SNP molecular markers related to potato long-shaped and round-shaped tuber and application

Abstract

The application provides a potato long and round tuber related SNP molecular marker and application. The potato long and round tuber related SNP molecular marker comprises: an upstream primer C6-58.27_665-F: GGCCACATTTCTGAAAGCCC and a downstream primer C6-58.27_665-R: CAAGTCTTCTATTGGCAAGCTTCT. The application takes a potato wild species M6 (S. chacoense) as a parent to perform self-crossing, constructs a diploid potato population. By using a QTL-seq technology and combining molecular marker development, a SNP molecular marker linked to potato long and round tubers is obtained. The application uses the SNP molecular marker related to potato long and round tubers to detect potato germplasm resources in a laboratory, and finds that the detection accuracy of long and round tubers reaches 91.86%, which indicates that the marker can be applied to the assisted selection of potato long and round tuber variety breeding.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, specifically to a molecular marker and application of SNPs related to oblong and round potato tubers. The SNP marker linked to oblong and round potato tubers is located on potato chromosome 6 and is denoted as C6-58.27_665. Background Technology

[0002] The potato (Solanum tuberrosum L.) is the world's most important non-cereal crop. Globally, potatoes are cultivated on 16.49 million hectares and consumed by over 1 billion people daily (FAOSTAT 2020). Tuber shape is one of the most important appearance traits of potatoes, as it influences consumer purchasing decisions and market value. In the fresh food market, consumers prefer potatoes with regular shapes and shallow eyes to reduce waste from peeling. For the processing industry, potato chips typically require round potatoes, while French fries require long potatoes. Therefore, breeding potato varieties with different tuber shapes is crucial to meeting the demands of both the consumer market and the processing industry.

[0003] Potato tubers range in shape from oblate to club-shaped. Therefore, there are various classifications regarding tuber shape. In cultivated potato varieties (Solanum tuberosum), tuber shapes are classified into two (round and oblong) or three (round, oval, oblong). In a diploid hybrid population of S. verrucosum and S. microdontum, tuber shapes are classified into six categories, including oblate, round, obovate, ovate, oblong, and cylindrical. (et al. 2008). On the other hand, tuber shapes can also be classified by statistically analyzing the tuber shape index (LW), which is the ratio of the tuber's longitudinal axis to its transverse axis. Bradshaw et al. (1994) considered tubers with an LW value < 1.4 to be round, and tubers with an LW value ≥ 1.4 to be elongated.

[0004] The genetic study of potato tuber shape has a long history. Van Eck et al. (1994) first conducted a detailed study on the inheritance of potato tuber shape, speculating that the inheritance of tuber shape may be controlled by the Ro gene located on potato chromosome 10, and that round tubers are dominant over long tubers. In 2008, researchers identified a major QTL on chromosome 2 controlling potato tuber shape in a diploid hybrid population, along with several minor QTLs on other chromosomes. This seemed to contradict previous studies. Subsequent genetic studies, in addition to the major QTL on chromosome 10, also detected QTLs affecting tuber shape on chromosomes 5, 6, and 12 (Lindqvist-Kreuze et al. 2015; Manrique-Carpintero et al. 2018). In conclusion, the inheritance of potato tuber shape is not a simple qualitative trait but may be a quantitative trait controlled by multiple loci. Chromosome 10 is the major QTL, but modifying QTLs still exist on other chromosomes. Wu et al. (2018) found through comparative genomics that the gene StOFP20 on chromosome 10 in a diploid population constructed from M6 and DM crosses may be the gene controlling tuber shape. On the other hand, Zhu Wenwen (2015) et al. developed a CAPS marker on chromosome 10, which achieved an accuracy of 83.02% in detecting tuber shape.

[0005] Problems with existing technologies: There are currently no reported SNP markers linked to tuber shape on chromosomes other than chromosome 10; and no ideal markers for marker-assisted selection linked to tuber shape on chromosomes other than chromosome 10 have been developed. Summary of the Invention

[0006] The key technical problem this invention aims to solve is to provide a SNP molecular marker and its application related to oblong and round potato tubers. To solve the above technical problem, this invention adopts the following technical solution:

[0007] 1. Primers for the SNP molecular marker C6-58.27_665 linked to long and round potato tubers, the sequences of which are shown in SEQ No. 1-2 of the sequence listing.

