collagen of the present invention contains 480 amino acids and has a theoretical molecular weight of about 44 kDa. Its amino acid sequence is shown in SEQ ID No. 4.

[0007] The present invention also provides the encoding gene of the above-mentioned recombinant humanized type III collagen, the nucleotide sequence of which is shown in SEQ ID NO.6.

[0008] Furthermore, the present invention provides a Pichia pastoris genetically engineered strain expressing the above-mentioned recombinant humanized type III collagen, constructed through the following steps:

[0009] The gene encoding recombinant humanized type III collagen was amplified by PCR, purified, and seamlessly cloned downstream of the α-factor secretion signal peptide of the pPIC9K plasmid using Gibson assembly technology. After verification by PCR and DNA sequencing, the plasmid was extracted, linearized by SalI restriction enzyme digestion, and electroporated into Pichia pastoris GS115 competent cells. High-copy Pichia pastoris genetically engineered strains expressing recombinant humanized type III collagen were obtained by screening on 1-6 g / L G418 resistance gradient replica plates.

[0010] Preferably, the primers used for PCR amplification of the encoding gene of recombinant humanized type III collagen are: primer 1 shown in SEQ ID NO.7: CTGAAGCTTACGTAGAATTC and primer 2 shown in SEQ ID NO.8: GCGAATTAATTCGCGGCCGC.

[0011] Furthermore, the present invention provides the application of the above-mentioned recombinant humanized type III collagen in the preparation of biomedical materials or cosmetics.

[0012] This invention screened amino acid sequences from known human type III α1 chain collagen amino acid sequences, identifying those with high water solubility and rich in multiple integrin-binding motifs. A fragment formed by repeating this amino acid sequence eight times was selected as the preferred fragment. Codon optimization was performed based on the codon preference of Pichia pastoris to obtain the optimized recombinant humanized type III collagen. （m=8） The coding gene was inserted into a Pichia pastoris expression plasmid, and the resulting transformed and screened Pichia pastoris genetically engineered strain expressed high levels of this gene. After fermentation and purification, high-purity recombinant humanized type III collagen was obtained. This invention relates to recombinant humanized type III collagen. （m=8）Its cell adhesion, proliferation and migration properties are significantly better than those of other recombinant humanized type III collagen (m=6 or 10) constructed with repeated times, and it has potential application prospects in biomedical materials, cosmetics and other fields. Attached Figure Description

[0013] Figure 1 For recombinant humanized type III collagen （m=8） The evaluation diagram of the hydrophobicity of amino acids.

[0014] Figure 2 For recombinant humanized type III collagen （m=8） Diagram of expression plasmid construction.

[0015] Figure 3 For recombinant humanized type III collagen （m=8） The SDS-PAGE results are shown in the figure.

[0016] Figure 4 Cell proliferation diagrams for various recombinant humanized type III collagen proteins.

[0017] Figure 5 The diagram shows the cell adhesion of various recombinant humanized type III collagen proteins.

[0018] Figure 6 Cell migration diagrams of various recombinant humanized type III collagen proteins. Detailed Implementation

[0019] The following description, in conjunction with the embodiments and accompanying drawings, is provided.

[0020] The present invention will be further described in detail below. Except for the specific details mentioned below, the processes, conditions, reagents, experimental methods, etc., used to implement the present invention are all common knowledge and general knowledge in the field, and the present invention does not have any particular limitations.

[0021] Example 1

[0022] 1. Design of recombinant humanized type III collagen

[0023] Hydrophobicity analysis was performed on the amino acid sequence of human type III α1 chain collagen (SEQ ID No. 1). Lower hydrophobicity scores indicated better hydrophilicity. To obtain collagen with better water solubility, based on the hydrophobicity analysis results, protein fragments with lower amino acid scores were selected, along with regions rich in integrin-binding motifs (GER, GEK, and RGD). The two selected amino acid sequence fragments were then integrated (SEQ ID No. 2). Using the integrated fragment as the smallest repeat unit, it was repeatedly repeated multiple times, with m repeats designed for m=6 (SEQ ID No. 3), 8 (SEQ ID No. 4), or 10 (SEQ ID No. 5), resulting in three recombinant humanized type III collagen proteins. Hydrophobicity analysis of the amino acids in the three recombinant humanized type III collagen proteins showed that all amino acid hydrophobicity scores were below zero, indicating good hydrophilicity. Taking the recombinant humanized type III collagen protein with m=8 as an example, its amino acid hydrophobicity score is as follows: Figure 1 As shown.

