A method for activating t cells in vitro using dunaliella salina exosome composition

Abstract

The application discloses a method for activating T cells in vitro by using Dunaliella salina exosome composition and belongs to the technical field of biological medicines. The method comprises the following steps: using an OKT3-LAMP2 fusion plasmid to construct OKT3 Dunaliella salina exosomes and using a CD28scFv-LAMP2 fusion plasmid to construct CD28scFv Dunaliella salina exosomes. The exosomes obtained by the method are novel in structure, unique in preparation method, simple, efficient and suitable for mass production. The two kinds of exosomes have good biological safety, and the synergistic use can very efficiently stimulate T cell expansion.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a method for activating T cells in vitro using a Dunaliella salina exosome composition. Background Technology

[0002] T cells are the main force of cellular immunity in the human body and occupy a central position in adaptive immune responses. Defects in T cell function affect both cellular and humoral immunity, leading to susceptibility to various pathogens, including opportunistic pathogens, and weakened anti-tumor effects. Many diseases can be completely eradicated if sufficient T cells are present. Clinically, tumor treatment requires the participation of T cells. For example, in CAR-T therapy for leukemia, T lymphocytes are extracted from the patient, activated in vitro, and then implanted with CARs (carrier receptors) for localization and navigation before being reinfused into the patient. A large number of immune cells then track and kill leukemia cells. However, T cells are difficult to culture and activate in vitro, posing a challenge to clinical treatment. Commercially available T cell-activating magnetic beads are difficult to prepare and expensive, resulting in high costs.

[0003] Dunaliella salina, also known as "Dumbella algae," belongs to the class Chlorophyta and family Dunaliellaceae. It is an extremely salt-tolerant single-celled eukaryotic green alga. Dunaliella salina is a planktonic alga that lives in highly concentrated saline lakes. It is the only known life form capable of surviving in high-concentration saline environments. Rich in unique and abundant life-sustaining elements, it is hailed by the world scientific community as a "power source for cells" and a "protector of life." Because it lacks a cell wall and is a natural protoplast, it can introduce exogenous genes. Dunaliella salina is rich in protein and has protein production capabilities, creating ideal conditions for the expression of exogenous genes. Exosomes are small membrane vesicles (30-150 nm) containing complex RNA and proteins; currently, they specifically refer to disc-shaped vesicles with a diameter of 40-100 nm. They mainly originate from multivesicles formed by the invagination of lysosomal microparticles within cells, and are released into the extracellular matrix after the outer membrane of the multivesicle fuses with the cell membrane. All cultured cell types can secrete exosomes, and exosomes are naturally present in body fluids, including blood, saliva, urine, cerebrospinal fluid, and breast milk. Exosomes are widely involved in intercellular communication and substance transfer, making Dunaliella salina exosomes an excellent information carrier. However, current technologies do not include research on activating T cells using Dunaliella salina cell exosomes. Summary of the Invention

[0004] The purpose of this invention is to provide a method for activating T cells in vitro using a Dunaliella salina exosome composition to solve the problems existing in the prior art. The T cell activation efficiency of this method is as high as 80%, and T cells can be expanded more than 100 times within 10 days.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides a method for activating T cells in vitro, comprising the step of activating T cells in vitro using a Dunaliella salina exosome composition; wherein the Dunaliella salina exosome composition comprises OKT3 Dunaliella salina exosomes and CD28 scFv Dunaliella salina exosomes; wherein the OKT3 Dunaliella salina exosomes contain OKT3 and LAMP2 molecules; and wherein the CD28 scFv Dunaliella salina exosomes contain CD28scFv and LAMP2 molecules.

[0007] Furthermore, the preparation method of the OKT3 Dunaliella salina exosomes is as follows:

[0008] (1) The genes encoding OKT3 and LAMP2 molecules were introduced into a vector to construct a recombinant plasmid;

[0009] (2) The recombinant plasmid was introduced into Dunaliella salina cells, and Dunaliella salina cells that were stably transfected and highly expressed OKT3 and LAMP2 molecules were screened to obtain Dunaliella salina cells.

