Insect-resistant, glyphosate-tolerant transgenic maize event kj1183 and methods for detecting same

Abstract

The present application discloses a nucleic acid sequence for detecting corn event KJDLM528T201183 (commercial name KJ1183), which comprises any one of sequences SEQ ID NO: 1, 3, 5 and any one of sequences SEQ ID NO: 2, 4, 6; or comprises sequence SEQ ID NO: 7 or 8. The nucleic acid sequence is derived from a plant, seed or cell comprising corn event KJ1183. The transgenic corn event KJ1183 of the present application can effectively resist the damage of lepidopteran pests and tolerate high concentration of glyphosate herbicide, reduce the use of pesticides during corn planting, reduce production investment, and is conducive to controlling field weeds, improving farming efficiency and yield.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and plant breeding technology, and mainly relates to transgenic plants and their testing methods. Specifically, it relates to a transgenic maize event KJDLM528T201183 (commercial name KJ1183) that is resistant to insects and tolerant to glyphosate herbicide application, and a method for detecting whether a biological sample contains the nucleic acid sequence of the specific transgenic maize event KJ1183. Background Technology

[0002] Maize (Zea mays L.) is a major food crop and an important feed crop in many parts of the world. It is of strategic importance in the development of animal husbandry and aquaculture, and also has wide applications in medicine and chemicals. Biotechnology has been applied to improve the agronomic traits and quality of maize.

[0003] Over the past decade, corn pest infestations have shown a continuous increasing trend, particularly lepidopteran pests such as the corn borer, bollworm, fall armyworm, and armyworm. By using transgenic methods to express resistance genes from lepidopteran insects in corn plants, corn can acquire resistance to these insects. In the 1990s, Monsanto developed the insect-resistant transgenic corn MON810, which has proven effective in controlling the corn borer for over 20 years since its commercialization. Syngenta's MIR162 has shown good results in resisting the fall armyworm.

[0004] Another important agronomic trait in maize is herbicide (especially glyphosate) tolerance. In maize production, field weeding consumes a significant amount of labor, increasing planting costs. Delayed weeding can also lead to reduced maize yields, resulting in economic losses. By expressing glyphosate-tolerant genes (such as EPSPS) in maize plants through transgenic methods, maize can acquire tolerance to glyphosate herbicides.

[0005] Currently, the trend in maize biobreeding is to cultivate hybrid traits of insect resistance and herbicide tolerance. Domestically, transgenic maize varieties DBN9936 and Ruifeng 12-5 have obtained safety certificates. These varieties possess resistance to lepidopteran pests and glyphosate herbicide resistance, representing a hybrid trait of one insect-resistant gene and one herbicide-resistant gene. Using a single insect-resistant gene results in a narrow insect resistance spectrum, and long-term use carries the risk of target pests developing resistance.

[0006] It is known that the expression of exogenous genes in plants is influenced by their chromosomal location, possibly due to the proximity of chromatin structures (such as heterochromatin) or transcriptional regulatory elements (such as enhancers) to integration sites. Therefore, screening a large number of events is usually required to identify commercially viable events (i.e., events where the introduced target gene is optimally expressed). Commercially viable events exhibit superior resistance to lepidopteran pests (such as corn borers, cotton bollworms, armyworms, fall armyworms, and cutworms) and herbicides, without affecting other agronomic traits. These transgenes can be backcrossed into other genetic backgrounds using conventional breeding methods. Offspring produced through this hybridization retain the transgenic expression characteristics and phenotypic traits of the original transformant. Applying this strategy can ensure reliable gene expression in many varieties.

[0007] Methods for detecting specific events will be beneficial for later hybridization and transgenic breeding, identifying whether offspring contain the target gene. Furthermore, it will help comply with relevant regulations and protect products. Detecting the presence of transgenes using any well-known polynucleotide detection method is possible, such as polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. Generally, a pair of primers spanning the junction between the inserted transgene and the flanking DNA is used to identify transgene-specific events via PCR, specifically a first primer located at the flanking sequence and a second primer at the inserted sequence. Summary of the Invention

[0008] The purpose of this invention is to provide a transgenic maize event KJDLM528T201183 (commercial name KJ1183, hereinafter referred to as trade name) and a nucleic acid sequence and detection method for detecting maize event KJ1183, which can accurately and rapidly identify whether biological samples contain DNA molecules of a specific transgenic maize event KJ1183.