[0024] 2. Construction of a high-copy Pichia pastoris genetically engineered strain expressing recombinant humanized type III collagen.

[0025] (1) Taking recombinant humanized type III collagen with m=8 as an example, its amino acid sequence was codon optimized according to the codon preference of Pichia pastoris to obtain the optimized recombinant humanized type III collagen. （m=8） The encoding gene, whose nucleotide sequence is shown in SEQ ID NO.6.

[0026] (2) Recombinant humanized type III collagen was amplified by PCR using primer 1: CTGAAGCTTACGTAGAATTC (SEQ ID NO.7) and primer 2: GCGAATTAATTCGCGGCCGC (SEQ ID NO.8). （m=8） The encoding gene was purified and seamlessly cloned downstream of the α-factor secretion signal peptide in the pPIC9K plasmid using Gibson assembly technology. The structure of the recombinant plasmid is shown below. Figure 2 As shown. After verification by PCR and DNA sequencing, the plasmid was extracted, linearized by SalI restriction enzyme digestion, and then electroporated into Pichia pastoris GS115 competent cells. High-copy recombinants were obtained by screening on 1-6 g / L G418 resistance gradient plates.

[0027] The recombinant humanized type III collagen was constructed using the methods described above. （m=6） and recombinant humanized type III collagen （m=10） High-copy Pichia pastoris genetically engineered strain.

[0028] 3. Expression of recombinant humanized type III collagen in Pichia pastoris genetically engineered strain

[0029] Expressing recombinant humanized type III collagen （m=8） High-copy Pichia pastoris genetically engineered strains were inoculated into 30 mL of BMGY medium and cultured for 16-20 hours, then the initial OD was used as the starting point. 600 The recombinant humanized type III collagen was inoculated into 30 mL of BMMY medium at an inoculum size of 1 and cultured. Every 24 hours, 300 µL of filtered sterilized methanol was added. After methanol induction for 120 hours, 2 mL of medium was collected, the supernatant was collected by centrifugation, and the recombinant humanized type III collagen was analyzed by SDS-PAGE. （m=8） Qualitative analysis was performed, and the test results are shown below. Figure 3 .Depend on Figure 3 It can be seen that this high-copy Pichia pastoris genetically engineered strain can successfully express recombinant humanized type III collagen. （m=8） .

[0030] The recombinant humanized type III collagen was expressed using the method described above. （m=6） and recombinant humanized type III collagen （m=10） High-copy Pichia pastoris genetically engineered strains were inoculated, cultured, and expressed to obtain recombinant humanized type III collagen. （m=6） and recombinant humanized type III collagen （m=10） .

[0031] BMGY medium: Each liter of medium contains 20 g / L peptone, 10 g / L yeast extract, 10×YNB 100 ml, 10×potassium phosphate buffer pH 6.0 100 ml, 10×glycerol 100 ml, and the remainder is water.

[0032] BMMY medium: Each liter of medium contains 20 g / L peptone, 10 g / L yeast extract, 10×YNB 100 ml, 10× potassium phosphate buffer pH 6.0 100 ml, and the remainder is water.

[0033] Example 2

[0034] Bioactivity assay of recombinant humanized type III collagen

[0035] Cellular experiments were conducted on recombinant humanized type III collagen. （m=6） Recombinant humanized type III collagen （m=8） Recombinant humanized type III collagen （m=10） The biological activity was detected.

