Rice leaf senescence regulation gene pwl1, protein encoded by the same and application thereof

Abstract

The application belongs to the field of agricultural biotechnology engineering, and particularly relates to a rice leaf senescence regulation gene PWL1, a protein encoded by the gene, and application of the gene in rice breeding. The gene in a rice plant can be mutated by a gene editing method to obtain a rice variety with a lower leaf wilting and early senescence phenotype, or the gene is introduced to obtain a rice variety with a lower leaf wilting and early senescence recovery, and the gene has practical value in rice breeding.

Description

Technical Field

[0001] This invention belongs to agricultural biotechnology engineering, specifically relating to a rice leaf senescence regulatory gene PWL1, its encoded protein, and its application in rice breeding. Background Technology

[0002] Plant leaf senescence is the final stage of leaf development and an adaptive mechanism formed by plants during long-term evolution. As the final stage of leaf growth and development, leaf senescence is caused by external and internal signals. This process includes changes in cell structure and physiology, leading to the degradation of macromolecules (such as chlorophyll, proteins, nucleic acids and lipids), redistribution of nutrients and destruction of cell structure. It is regulated by plant hormones, endogenous factors of some metabolites, and the state of photosynthesis. Studies have shown that the plant senescence process can be divided into two stages: (1) the reversible senescence stage, in which cells exist in a living state and still have relevant functions. When external stress or internal signals disappear, cells can quickly return to normal. (2) the irreversible senescence stage, at which time organelles in the cells rupture, cell membrane permeability decreases, cell proliferation and differentiation capacity and physiological functions gradually decline, and chromatin begins to degrade, PCD occurs, that is, the effects produced cannot be reversed. As an important source organ of rice (Oryza sativa), the leaf provides the plant with various nutrients, including a large amount of energy and organic matter, to ensure the normal growth and development of rice. The senescence of rice first manifests in the leaves. Extensive breeding practices have revealed that premature leaf senescence shortens the functional period of rice leaves, leading to a lack of available nutrients and severely impacting grain development, thus causing a decline in rice yield and quality. Therefore, the senescence process largely determines crop yield and quality.

[0003] The most significant morphological change in leaf senescence is the change in leaf color. There are three main types of morphological changes in rice leaf senescence: (1) premature yellowing of most rice leaves due to chlorophyll loss; (2) leaf curling, extending from the leaf margin to the leaf tip, and then spreading to the entire leaf; (3) pathogenesis-associated proteins (PRS) and other factors cause spots to gradually appear in the middle of the leaf, and even local necrosis. The senescence process of rice is accompanied by many complex physiological and biochemical reactions. Scientists have created a large number of rice leaf premature senescence-related mutants using physical radiation, chemical mutagenesis, and T-DNA insertion techniques. With the development of map-based cloning technology, research on rice leaf premature senescence has developed rapidly. During leaf senescence, the expression of some genes is suppressed, while the expression of others is promoted. These genes that show significant changes in the expression level of RNA or protein are called senescence-associated genes (SAGs). These mainly include genes related to hormone pathways, genes related to chloroplast development and chlorophyll degradation, genes related to protease or substance transport metabolism, genes related to transcription factor families, and other pathway-related genes such as phytochromes. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a rice leaf senescence regulatory gene PWL1 and its encoded protein, as well as transgenic plant cells obtained therefrom, and a method for modifying rice leaf senescence using said gene.

[0005] To address the aforementioned technical problems, this invention provides a protein encoded by the rice leaf senescence regulatory gene PWL1, as shown in (A) or (B) as follows: (A) The amino acid sequence shown in SEQ ID No: 3; (B) An amino acid sequence that has at least 70%, 80%, 90%, 95%, 98%, or 99% homology with the amino acid sequence defined in (A) and has the function of regulating rice leaf senescence. (C) A protein derived from (A) with the addition, substitution or deletion of one or more amino acids in the amino acid sequence defined in (A) and having the function of regulating rice leaf senescence.

[0006] The present invention also provides a gene encoding the above-mentioned protein.

[0007] As a further improvement, the above genes, as shown in (a) or (b), have the following sequences: (a) The nucleotide sequences shown in SEQ ID No: 1 and SEQ ID No: 2; (b) A mutant gene, allele or derivative that encodes a protein that regulates the senescence of rice leaves by adding, substituting or deleting one or more nucleotides in the nucleotide sequence defined in (a). The present invention also provides a recombinant vector containing the above-mentioned genes.

[0008] As a further improvement, the carrier is pCAMBIA1300.

[0009] The present invention also provides a host cell containing the above-mentioned genes.

[0010] Preferably, the host cell is an Escherichia coli cell or an Agrobacterium cell.

[0011] This invention also provides the application of the aforementioned gene in the breeding of rice varieties that regulate rice leaf senescence.