[0010] (3) After the Dunaliella salina cells obtained in step (2) are expanded and cultured, exosomes are isolated, which are the OKT3 Dunaliella salina exosomes.

[0011] Furthermore, in step (1), the genes encoding the OKT3 and LAMP2 molecules are shown in SEQ ID NO: 1.

[0012] Furthermore, the method for preparing the CD28 scFv Dunaliella salina exosomes is as follows:

[0013] (1) The genes encoding CD28scFv and LAMP2 molecules were introduced into a vector to construct a recombinant plasmid;

[0014] (2) The recombinant plasmid was introduced into Dunaliella salina cells, and Dunaliella salina cells that were stably transfected and highly expressed CD28scFv and LAMP2 molecules were screened to obtain Dunaliella salina cells;

[0015] (3) After the Dunaliella salina cells obtained in step (2) are expanded and cultured, exosomes are isolated, which are the CD28scFv Dunaliella salina exosomes.

[0016] Furthermore, during activation, the ratio of the OKT3 Dunaliella salina exosomes and the CD28 scFv Dunaliella salina exosomes to T lymphocytes is 0.25~1.25∶0.25~1.25∶1.

[0017] Furthermore, during the activation of in vitro T cells using the Dunaliella salina exosome composition, recombinant human IL-2 was added at a concentration of 200 U / mL.

[0018] Furthermore, the activation step also includes culturing in a CO2 cell incubator at 37°C.

[0019] The present invention also provides a T cell, wherein the T cell is a T cell activated according to any one of the methods described herein.

[0020] T cell activation requires two signals. The first signal comes from the T cell surface receptor TCR recognizing the MHC / antigen peptide complex and transmitting an antigen-specific recognition signal. The second signal is provided by the co-stimulatory molecules of APC, which is a non-specific co-stimulatory signal. In this invention, OKT3 and CD28scFv replace the MHC / antigen peptide complex and APC surface co-stimulatory molecules, respectively, and bind to CD3 and CD28 molecules on the surface of T cells, providing the first and second signals for T cell activation. After the CD3 molecules on the T cells come into contact with the stimulation signal of OKT3, they aggregate with the cytoplasmic tail of the co-receptor CD4 or CD8 molecules on the surface of the T cells, thereby activating the tyrosine kinases connected to the cytoplasmic tails. This promotes the phosphorylation of tyrosine in the tyrosine activation motif of the immunoreceptor in the CD3 molecule cytoplasm. The phosphorylated tyrosine further phosphorylates downstream tyrosine-containing proteins, thereby causing a cascade reaction of kinase activation. Finally, by activating transcription factors, these factors enter the cell nucleus and bind to target genes that regulate T cell proliferation and activation, causing gene expression and transcription. CD28scFv binds to CD28 molecules on the surface of T lymphocytes, providing a co-stimulatory signal, jointly promoting the transformation of T cells from a quiescent state to an activated state.

[0021] The present invention discloses the following technologies, which have the following advantages:

[0022] (1) For the first time, fusion plasmids containing OKT3 and LAMP2, and CD28scFv and LAMP2 molecules were obtained through simple operation. Stable transfected Dunaliella salina cells can produce large quantities of the corresponding novel exosomes (OKT3 exosomes and CD28 scFv exosomes). The exosomes and naïve T cells can be co-cultured for T cell activation.

[0023] (2) High activation efficiency: When two types of exosomes are used in combination, a small amount can significantly activate T cells.