[0008] 2. The SNP molecular marker C6-58.27_665 linking long and round potato tubers, as shown in the sequence listing SEQ No. 3-4, wherein when position 666 is G, the potato phenotype is long and the potato phenotype is round.

[0009] 3. A method for screening SNP molecular markers linked to long and round potato tubers, comprising the following steps: (1) genetic population construction; (2) by statistically analyzing the LW values ​​of all progeny of PM7, selecting extreme single plants to construct a long-pool and a round-pool; (3) analyzing the sequencing data to obtain differential SNPs between the long-pool and the round-pool; (4) QTL-seq analysis; (5) screening of polymorphic SNP markers; (6) using the polymorphic primers obtained in the above steps to perform PCR amplification on all single plants in the PM7 population; (7) genetic map construction and QTL mapping; (8) obtaining the primer sequence of marker C6-58.27_665 as shown in SEQ No. 1-2.

[0010] 4. Application of SNP molecular markers linked to long and round potato tubers, the application being to distinguish between long and round potato tubers in potato germplasm resources, specifically implemented through the following steps: (1) Determine the LW value of the potato germplasm resources to be identified; (2) Extract DNA from the materials using the CTAB method; (3) Detect the potato materials using the marker C6-58.27_665, the specific steps including: ① The 50ng / μl PCR amplification reaction system consists of 1μl DNA template, 0.5μl each of 10μM upstream and downstream primers, 10μl 2×Utaq PCR Mix, and 8μl ddH2O; ② The PCR reaction program is as follows: 95℃ pre-denaturation for 3min, 95℃ denaturation for 30s, 58℃ annealing for 1min, 72℃ extension for 1min and 30s, and finally 72℃ extension for 5min; store at 4℃ and take out; ③ Digest the PCR product using the restriction endonuclease RsaⅠ, the digestion system consisting of 10μl PCR product and 10×NEB. 1.5 μl buffer, 0.3 μl RsaⅠ restriction enzyme, 3.2 μl ddH2O. Digest at 37℃ for 2 h. After electrophoresis of the enzyme digestion products on a 1% agarose gel, the results are directly observed using a fluorescence imager, or the sequence of the amplified products is determined; (4) Result determination: when the electrophoresis of the amplified products shows two bands, it is a long potato; when the electrophoresis of the amplified products shows one band, it is a round potato. Or determine the sequence as shown in the sequence listing SEQ No. 3-4, where the potato phenotype is long when position 666 is G, and the potato phenotype is round when position 666 is T.

[0011] Beneficial effects: (1) This invention uses diploid potato materials as parents and constructs a diploid population through self-pollination. Using QTL-seq analysis technology and molecular marker development, a QTL Tubershape06 associated with tuber shape was identified at the end of chromosome 6. This locus can be detected in three environments and contributes 10.2-17.5% to tuber shape, which lays an important foundation for realizing molecular-assisted breeding and genetic improvement of multi-gene controlled traits. (2) Based on the developed SNP marker primers, this invention detects the tuber shape of potato germplasm resources with an accuracy of 91.86%, indicating that the marker can be applied to auxiliary selection in potato tuber shape breeding. Attached Figure Description

[0012] Figure 1 These are photos of PM7 tubers.

[0013] Figure 2 This is a distribution map of LW values ​​in the tubers of the PM7 population. The horizontal axis represents the LW value (the ratio of the vertical axis to the horizontal axis of the tuber).

[0014] Figure 3 These are the results of QTL-seq analysis. Figure A shows the SNP-index distribution of the Long-pool sample; Figure B shows the SNP-index distribution of the Round-pool sample; Figure C shows the Δ(SNP-index).

[0015] Figure 4 These are the QTL results for tuber shape in the PM7 population. The numbers to the left of the linkage group represent the genetic distance between markers, in cM. The solid rectangles to the right of the linkage group indicate the QTL mapping intervals.

[0016] Figure 5 This is a distribution map of LW values ​​in tubers from 86 potato germplasm resources.

[0017] Figure 6 This image shows the results of detecting the SNP marker C6-58.27_665 in 86 potato germplasm resources. Image A shows the difference in LW values ​​between the presence and absence of the marker in the 86 potato materials. 0 indicates no SNP marker C6-58.27_665; 1 indicates the presence of the SNP marker C6-58.27_665. Image B shows the banding patterns after digestion of the SNP marker C6-58.27_665. The arrows indicate the target banding patterns. The lanes represent DNA markers, with sizes of 5000bp, 3000bp, 2000bp, 1000bp, 750bp, and 500bp, respectively. Image C shows representative tubers.