[0012] Specifically, rice varieties exhibiting the lower leaf blight and premature senescence phenotype are obtained by mutating the aforementioned gene in rice plants using gene editing methods, or rice varieties recovering from lower leaf blight and premature senescence are obtained by introducing overexpression of the aforementioned gene. The rice varieties obtained by the former can be used as research materials or controls for the lower leaf blight and premature senescence phenotype.

[0013] This invention also provides a method for cultivating rice varieties that regulate leaf senescence, characterized by comprising transforming rice cells with the aforementioned gene for overexpression, and then cultivating the transformed rice cells into plants, optionally starting with rice varieties exhibiting the lower leaf withering and premature senescence phenotype. Specifically, the transformation is performed using Agrobacterium infection.

[0014] Further details: The purpose of this invention is to provide a novel gene, PWL1, cloned from the rice mutant pwl1, having the DNA sequences shown in SEQ ID No: 1 and SEQ ID No: 2, and also including gene sequences with at least 70%, 80%, 90%, 95%, 98%, and 99% homology to the DNA sequences shown in SEQ ID No: 1 and SEQ ID No: 2. The protein shown in SEQ ID No: 3 of this invention belongs to the class of cytoplasmic receptor kinases, and is a functional analog obtained by substitution, insertion, or deletion of one or more amino acids. Additionally, it also includes mutants, alleles, or derivatives generated by substitution, insertion, or deletion of one or more nucleotides in SEQ ID No: 1 and SEQ ID No: 2; sequences with the same function can also achieve the purpose of this invention.

[0015] Another object of the present invention is to provide a method for efficient plant transformation using the PWL1 gene. Specifically, the present invention provides a recombinant vector and transformant having the sequences shown in SEQ ID No: 1 and SEQ ID No: 2, wherein, as Figure 3 The pCAMBIA1300-PWL1 vector shown can express polypeptides or their homologs encoded by the above nucleotide sequence.

[0016] This invention, through research and verification, describes how to obtain rice varieties with the lower leaf blight and premature senescence phenotype by mutating the PWL1 gene in rice plants using gene editing methods, or how to obtain rice varieties that recover from lower leaf blight and premature senescence by introducing overexpression of the gene. This invention has practical value in rice breeding. Attached Figure Description

[0017] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0018] Figure 1 Phenotypic analysis of wild-type WT and the lower leaf blight mutant pwl1: A: Phenotyps of wild-type (left) and pwl1 (right) at the seedling stage; B: Comparison of chlorophyll content of leaves at different parts of the seedling stage; C: Phenotyps of wild-type (left) and pwl1 (right) at the heading stage; D: Comparison of chlorophyll content of the top leaf of wild-type and pwl1 at the heading stage.

[0019] Figure 2 This is a map showing the location of the PWL1 gene. A: Initial location of the PWL1 gene; B: Fine location map of the PWL1 gene on rice chromosome 3; C: Target gene structure analysis and mutation site sequencing of the PWL1 gene location region.

[0020] Figure 3 This is the spectrum of the functionally complementary vector pCAMBIA1300-PWL1.

[0021] Figure 4 The functional complementation experiment involved sequencing verification (A) and phenotypic identification of T1 transgenic rice plants. Detailed Implementation

[0022] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto: To more fully explain the implementation of this invention, examples of the pwl1 gene, a rice lower leaf blight and premature senescence mutant, are provided below. These examples are merely illustrative and not intended to limit the scope of the invention. All raw materials used are commercially available. All culture media used in the examples (induction medium, screening medium, differentiation medium) are conventional culture media.

[0023] Example 1: Obtaining and phenotype of mutant materials A lower leaf withering mutant, pwl1, was screened from the indica rice variety Jingang 30 by EMS (ethyl methanesulfonate) chemical mutagenesis. This mutant's traits have been stably inherited through multiple generations of self-pollination. It exhibits premature senescence phenotypes starting at the 5-leaf stage, with wilting occurring at the fifth leaf from the bottom and at the tip of the fourth leaf from the bottom. Figure 1 (A), while the chlorophyll content is also relatively reduced ( Figure 1 (Medium B). By the heading stage, the premature senescence of the leaves was very obvious; except for the flag leaf, almost all the other leaves withered and died. Figure 1 In addition, the contents of chlorophyll a, chlorophyll b, and carotenoids in the sword leaves were also significantly reduced (C). Figure 1 (D).

[0024] Example 2: Genetic analysis and fine mapping of PWL1 The mutant pwl1 was crossed with the conventional japonica rice variety JG88 and the original parent JG30. The F1 plants all exhibited the normal wild-type phenotype, indicating that pwl1 is controlled by a recessive nuclear gene. The segregation ratio of the F2 segregating population (Table 1) showed that the segregation ratio of the normal phenotype plants to the lower leaf blight mutant phenotype was approximately 3:1 after a chi-square test. This indicates that the lower leaf blight phenotype of pwl1 is controlled by a single recessive nuclear gene.