[0036] 1. Cell proliferation

[0037] (1) Add 8000 well-cultured human epidermal cells (HaCaT cells) to each well of a 96-well plate and incubate at 37°C for 24 hours;

[0038] (2) Discard the supernatant, set up different concentrations of recombinant humanized type III collagen solution prepared with 10% serum culture medium as experimental group and 10% serum culture medium as blank control group, set up 6 replicates for each group, add 100 μL of different concentrations of recombinant humanized type III collagen solution or culture medium to each well, and incubate at 37℃ for 48h.

[0039] (3) Discard the supernatant, add 50 μL of MTT-complete culture medium solution to each well, and incubate at 37°C for 2 h;

[0040] (4) Discard the supernatant and add 100 μL of DMSO to each well and shake on a decolorizing shaker for 10 min;

[0041] (5) The detection wavelength is 490nm, with 630nm as the reference wavelength. The OD value is the OD value at 490nm minus the OD value at 630nm. According to the formula, the relative cell proliferation rate = OD 样品 / OD 空白 ×100% to calculate the relative cell proliferation rate, with the blank control set to 100%.

[0042] The results are as follows Figure 4 As shown, the recombinant humanized type III collagen of the present invention at various concentrations... （m=8） Both are superior to recombinant humanized type III collagen. （m=6） and recombinant humanized type III collagen （m=10） Furthermore, at concentrations below 0.1%, recombinant humanized type III collagen... （m=8） It has excellent ability to promote cell proliferation.

[0043] 2. Cell adhesion

[0044] Recombinant humanized type III collagen was detected by centrifugation. （m=6） Recombinant humanized type III collagen （m=8） Recombinant humanized type III collagen （m=10） Cell adhesion of the samples was assessed by coating cell suspensions with recombinant humanized type III collagen. （m=6） Recombinant humanized type III collagen （m=8） Recombinant humanized type III collagen （m=10）Cells were cultured in culture dishes for a certain period of time, fluorescently labeled, and eluted from non-adherent cells using optimal relative centrifugation. The percentage of cells separated before and after centrifugation was measured to evaluate the relative cell adhesion-promoting effect of the collagen being tested. The relative cell adhesion rate was calculated using the formulas: Adhesion percentage = (Number of cells after centrifugation / Number of cells before centrifugation) × 100%, and Relative cell adhesion rate = (Average adhesion percentage of the sample / Average adhesion percentage of the blank control group). The specific steps are as follows:

[0045] (1) Set up 2 mL of serum-free culture medium with different concentrations of recombinant humanized type III collagen solution as experimental group and blank control group with added PBS solution. Each group was set up with 6 replicates. Add 100 μL of recombinant humanized type III collagen solution or PBS solution of different concentrations to each well of 96-well plate and incubate at 37℃ for 1~4h.

[0046] (2) Discard the supernatant, add 100 μL of 1% BSA to each well, and incubate at 37°C for 48 h;

[0047] (3) Wash three times with PBS, seal with sealing film and store at 4 ℃ for later use;

[0048] (4) Add 5000 well-cultured human epidermal cells (HaCaT cells) containing 10% Hoechst33342 fluorescent staining agent to each well and incubate at 37°C for 1 h;

[0049] (5) Use an inverted microscope to capture fluorescence tile images of each of the three wells;

[0050] (6) Fill each well with D-PBS to form an “inverted meniscus”, purge air bubbles and cover with sealing film, then centrifuge at 350g (inverted) for 5 min;

[0051] (7) After centrifugation, discard the sealing film, take out the supernatant from the well, wash once with D-PBS, add 100 μL of D-PBS, and take pictures of each of the three wells;

[0052] (8) Use Image J cell counting program to count the number of fluorescently labeled cell nuclei, measure the number of cells before and after centrifugation, and set the blank control to 100%.

[0053] Cell adhesion rate can reflect the activity of recombinant humanized type III collagen. Higher protein activity allows for a faster provision of a superior external environment for cells, aiding cell adhesion. Figure 5 It can be seen that at the experimental concentration, recombinant humanized type III collagen... （m=8） It is superior to recombinant humanized type III collagen in promoting cell adhesion in human epidermal cells. （m=6） and recombinant humanized type III collagen（m=10） Furthermore, its activity increases with increasing protein solution concentration, demonstrating excellent cell adhesion-promoting activity.