[0009] To achieve the above objectives, the present invention provides a nucleic acid sequence comprising one of the following (1)-(3):

[0010] (1) Any sequence of SEQ ID NO:1, 3, 5 or its complementary sequence, and any sequence of SEQ ID NO:2, 4, 6 or its complementary sequence;

[0011] (2) Sequence SEQ ID NO:7 or its complementary sequence;

[0012] (3) Sequence SEQ ID NO:8 or its complementary sequence.

[0013] The nucleic acid sequence is derived from the plant, seed, or cell of the transgenic maize event KJ1183. A representative sample of the seed (Latin name: Zea mays L.) of the maize event has been deposited at the China Center for Type Culture Collection (CCTCC, address: Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China) with accession number CCTCC NO:P202305 on March 13, 2023.

[0014] The SEQ ID NO:1 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 5' end of the inserted sequence in transgenic maize event KJ1183, and the SEQ ID NO:1 or its complementary sequence spans the flanking genomic DNA sequence of the maize insertion site and the DNA sequence at the 5' end of the inserted sequence; the SEQ ID NO:2 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence in transgenic maize event KJ1183, and the SEQ ID NO:2 or its complementary sequence spans the DNA sequence at the 3' end of the inserted sequence and the flanking genomic DNA sequence of the maize insertion site. The presence of transgenic maize event KJ1183 can be identified by the inclusion of the SEQ ID NO:1 and 2 or their complementary sequences.

[0015] In this invention, the nucleic acid sequence may be at least 11 or more consecutive polynucleotides (first nucleic acid sequence) of any portion of the transgenic insertion sequence in SEQ ID NO:3 or its complementary sequence, or at least 11 or more consecutive polynucleotides (second nucleic acid sequence) of any portion of the 5' flanking maize genomic DNA region in SEQ ID NO:3 or its complementary sequence. The nucleic acid sequence may further be a portion of SEQ ID NO:3 that is homologous to or complementary to the entirety of SEQ ID NO:1. When the first and second nucleic acid sequences are used together, these nucleic acid sequences include a DNA primer pair in a DNA amplification method for generating the amplification product. When the amplification product generated in the DNA amplification method using the DNA primer pair is an amplification product including SEQ ID NO:1, the presence of transgenic maize event KJ1183 or its progeny can be diagnosed. As is well known to those skilled in the art, the first and second nucleic acid sequences need not consist solely of DNA; they may also include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or analogues that do not serve as templates for one or more polymerases. Furthermore, the probes or primers described in this invention should be at least approximately 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides in length, which may be selected from the nucleotides described in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. When selected from the nucleotides shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, the probes and primers may be continuous nucleotides with a length of at least approximately 21 to approximately 50 or more. The SEQ ID NO:3 or its complementary sequence is a 1104-nucleotide sequence located near the insertion junction at the 5' end of the inserted sequence in transgenic maize event KJ1183. The SEQ ID NO:3 or its complementary sequence consists of a 686-nucleotide 5' maize flanking genomic DNA sequence (nucleotides 1-686 of SEQ ID NO:3) and a 418-nucleotide LB sequence (nucleotides 687-1104 of SEQ ID NO:3). The presence of the SEQ ID NO:3 or its complementary sequence is sufficient to identify the transgenic maize event KJ1183.

[0016] The nucleic acid sequence may be at least 11 or more consecutive polynucleotides (third nucleic acid sequence) of any portion of the transgenic insert sequence in SEQ ID NO:4 or its complementary sequence, or at least 11 or more consecutive polynucleotides (fourth nucleic acid sequence) of any portion of the 3' flanking maize genomic DNA region in SEQ ID NO:4 or its complementary sequence. The nucleic acid sequence may further be a portion of SEQ ID NO:4 that is homologous to or complementary to the complete SEQ ID NO:2. When the third and fourth nucleic acid sequences are used together, these nucleic acid sequences include a DNA primer set in the DNA amplification method that produces the amplification product. The presence of transgenic maize event KJ1183 or its progeny can be diagnosed when the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product including SEQ ID NO:2. The SEQ ID NO:4 or its complementary sequence is a 1099-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence in transgenic maize event KJ1183. The SEQ ID NO:4 or its complementary sequence consists of a 392-nucleotide T-DNA sequence (nucleotides 1-392 of SEQ ID NO:4), a 256-nucleotide terminator nos sequence of the carmine synthase gene (nucleotides 393-648 of SEQ ID NO:3), a 43-nucleotide RB sequence (nucleotides 649-691 of SEQ ID NO:3), and a 408-nucleotide genomic DNA sequence flanking the 3' maize integration site (nucleotides 692-1099 of SEQ ID NO:4). The presence of the SEQ ID NO:4 or its complementary sequence is sufficient to identify the transgenic maize event KJ1183.