[0024] (3) Low economic cost: Dunaliella salina cells are eukaryotic algae that are widely present in nature. They reproduce quickly and have no seasonal growth restrictions. They can be cultured on a large scale and secrete a large number of exosomes by providing them with the salt and a small amount of nutrients required for survival. (4) High biosafety: Dunaliella salina cells are rich in vitamins, unsaturated fatty acids and other beneficial components to the human body. There have been articles reporting its nutritional value and health product efficacy. Dunaliella salina can also be used for medical purposes such as vaccine production and targeted drug delivery. Therefore, there is no need to worry about its biosafety. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This is a schematic diagram of the plasmid construction method;

[0027] Figure 2 This is a Western blot assay for proteins. The blank control group was untransfected plasmid, the negative control group was transfected with empty vector plasmid, and the OKT3 and CD28 scFv groups were transfected with plasmids carrying the OKT3 and CD28 scFv encoding genes, respectively. Fusion proteins refer to the fusion of OKT3 and LAMP2 proteins and the fusion of CD28 scFv and LAMP2 proteins.

[0028] Figure 3 For particle size distribution analysis of Dunaliella salina exosomes using a particle size analyzer;

[0029] Figure 4 Microscopic images of T cells cultured for different times;

[0030] Figure 5 Roadmap for activating in vitro T cells via Dunaliella salina exosomes;

[0031] Figure 6 The graph shows a comparison of CD69 expression levels before and after T cell activation. In the graph, A represents the CD69 expression level of T cells before activation, and B represents the CD69 expression level of T cells after activation. Detailed Implementation

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0034] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0035] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0036] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0037] The pCAMBIA3301 used in the following examples was purchased from Beijing Huayueyang Biotechnology Co., Ltd.

[0038] Example 1

[0039] Preparation of Dunaliella salina cell exosomes

[0040] 1. Constructing plasmids

[0041] For the plasmid we constructed, it needs to be noted that its inserted fragments are fused, that is, OKT3 and LAMP2 are fused together, and the gene sequence is as follows:

[0042]

[0043] pCAMBIA3301 was selected as the expression plasmid. First, inverse PCR was performed to prepare a linearized vector. Then, an 18 bp homologous sequence was introduced into the 5' end of the forward primer (5-CAGGTGCAGCTGCAGCAGAGCGG-3) and the reverse primer (5-TTACAGAGTCTGATATCCAGCAT-3), respectively, resulting in: forward primer (5-GCTGTGCGGTCTTATGCACAGGTGCAGCTGCAGCAGAGCGG-3) and reverse primer (5-CAAGCTGCCTCCGCCGCCTTACAGAGTCTGATATCCAGCAT-3). The fusion gene fragment was then amplified (amplification program: pre-denaturation, 95℃, 30s; denaturation, 95℃, 15s; annealing, 60℃, 15s; extension, 72℃, 50s, 35 cycles; 72℃, 5min; 4℃, 10min) to ensure that the 5' and 3' end sequences of the amplified product were completely identical to the end sequences of the linearized vector. A one-step rapid cloning kit was then used to mix the linearized vector and insert fragment in a 1:3 ratio, and directional cloning was performed under the action of recombinase. The recombinant plasmid was then transformed into *E. coli* and plated for recombinant selection. After overnight culture and selection, single colonies were picked and cultured in a bacterial shaker at 37℃ and 200 rpm. The plasmid was then extracted, and after sequencing verification, the OKT3 recombinant plasmid was obtained. The plasmid construction method is as follows: Figure 1 As shown.

[0044] 2. Obtain stably transfected Dunaliella salina cells

[0045] The plasmid constructed in step 1 was introduced into Dunaliella salina cells using electroporation. The following describes the steps using the OKT3 plasmid as an example:

[0046] (1) To culture Dunaliella salina cells, a modified PKS liquid culture medium was prepared to simulate the natural growth environment of Dunaliella salina cells. This liquid culture medium contained salts such as NaCl (1M), MgSO4 (5mM), CaCl2 (0.2mM), KNO3 (10mM), and KH2PO4 (0.4mM), as well as iron salt solutions: Na2.EDTA.2H2O (4uM), FeCl3.6H2O (1.6uM) and trace elements such as CUCl2.2H2O (0.43uM), COCl2.2H2O (0.4uM), and ZnCl2 (0.4uM). A light incubator was selected as the Dunaliella salina cell incubator, with the temperature set at 26℃, the light intensity at 4000Lux, and the light-dark time ratio at 12h / 12h.