[0025] Table 1. Genetic analysis of the lower leaf blight mutant pwl1 Polymorphic screening of the mutants pwl1 and JG88 was performed using InDel primers uniformly distributed across the 12 rice chromosomes, preserved in our laboratory. 112 primer pairs showed polymorphism. Linkage analysis was then performed on 21 leaf-blighted F2 plants from the JG88 / pwl1 strain to preliminarily confirm the chromosomal location of the target gene. Genomic DNA was extracted using the CTAB method. The specific steps are as follows: ① Weigh 0.1 g of rice leaves and grind them into powder using liquid nitrogen. Then add 600 ml of DNA extraction buffer prepared with CTAB solution (2% (m / V) CTAB, 100 mmol / L Tris-Cl, 20 mmol / L EDTA, 1.4 mol / L NaCl; pH 8.0) and incubate at 65°C for 40 minutes. Add 600 ml of chloroform:isoamyl alcohol (24:1 volume ratio) and mix well. Centrifuge at 10,000 rpm for 5 minutes and transfer the supernatant to a new centrifuge tube.

[0026] ② Add 2 / 3 to 1 volume of pre-cooled (to 4°C) isopropanol to the supernatant obtained after centrifugation in step ① above, and gently mix until DNA precipitates. Centrifuge at 13,000 rpm for 8 minutes and discard the supernatant.

[0027] ③ Wash the DNA precipitate obtained in step ② with 200 ml of 70% (volume concentration) ethanol.

[0028] ④ Dry the washed DNA and dissolve it in 100ml of TE buffer or pure water.

[0029] ⑤ The concentration of the DNA sample obtained in step ④ above was determined by ultraviolet spectrophotometry, and the integrity of the DNA was detected by 0.7% agarose gel electrophoresis. Complete and suitable DNA was used for PCR amplification, while incomplete DNA was extracted again until complete DNA was obtained.

[0030] The PCR reaction system used was a 10 μL system: 1 μL DNA template, 1 μL 10× PCR buffer, 0.5 μL each of forward and reverse primers (10 μmol / L), 1 μL dNTPs, 0.2 μL rTaq enzyme, and ddH2O to make up to 10 μL. The PCR amplification program was as follows: pre-denaturation at 94℃ for 4 min; denaturation at 94℃ for 30 s, annealing at 55℃~60℃ for 30 s (temperature varies depending on the primers), extension at 72℃ for 30 s, for 40 cycles; final extension at 72℃ for 10 min. PCR products were subjected to 4% agarose gel electrophoresis. After electrophoresis, the gel was photographed and read using a gel imaging system. Linkage analysis of the PWL1 gene using the 112 InDel primers selected above revealed linkage at marker ID3-19 on chromosome 3. Subsequent selection of markers upstream and downstream of this marker for region determination resulted in the target gene being located between markers ID3-29 and ID3-28 (e.g., ...). Figure 2 (As shown in Figure A). New polymorphic molecular markers were designed within this region, and using 725 F2 single plants, the gene was ultimately located between the two molecular markers ID3-50 and ID3-34 (as shown in Figure A). Figure 2 (As shown in B). Primer sequences are shown in Table 2.

[0031] Table 2 Molecular markers used for fine localization Primer name Forward primer (5′→3′) Reverse primer (5′→3′) ID3-17 ACACCGTGCCAGAAGTCAAT CAGTAACAAGGGGTGCAAAGC ID3-19 TCACCGTTCAGACTAGCATCT TGCAGATCTCCATCCAGAAAGT ID3-22 AACGACTGCAAAACCACGAA GTCAGGAACAACAATTCAAGGT ID3-28 GACTCGCCCAGATTCTCTCC GGGGTTGGGATGAAACGAAA ID3-29 GTCGTTGAGGTGAACAGGATAA GCCTCACAACGAAAACCAGA ID3-30 AGTCCACTGTCCACTGCTAG TGCAGCACGAACTTCAAGAC ID3-34 CTCATGGATGCAACGAGGTT CATACTCTCCCACCCACGTT ID3-36 GGATGGGCACGAATCATTGT GCTGGGCAATCACAATACACA ID3-46 GCTAGCAATCTCTTCCAGCAC GATGGAGTACTTGCGTCCCT ID3-50 GGCGGCAACACGACCAGCTT TAGTGGACCGACAATAATAT Example 3: Identification of Candidate Genes Based on the finely mapped 85.54 kb region, candidate genes were predicted in the rice genome database (http: / / rice.plantbiology.msu.edu / ), identifying 17 open reading frames (ORFs). Sequencing primers were designed for each gene, and candidate genes were amplified from the pwl1 and wild-type JG30 genomes using PCR for sequencing analysis. The results showed a one-base substitution mutation in the coding region of LOC_Os03g62180 in the pwl1 mutant, changing from G to A, resulting in a change from glycine (Gly) to glutamic acid (Glu). Figure 2 C). This was verified three times each using different mutant single plants and single plants with mutant phenotypes in the population, and the mutation site remained stable.