[0018] Figure 7 This is the target sequence for the C6-58.27_665 primer. The mutation sites are highlighted. Specific implementation methods

[0019] Unless otherwise specified, the methods and apparatus used in the following embodiments of this invention are conventional methods and apparatus; the equipment and reagents used are all conventional equipment and reagents purchased from reagent companies. To make the objectives, technical solutions, and advantages of this invention clearer, the specific embodiments of this invention are described in detail below. Examples of these preferred embodiments are illustrated in the specific embodiments. It should also be noted that, to avoid obscuring the technical solution of this invention due to unnecessary details, only technical solutions and / or processing steps closely related to the solution according to this invention are shown in the embodiments, while other details that are not closely related are omitted.

[0020] Example 1

[0021] This embodiment provides the full-length sequences of SNP molecular markers linked to oblong and round potato tubers, as follows:

[0022] (1) Molecular marker C6-58.27_665 primer sequence: upstream primer: GGCCACATTTCTGAAAGCCC, downstream primer: CAAGTCTTCTATTGGCAAGCTTCT.

[0023] (2) The sequences of oblong and round potatoes are shown in the sequence listing SEQ No. 3-4; or as shown in... Figure 7 As shown, the highlighted area indicates the location where the mutation occurred.

[0024] Example 2

[0025] This embodiment provides a method for screening SNP molecular markers linked to oblong and round potato tubers, as detailed below:

[0026] (1) Genetic population construction: Parental M6 (S. chacoense) was a breeding material preserved in our laboratory, which could be obtained through CIP. The tubers of parental material M6 were oval in shape, and the mean tuber shape index (LW) measured under three conditions was 1.48. A diploid population (named PM7) was constructed using this material through self-pollination, comprising a total of 167 progeny. Observation of tuber shape revealed segregation in the tuber shape of the PM7 population (…). Figure 1 Phenotypic analysis was performed on all progeny tubers to determine the tuber shape index (LW value) for each progeny. Figure 2 For specific methods, please refer to Prashar et al. (2014).

[0027] (2) DNA was extracted from individual plants of the PM7 population using the CTAB method (Dellaporta et al., 1983).

[0028] (3) By statistically analyzing the LW values ​​of all PM7 progeny, extreme single plants were selected to construct long-pool and round-pool sequences. Each pool contained 24 single plants, and DNA from these 48 single plants was collected. After being mixed to the same quality, the DNA was sent to Novogene Corporation for whole-genome sequencing using an Illumina sequencer. A 350bp library was constructed in each pool, with a read length of 150bp and a sequencing depth of 50× (library type: small fragment library of plant and animal genome (350bp); sequencing strategy: HiSeq-PE150).

[0029] (4) Analyze the sequencing data to obtain differential SNPs between the Long-pool and Round-pool. The specific analysis steps are as follows: ① Use the MEM algorithm of BWA software (version 0.7015-r1140) to align the sequencing data of the anti-infective pool with the reference genome to obtain the alignment results in SAM format; ② Use samtools software (version 1.3.1) to convert the SAM format file to BAM format; ③ Use SortSam in Picard tool (version 1.91) to sort the reads in the BAM file. The obtained BAM file can be used to count differential SNPs between the Long-pool and Round-pool.

[0030] (5) QTL-seq analysis: Based on the R package provided by Mansfeld and Grumet (2018), the SNP-index values ​​of the Long-pool and Round-pool obtained in (4) were calculated respectively. The distribution map of the SNP-index on the genome was plotted using the sliding window method (with a unit window of 2Mb and a step size of 10kb). Figure 3 A and Figure 3 As shown in B. Then, based on the SNP-index values ​​of the extreme pool, the Δ(SNP-index) value was calculated, and the distribution of Δ(SNP-index) on the genome was plotted using the sliding window method (with a 2Mb window size and a 10kb step size), as shown in Figure B. Figure 3 As shown in C. Finally, the threshold of Δ(SNP-index) at the 95% level is calculated to determine candidate regions related to tuber shape.

[0031] (6) Screening for polymorphic SNP markers: The PGSC_DM_v6.1 genome sequence was downloaded from http: / / potato.plantbiology.msu.edu / pgsc_download.shtml. DNA sequences of SNP sites in candidate regions on chromosome 6 were searched, and sequences 1000 bp before and after each site were selected. Sequences containing a single restriction endonuclease site (SNP) were selected using SnapGene software analysis. Primers were designed using default parameters on NCBI (https: / / www.ncbi.nlm.nih.gov / tools / primerblast / index.cgi?LINK_LOC=BlastHome). A total of 60 primer pairs were designed, and polymorphism screening was performed between parental M6 and mixed pools, resulting in 20 pairs of polymorphic primers.