[0047] (2) Select Dunaliella salina cells in the logarithmic growth phase, use the heat shock method to render the Dunaliella salina cells immobile, use a hemocytometer to count the Dunaliella salina cells, and adjust the Dunaliella salina cell concentration to 1.0 × 10⁻⁶. 7 / mL; transfer to a 1.5 mL sterile EP tube and place on ice for 10 min for an ice bath.

[0048] (3) Take 1 mL of logarithmic growth-phase Dunaliella salina cells that have been chilled in an ice bath and 20 μg of the plasmid prepared in step 1 into an electroporation cup. Set the electroporation parameters to 800 V, 25 μF, 400 Ω and control the pulse time to 4 ms to obtain the optimal electroporation efficiency.

[0049] (4) After the electrocution is completed, the Dunaliella salina cells are first inoculated into fresh liquid culture medium and stabilized in a light incubator for 12 hours.

[0050] (5) Solid culture screening, preparation of 20 mg·L -1 For solid culture medium containing high concentration of glufosinate (PPT), take 200 μL of Dunaliella salina cell suspension, spread it evenly on the solid culture medium, and place it upright in a light incubator for 12 hours, then invert it for culture until Dunaliella salina colonies grow.

[0051] The steps for introducing the CD28 scFv recombinant plasmid into Dunaliella salina cells are the same as above. It should be noted that the CD28 scFv gene sequence is: GATATCGTGCTGACACAGTCCCCTGCATCTCTGGCCGTGTCTCTGGGACAGAGGGCAACCATCAGCTGCAGAGCCTCTGAGAGCGTGGAGTACTATGTGACATCCCTGATGCAGTGGTATCAGCAGAAGCCTGGCCAGCCCCCTAAGCTGCTGATCTTCGCAGCAAGCAACGTGGAGTCCGGAGTGCCAGCAAGGTTCTCCGGCTCTGGCAGCGGAACCAACTTTAGCCTGAATATCCACCCCGTGGACGAGGACGATGTGGCCATGTATTTCTGCCAGCAGTCCAGGAAGGTGCCTTACACCTTTGGCGGCGGCACAAAGCTGGAGATCAAGAGGGGAGGAGGAGGCAGCGGCGGAGGAGGCTC CGGCGGCGGCGGCTCTCAGGTGAAGCTGCAGCAGAGCGGACCTGGCCTGGTGACCCCATCCCAGTCTCTGAGCATCACCTGTACAGTGTCCGGCTTTTCCCTGTCTGACTATGGAGTGCACTGGGTGCGGCAGTCCAGGACAGGGCCTGGAGTGGCTGGGCGTGATCTGGGCAGGAGGAGGCACCA ACTACAATTCTGCCCTGATGAGCAGAAAGAGCATCTCCAAGGATAACTCTAAGAGCCAGGTGTTCCTGAAGATGAATAGCCTGCAGGCCGACGATACAGCCGTGTACTATTGTGCCAGAGACAAGGGCTATTCCTACTATTACTCTATGGATTACTGGGGCCAGGGCACCACAGTGACCGTGAGCTCC

[0052] Forward primer: 5-GATATCGTGCTGACACAGTCCCC-3

[0053] Reverse primer: 5-TTACAGAGTCTGATATCCAGCAT-3

[0054] After adding the homologous fragment at the end of the vector:

[0055] Forward primer: 5-GCTGTGCGGTCTTATGCAGATATCGTGCTGACACAGTCCCC-3

[0056] Reverse primer: 5-CAAGCTGCCTCCGCCGCCTTACAGAGTCTGATATCCAGCAT-3

[0057] 3. Identification of stably transfected Dunaliella salina cells

[0058] Proteins from the Dunaliella salina cells obtained after introducing the two plasmids in step 2 were extracted and subjected to Western blotting assays. LAMP2 antibody was selected as the primary antibody. Results are shown below. Figure 2 LAMP2 has 1233 bp, or 410 amino acids, with a calculated molecular weight of 45 kDa. The actual observed band was around 100 kDa. OKT3 has 723 bp, or 241 amino acids, with a calculated molecular weight of 24.3 kDa. Therefore, the fusion protein has a molecular weight of 125 kDa. This was determined after a preliminary experiment. Figure 2 As shown, compared with the blank control and negative control, cells transfected with the fusion plasmid showed expression of the fusion protein. According to the bands, the result is consistent with the expected result, that is, the fusion protein is expressed in Dunaliella salina cells.

[0059] 4. Collect exosomes from Dunaliella salina cells.

[0060] Pick individual algal colonies from the two types of Dunaliella salina from step 2, transferring them to liquid culture medium. When the medium turns dark green, replace the supernatant. Repeat this process 2-3 times to collect 200 mL of culture medium. Perform preliminary treatment on the collected medium: Take several sterile centrifuge tubes, aliquot each with Dunaliella salina cell culture medium, and centrifuge at 5000 rpm for 3 minutes. After centrifugation, collect the supernatant and store them separately at 4°C. Separately, thoroughly resuspend the Dunaliella salina cell pellet in fresh culture medium, gently agitate, and then inoculate into culture flasks and incubate them in a light incubator. Exosomes were obtained by ultracentrifugation of the pre-treated supernatant. Specifically, the supernatants from the two types of Dunaliella salina cells were centrifuged again at 5000 rpm for 60 min. The precipitate was discarded, and the supernatant was ultracentrifuged at 100000 g for 90 min. After centrifugation, the supernatant was discarded, and the precipitate was resuspended in 1 mL of PBS. Approximately 4-6 mg of exosomes were obtained from 200 mL of supernatant. The exosome precipitates were then stored at -80°C for later use. The two types of exosomes were named OKT3 Dunaliella salina exosomes and CD28 scFv Dunaliella salina exosomes, respectively. The particle size of the Dunaliella salina exosomes was measured using a particle size analyzer. Figure 3As shown, by observation Figure 3 It is known that the particle size of Dunaliella salina exosomes is 130 nm.

[0061] Example 2

[0062] In vitro activated T cells

[0063] 1. Extracting T lymphocytes from peripheral blood:

[0064] (1) Draw 10 ml of venous whole blood from a healthy adult and add an anticoagulant, the anticoagulant being heparin;

[0065] (2) Dilute fresh anticoagulated whole blood with sterile 1×PBS or physiological saline at a ratio of 1:1;

[0066] (3) Slowly add diluted blood to a clean glass centrifuge tube that has been filled with lymphocyte separation solution (the main component of which is Ficoll solution with a density of 1.077±0.001 g / mL), so that the blood spreads evenly above the surface of the separation solution, and be careful to keep the interface between the two liquid surfaces clear;

[0067] (4) Centrifuge at room temperature using a horizontal rotor at 2000 rpm for 30 min. After centrifugation, distinct layers will appear (from top to bottom: plasma layer, mononuclear cell layer, separation liquid layer, erythrocyte and granulocyte layer). Transfer the white membrane layer cells to a 10 mL sterile centrifuge tube, add 6 mL of PBS solution to the centrifuge tube, mix well, and centrifuge at 1250 rpm for 10 min.

[0068] (5) Discard the supernatant, resuspend the cells in 5 mL of PBS solution, and centrifuge again at 1250 rpm for 10 min. After centrifugation, discard the supernatant and repeat this step once more.

[0069] (6) Prepare 1640 culture medium (add 10% fetal bovine serum, 200 U / mL IL-2, 100 U / mL penicillin and 100 μg / mL streptomycin), resuspend the cell pellet and seed the cells in culture flasks for culture. After 12 h of culture, remove the adherent cells and leave the non-adherent cells to obtain T lymphocytes.