[0054] 3. Cell migration

[0055] Cell migration was measured using the cell scratch assay. The specific steps are as follows:

[0056] (1) Using a marker pen and a ruler, draw three horizontal lines at the bottom of the 6-well plate. Adjust the concentration of human epidermal cells (HaCaT cells) to 5 × 10⁻⁶. 5 Seeds were inoculated into 6-well plates at a volume of 2 ml per well and incubated for 24 h.

[0057] (2) Using a 20 µL nozzle, align it vertically with the orifice plate using a ruler, and gently push downwards along the longitudinal scribing line to create a scratch.

[0058] (3) Rinse the cells three times with PBS to remove the crossed-out cells;

[0059] (4) 2 mL of serum-free culture medium was added to the experimental group to prepare different concentrations of recombinant humanized type III collagen solution, while only 2 mL of serum-free culture medium was added to the blank control group. The samples were cultured at 37°C in a 5% CO2 incubator. After 0 h and 24 h, the intersection of the horizontal and vertical scratches was taken as the core and photographed under a 40x microscope. Nine images of each part were obtained in each well, and a total of 27 data points were obtained for each group.

[0060] (5) Use ImageJ software to measure the scratch area and calculate the cell migration rate of each group of cells. Set the blank control to 100%.

[0061] The results are as follows Figure 6 As shown, this indicates that recombinant humanized type III collagen... （m=8） The cell migration promotion rate of human epidermal cells was superior to that of recombinant humanized type III collagen at all protein concentrations. （m=6） and recombinant humanized type III collagen （m=10） Furthermore, its concentration increases with the concentration of the protein solution, demonstrating excellent cell migration-promoting effects.

[0062] In summary, this invention selects a highly water-soluble protein sequence rich in multiple integrin-binding motifs from the helical region of the known human collagen type III gene. The selected gene fragment is repeatedly repeated and inserted into a Pichia pastoris expression plasmid. Pichia pastoris is then transformed and screened to obtain a highly expressive Pichia pastoris genetically engineered strain. After preliminary fermentation and purification steps, high-purity recombinant humanized type III collagen is obtained. The structure of the recombinant humanized type III collagen of this invention is 100% identical to the corresponding portion of the natural collagen gene sequence. Cell experiments show that the recombinant humanized type III collagen...（m=8） It is superior to recombinant humanized type III collagen in promoting cell adhesion, proliferation, and migration. （m=6） and recombinant humanized type III collagen （m=10） Furthermore, it exhibits a promoting effect; the recombinant humanized type III collagen of this invention... （m=8） It has potential applications in fields such as biomedical materials and cosmetics.

Claims

1. Recombinant humanized type III collagen, characterized in that, Its amino acid sequence is shown in SEQ ID No.

4.

2. The gene encoding recombinant humanized type III collagen as described in claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

6.

3. A Pichia pastoris genetically engineered strain expressing recombinant humanized type III collagen as described in claim 1, characterized in that, Build it using the following steps: The gene encoding recombinant humanized type III collagen was amplified by PCR, purified, and seamlessly cloned downstream of the α-factor secretion signal peptide of the pPIC9K plasmid using Gibson assembly technology. After verification by PCR and DNA sequencing, the plasmid was extracted, linearized by SalI restriction enzyme digestion, and electroporated into Pichia pastoris GS115 competent cells. High-copy Pichia pastoris genetically engineered strains expressing recombinant humanized type III collagen were obtained by screening on 1–6 g / L G418 resistance gradient replica plates.

4. The Pichia pastoris genetically engineered strain according to claim 3, characterized in that, The primers used for PCR amplification of the encoding gene of recombinant humanized type III collagen were: primer 1 shown in SEQ ID NO.7: CTGAAGCTTACGTAGAATTC and primer 2 shown in SEQ ID NO.8: GCGAATTAATTCGCGGCCGC.

5. The application of the recombinant humanized type III collagen as described in claim 1 in the preparation of biomedical materials or cosmetics.

Images