[0032] (7) Using the polymorphic primers obtained in (6), PCR amplification was performed on all single plants in the PM7 population. The PCR reaction system was 20 μl, specifically as follows: 1 μl DNA template (50 ng / μl), 0.5 μl each of forward and reverse primers (10 μM), 10 μl Utaq PCRMix (2×), and 8 μl ddH2O. The reaction program was as follows: 95℃ pre-denaturation for 3 min, followed by 35 cycles of 95℃ denaturation for 30 s, Ta℃ annealing for 1 min, 72℃ extension for 1 min and 30 s, and finally 72℃ extension for 5 min; stored at 4℃. The amplified product was digested with the corresponding restriction endonuclease. The digestion system was: 10 μl PCR product, 1.5 μl NEB buffer (10×), 0.3 μl enzyme, and 3.2 μl ddH2O. Digestion was performed in a 37℃ incubator for 2 h. The enzyme digestion products were subjected to 1% agarose gel electrophoresis, and the results were directly observed using a fluorescence imager. Results were recorded as follows: the appearance of a differential band was recorded as "1", and the absence of a differential band was recorded as "0". A total of 20 differential bands were obtained.

[0033] (8) Genetic map construction and QTL mapping: Using the genetic map construction software JoinMap and the marker results statistically analyzed in (7), a genetic map of chromosome 6 was constructed; based on the PM7 population phenotype statistically analyzed in (1), the QTLs related to tuber shape were located using the diploid mapping software MapQTL, such as Figure 4 As shown. This QTL is named Tsch6, and the SNP at the peak is labeled C6-58.27_665.

[0034] (9) The primer sequence for marker C6-58.27_665 is as follows: F: GGCCACATTTCTGAAAGCCC, R: CAAGTCTTCTATTGGCAAGCTTCT.

[0035] Example 3

[0036] This embodiment provides the application of SNP molecular markers linked to long and round potato tubers. The application of the primers for the SNP molecular markers related to long and round potato tubers is for distinguishing long and round potatoes in potato germplasm resources. This is specifically achieved through the following steps:

[0037] (1) The LW value of 86 potato germplasm resources in the laboratory was determined, such as Figure 5 As shown.

[0038] (2) DNA was extracted from 86 samples using the CTAB method.

[0039] (3) Eighty-six potato samples were tested using the C6-58.27_665 label. The specific steps included: ① The PCR amplification reaction system consisted of 1 μl of DNA template (50 ng / μl), 0.5 μl each of upstream and downstream primers (10 μM), 10 μl of Utaq PCR Mix (2×), and 8 μl of ddH2O; ② The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 58℃ annealing for 1 min, 72℃ extension for 1 min 30 s, and a final extension at 72℃ for 5 min; the samples were then stored at 4℃ and removed; ③ The PCR products were digested with restriction endonuclease RsaⅠ. The digestion system consisted of 10 μl of PCR product, 1.5 μl of NEB buffer (10×), 0.3 μl of RsaⅠ, and 3.2 μl of ddH2O. The digestion was carried out at 37℃ for 2 h. The digested products were subjected to 1% agarose gel electrophoresis, and the results were directly observed using a fluorescence imaging system.

[0040] (4) The results were determined as follows: 17 out of 86 potato germplasm resources had an LW value less than 1.4, with round tubers; 66 resources had an LW value greater than 1.4, with oblong tubers. Testing of the 86 potato germplasm resources using the SNP marker C6-58.27_665 showed that the LW value identification results for oblong and round tubers in the 86 resources were 91.86% consistent with the marker detection results (Table 1). Correlation analysis between the phenotypic identification results and the marker detection results showed a correlation coefficient of 0.55**, which was highly significant at the 0.01 level. Figure 6 ).

[0041]

[0042] The above description is only a specific embodiment of this application. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of this application, and these improvements and modifications should also be considered within the scope of protection of this application.

[0043] Thanksgiving license plate:

[0044] [1].Bradshaw JE,Mackay G R.Potato Genetics.Wallingford:CabInternational,1994.pp227–229.