[0070] 2. Dunaliella salina exosomes activate T cells:

[0071] (1) With 1×10 6 The T lymphocytes obtained in step 1 were seeded into six-well plates at a concentration of cells / mL.

[0072] (2) Add the OKT3 Dunaliella salina exosomes and CD28 scFv Dunaliella salina exosomes prepared in Example 1 to the six-well plate, ensuring that the ratio of OKT3, CD28 scFv exosomes to cells is 0.25~1.25∶0.25~1.25∶1.

[0073] (3) Add recombinant human IL-2 to the six-well plate. Preferably, the optimal amount of IL-2 added is 200 U / mL.

[0074] (4) Culture in a CO2 cell incubator at 37°C;

[0075] (5) Examine the culture daily, observing the size and shape of the cells; among them, T cells at different culture times, such as Figure 4 As shown; via Figure 4 It can be seen that as the culture time of T cells increases, the formation of T cell clones becomes more pronounced;

[0076] (6) Perform cell counting every two days, and thoroughly resuspend the cells each time to ensure thorough mixing;

[0077] (7) When the cell density exceeds 2.5 × 10 6 Cells / mL or when the culture medium turns yellow, expand the wells with cells at a 1:2 ratio.

[0078] The roadmap for activating in vitro T cells using Dunaliella salina exosomes is as follows: Figure 5 As shown.

[0079] 3. Detection of T cell activation:

[0080] The expression rate of CD69 in activated T cells was detected by flow cytometry. The specific procedure was as follows:

[0081] (1) With 1×10 6 Unactivated T cells were seeded in a six-well plate at a concentration of 1 cell / mL;

[0082] (2) Select one well and add OKT3 Dunaliella salina exosomes and CD28 scFv Dunaliella salina exosomes to ensure that the ratio of OKT3, CD28 scFv exosomes to cells is 0.25~1.25:0.25~1.25:1. Add an equal volume of PBS buffer to the other well.

[0083] (3) Collect cells after 12 hours and wash twice with PBS at 1000 rpm for 5 min;

[0084] (4) Add 5 μL of APC fluorescently labeled CD69 antibody to each of the two wells and incubate at 4°C in the dark for 30 min.

[0085] (5) APC fluorescence signal was detected in the FL4 channel of a BD flow cytometer. The expression levels of CD69 in the two wells were as follows: Figure 6 As shown, through Figure 6 It can be seen that there is a significant difference in CD69 expression levels before and after T cell activation.

[0086] 4. Cell proliferation was detected using the CCK8 assay kit. The specific steps are as follows:

[0087] (1) Add 6000 unactivated T cells to each well of a 96-well plate;

[0088] (2) The cells were divided into seven groups according to the following ratios: blank group, IL-2 group, OKT3, CD28 scFv exosomes to cells ratio of 0.25:0.25:1, OKT3, CD28 scFv exosomes to cells ratio of 0.5:0.5:1, OKT3, CD28 scFv exosomes to cells ratio of 0.75:0.75:1, OKT3, CD28 scFv exosomes to cells ratio of 1:1:1, and OKT3, CD28 scFv exosomes to cells ratio of 1.25:1.25:1. 1640 complete culture medium and 1640 complete culture medium + 200 U / mL IL-2 were added to each of the seven groups respectively.

[0089] 1640 complete culture medium + 200 U / mL IL-2 + 1.5 × 10⁻⁶ 3 OKT3 exosomes+1.5×10 3 CD28 scFv exosomes;

[0090] 1640 complete culture medium + 200 U / mL IL-2 + 3 × 10 3 OKT3 exosomes+3×10 3 CD28 scFv exosomes;

[0091] 1640 complete culture medium + 200 U / mL IL-2 + 4.5 × 10⁻⁶ 3 OKT3 exosomes+4.5×10 3 CD28 scFv exosomes;

[0092] 1640 complete culture medium + 200 U / mL IL-2 + 6 × 10 3 OKT3 exosomes+6×10 3 CD28 scFv exosomes;

[0093] 1640 complete culture medium + 200 U / mL IL-2 + 7.5 × 10⁻⁶ 3 OKT3 exosomes+7.5×10 3 CD28 scFv exosomes;

[0094] (3) When the cell density exceeds 2.5 × 10 6 Cells / mL, expand the wells with cells at a ratio of 1:2;

[0095] (4) Then, 10 μL of CCK8 solution was added every two days, and the absorbance of each well was measured at 450 nm.