[0032] The amino acid sequence of the protein encoded by this gene is shown in SEQ ID No: 3. The full-length cDNA of this gene is shown in SEQ ID NO: 1, and the full-length gDNA is shown in SEQ ID NO: 2.

[0033] Example 4: Construction of functionally complementary vectors and transgenic functional complementarity To verify that the premature senescence and lower leaf withering phenotype of the rice mutant pwl1 is caused by the mutant gene PWL1, wild-type JG30 genomic DNA was used as a template. Primers for 1300-PWL1-CF (CGAGCTCGGTACCCGGGGATTGTTTCTGCAGCACTGGTC) and 1300-PWL1-CR (CAGGTCGACTCTAGAGGATAAATAAGACCCAGTATAAGCCTTAATC) were used to successfully amplify the full-length PWL1 DNA sequence, including the promoter, expression cassette, and terminator, via PCR. Subsequently, the PWL1 PCR product fragment was ligated into the BamHI-digested linearized vector pCAMBIA1300 using the Novizan ClonExpress II One Step Cloning Kit (catalog number: C112-01) via recombination. (Refer to the instruction manual for specific usage). The recombinant product was heat-shocked and transformed into E. coli TOP10, then plated on LB agar plates containing 50 mg / L kanamycin and grown for 16 hours. Positive clones were selected, and plasmids were sent to Beijing Sangon Biotech Co., Ltd. for sequencing. The correctly sequenced plasmid was named pCAMBIA1300-PWL1. Figure 3 ).

[0034] This plasmid was transferred into the Agrobacterium strain EHA105 via electroporation to transform rice. Callus tissue induced by the mature embryo of the mutant pwl1 was cultured on induction medium for 2 weeks, and vigorous callus was selected as the recipient for transformation. Rice callus was infected with EHA105 strain containing the binary plasmid vector (pCAMBIA1300-PWL1) and co-cultured in the dark at 25°C for 3 days. Then, it was cultured under light for approximately 14 days on selection medium containing 50 mg / L Hygromycin (light intensity 13200 LX, temperature 32°C). The pre-differentiated callus was transferred to differentiation medium and cultured under light conditions (light intensity 13200 LX, temperature 32°C) for approximately one month to obtain resistant transgenic plants. Identification and continuous observation of the plants revealed that, compared with the mutant at the tillering stage, the transgenic plants did not exhibit the premature senescence phenotype of lower leaves, but instead displayed the normal leaf phenotype. Sequencing revealed a bimodal distribution at the mutation site, indicating that the complementary vector could completely restore the premature senescence phenotype of lower leaves in pwl1. Figure 4 ).

[0035] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. Application of the rice leaf senescence regulatory gene PWL1 in the breeding of rice varieties that regulate rice leaf senescence; the amino acid sequence encoded by the rice leaf senescence regulatory gene PWL1 is shown in SEQ ID No: 3, and the nucleotide sequence is shown in SEQ ID No:

1. The application is to obtain rice varieties with the lower leaf blight and premature senescence phenotype by mutating the gene in rice plants using gene editing methods, wherein the mutation is to mutate position 1234 of SEQ ID No: 1 from G to A; or to obtain rice varieties that recover from lower leaf blight and premature senescence by introducing the gene, wherein the PWL1 gene in the rice varieties to be introduced with lower leaf blight and premature senescence is mutated, wherein the mutation is to mutate position 1234 of SEQ ID No: 1 from G to A.

2. A method for breeding rice varieties that regulate leaf senescence, characterized in that, The method involves transforming rice cells with the rice leaf senescence regulating gene PWL1 to overexpress the gene, then cultivating the transformed rice cells into plants, and the starting rice plants being rice varieties with a lower leaf withering and premature senescence phenotype. The PWL1 gene in the rice varieties with lower leaf withering and premature senescence has a mutation, which is a mutation of position 1234 of SEQ ID No: 1 from G to A; the amino acid sequence encoded by the rice leaf senescence regulating gene PWL1 is shown in SEQ ID No:

3.

3. The method as described in claim 2, characterized in that, The nucleotide sequence of the rice leaf senescence regulatory gene PWL1 is shown in SEQ ID No:

1.

4. The method as described in claim 2 or 3, characterized in that, The transformation was performed using the Agrobacterium infection method.

Images