[0045] [2].Lindqvist-Kreuze H,Khan A,Salas E,Meiyalaghan S,Thomson S,GomezR,Bonierbale M(2015)Tuber shape and eye depth variation in a diploid familyof Andean potatoes.BMC Genet16:57.

[0046] [3].Manrique-Carpintero NC,Coombs JJ,Pham GM,Laimbeer FPE,Braz GT,Jiang J,Veilleux RE,Buell CR,Douches DS(2018)Genome Reduction in TetraploidPotato Reveals Genetic Load,Haplotype Variation,and Loci Associated WithAgronomic Traits.Front Plant Sci9:944.

[0047] [4].Mansfeld BN,Grumet R(2018)QTLseqr:An R Package for Bulk Segregant Analysis with Next-Generation Sequencing.Plant Genome 11。

[0048] [5].Prashar A,Hornyik C,Young V,McLean K,Sharma SK,Dale MF,Bryan GJ(2014)Construction of a dense SNP map of a highly heterozygous diploid potatopopulation and QTL analysis of tuber shape and eye depth.Theor Appl Genet127:2159-2171。

[0049] [6]. J,Wasilewicz-Flis I,Jakuczun H,Gebhardt C(2008)Taggingquantitative trait loci for dormancy,tuber shape,regularity of tuber shape,eye depth and flesh colour in diploid potato originated from six Solanumspecies.Plant Breeding 127:49-55。

[0050] [7].Van Eck HJ,Jacobs JM,Stam P,Ton J,Stiekema WJ,Jacobsen E(1994)Multiple alleles for tuber shape in diploid potato detected by qualitativeand quantitative genetic analysis using RFLPs.Genetics 137:303-309。

[0051] [8].Wu S,Zhang B,Keyhaninejad N,Rodriguez GR,Kim HJ,Chakrabarti M,Illa-Berenguer E,Taitano NK,Gonzalo MJ,Diaz A,Pan Y,Leisner CP,Halterman D,Buell CR,Weng Y,Jansky SH,van Eck H,Willem J,Willem,J,Willem TJ,Mevan T,Taitano NK,Gonzalo MJ derKnaap E(2018)A common geneticmechanism underlies morphological diversity in fruits and other plant organs.Nat Commun9:4734。

Claims

1. Primers C6-58.27_665, a SNP molecular marker linked to oblong and round potato tubers, characterized in that... The primer sequence of the molecular marker C6-58.27_665 is shown in SEQ ID No. 1-2 of the sequence listing, and the molecular marker is shown in SEQ ID No. 3-4 of the sequence listing. When the 666th position is G, the potato phenotype is oblong, and when the 666th position is T, the potato phenotype is round.

2. The application of the SNP molecular marker C6-58.27_665 primer linked to oblong and round potato tubers as described in claim 1, characterized in that, The application is to distinguish between long and round potatoes in potato germplasm resources, and is specifically implemented through the following steps: (1) Determine the LW value of the potato germplasm resources to be identified; (2) Extract DNA from the materials using the CTAB method; (3) Detect the potato materials using the marker C6-58.27_665; (4) Determine the results: when the amplification product shows two bands in electrophoresis, it is a long potato; when the amplification product shows one band in electrophoresis, it is a round potato; or determine the sequence as shown in the sequence listing SEQ No. 3-4, where the potato phenotype is long when position 666 is G, and the potato phenotype is round when position 666 is T.

3. The application of the SNP molecular marker C6-58.27_665 linked to oblong and round potato tubers according to claim 2, characterized in that, The specific steps for detecting potato materials using the label C6-58.27_665 are as follows: (1) The PCR amplification reaction system of 50 ng / μl consists of 1 μl DNA template, 0.5 μl each of 10 μM upstream and downstream primers, 10 μl of 2×Utaq PCR Mix, and 8 μl of ddH2O; (2) The PCR reaction program is as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 58℃ annealing for 1 min, 72℃ extension for 1 min 30 s, and finally 72℃ extension for 5 min; store at 4℃ and take out; (3) The PCR product is digested with restriction endonuclease RsaⅠ. The digestion system consists of 10 μl PCR product, 1.5 μl 10×NEB buffer, 0.3 μl RsaⅠ endonuclease, and 3.2 μl ddH2O. The digestion is carried out in a 37℃ incubator for 2 h. After the digestion product is electrophoresed with 1% agarose gel, the results are directly observed using a fluorescence imaging instrument or determined by sequencing.

Images