[0096] The absorbance was measured at 450 nm on days 0, 2, 4, 6, 8, and 10.

[0097] Based on the experimental results: A (blank) = 0.045, A (0 with added drug) = 0.30

[0098] The approximate absorbance values ​​for the blank control group were: 0.10, 0.106, 0.183, 0.235, 0.26, and 0.283.

[0099] The absorbance values ​​of the IL-2 group were: 0.10, 0.166, 0.292, 0.45, 0.608, and 0.693, respectively.

[0100] The absorbance of the OKT3 / CD28 scFv exosome group (0.25:0.25:1) was 0.1, 0.306, 0.289, 0.389, 0.3446, and 0.314. (This group was passaged every two days at a 1:2 ratio. Therefore, the actual absorbance values ​​on days 4, 6, 8, and 10 should be 0.578, 1.556, 2.757, and 5.024, respectively.)

[0101] The absorbance of the OKT3 / CD28 scFv exosome group (0.5:0.5:1) was 0.1, 0.318, 0.546, 0.556, 0.532, and 0.531.

[0102] (This group was passaged every two days at a ratio of 1:2. That is, the actual absorbance values ​​on days 4, 6, 8, and 10 should be 1.092, 2.224, 4.256, and 8.496, respectively.)

[0103] The absorbance values ​​of the OKT3 / CD28 scFv exosome group (0.75:0.75:1) were: 0.1, 0.494, 0.8, 0.7229, 0.761, and 0.6778 (this group was passaged every two days at a 1:2 ratio. That is, the actual absorbance values ​​on days 4, 6, 8, and 10 should be 1.6, 2.891, 6.09, and 10.845, respectively).

[0104] The absorbance of the OKT3 / CD28 scFv exosome group (1:1:1) was 0.1, 0.46, 0.79, 0.72, 0.802, and 0.688.

[0105] (This group was passaged every two days at a ratio of 1:2. That is, the actual absorbance values ​​on days 4, 6, 8, and 10 should be 1.58, 2.884, 6.416, and 11.008, respectively.)

[0106] The absorbance values ​​of the OKT3 / CD28 scFv exosome group (1.25:1.25:1) were: 0.1, 0.467, 0.808, 0.80, 0.782, and 0.719 (this group was passaged every two days at a 1:2 ratio. That is, the actual absorbance values ​​on days 4, 6, 8, and 10 should be 1.6175, 3.20, 6.2575, and 11.505, respectively).

[0107] 5. Cell proliferation detection:

[0108] We conducted a T-cell proliferation experiment to verify this, and the changes in cell number in each group are shown in the table below:

[0109] Day0 6000 6000 6000 6000 6000 6000 6000 Day 2 6409 10050 18369 19120 29656 27660 28040 Day 4 11012 17502 34652 65546 96050 95006 97056 Day 6 14105 27004 93610 133984 173710 173051 193116 Day 8 16110 36526 167320 295370 405514 417418 465450 Day 10 17023 41006 302029 509824 656702 660870 680325

[0110] The results above show that as the amount of exosomes used increases, the T cell expansion fold gradually increases. Compared with other groups, the OKT3 / CD28 scFv exosome group (0.75:0.75:1) showed excellent expansion effect. Considering the cost, we believe that the 0.75:0.75:1 ratio is the best choice.

[0111] The above embodiments describe the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are only illustrative of the principles of the present invention. Various changes and modifications can be made to the present invention without departing from the scope of the principles of the present invention, and all such changes and modifications fall within the protection scope of the present invention.

Images