[0017] The sequence SEQ ID NO:5 or its complementary sequence is located inside SEQ ID NO:3, containing 418 bp of T-DNA at the 5' end; the sequence SEQ ID NO:6 or its complementary sequence is located inside SEQ ID NO:4, containing 691 bp of T-DNA at the 3' end.

[0018] The sequence SEQ ID NO:7 or its complementary sequence is a 19129-nucleotide sequence characterizing the transgenic maize event KJ1183, which is the entire transgenic expression cassette, extended by 50 bp at each end. The sequence SEQ ID NO:8 or its complementary sequence is a 20123-nucleotide sequence characterizing the transgenic maize event KJ1183, containing SEQ ID NO:1-7, including the 5' maize genome flanking sequence, the entire transgenic expression cassette, and the 3' maize genome flanking sequence. The specific genome and genetic elements contained therein are shown in Table 1. The presence of the transgenic maize event KJ1183 can be identified by the presence of the sequence SEQ ID NO:8 or its complementary sequence.

[0019] Table 1 shows the genome and genetic elements contained in SEQ ID NO:8.

[0020]

[0021] The nucleic acid sequence or its complementary sequence can be used in DNA amplification to generate amplicones, the detection of which diagnoses the presence of transgenic maize event KJ1183 or its progeny in biological samples; the nucleic acid sequence or its complementary sequence can be used in nucleotide detection to detect the presence of transgenic maize event KJ1183 or its progeny in biological samples.

[0022] To achieve the above objectives, the present invention also provides a method for detecting the presence of DNA of transgenic maize event KJ1183 in a sample, comprising: contacting the sample to be tested with at least two primers in a nucleic acid amplification reaction;

[0023] Perform nucleic acid amplification reaction;

[0024] Detect the presence of amplification products;

[0025] The amplification product includes a nucleic acid sequence selected from sequences SEQ ID NO:1-8 and their complementary sequences, indicating that the test sample contains DNA from the transgenic maize event KJ1183.

[0026] The first primer is selected from SEQ ID NO:1 or its complementary sequence, and the second primer is selected from SEQ ID NO:2 or its complementary sequence, SEQ ID NO:10 or SEQ ID NO:30; or the first primer is selected from SEQ ID NO:2 or its complementary sequence, SEQ ID NO:10 or SEQ ID NO:30, and the second primer is selected from SEQ ID NO:9 or SEQ ID NO:31.

[0027] To achieve the above objectives, the present invention also provides a method for detecting the presence of DNA from the transgenic maize event KJ1183 in a sample, comprising:

[0028] The sample to be tested is brought into contact with the probe, which contains a portion of the sequence of SEQ ID NO:8 and its complementary sequence. The probe hybridizes with DNA molecules containing nucleic acid sequences selected from SEQ ID NO:1-8 or their complementary sequences under strict hybridization conditions, and does not hybridize with DNA molecules that do not contain nucleic acid sequences selected from SEQ ID NO:1-8 or their complementary sequences under strict conditions.

[0029] The sample to be tested and the probe are hybridized under strict hybridization conditions;

[0030] The hybridization between the sample to be tested and the probe is detected.

[0031] The stringent conditions can be defined as hybridization at 65°C in a 6×SSC (sodium citrate) and 0.5% SDS (sodium dodecyl sulfate) solution, followed by washing the membrane once each with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS.

[0032] In some embodiments, the probe comprises at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence;

[0033] Further, the probe comprises consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:1 or its complementary sequence, consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:2 or its complementary sequence, SEQ ID NO:5 or its complementary sequence, and SEQ ID NO:6 or its complementary sequence.

[0034] Alternatively, at least one of the probes may be labeled with at least one fluorescent group.

[0035] To achieve the above objectives, the present invention also provides a method for detecting the presence of DNA from the transgenic maize event KJ1183 in a sample, comprising:

[0036] The sample to be tested is brought into contact with a labeled nucleic acid molecule, the labeled nucleic acid molecule containing a portion of the sequence of SEQ ID NO:8 and its complementary sequence, the labeled nucleic acid molecule hybridizing with DNA molecules containing nucleic acid sequences selected from SEQ ID NO:1-8 or their complementary sequences under strict hybridization conditions, and not hybridizing with DNA molecules that do not contain nucleic acid sequences selected from SEQ ID NO:1-8 or their complementary sequences under strict conditions.

[0037] The sample to be tested and the labeled nucleic acid molecules are hybridized under strict hybridization conditions;

[0038] The hybridization of the sample to be tested and the marker nucleic acid molecule is detected, and then marker-assisted breeding analysis is used to determine whether insect resistance and / or herbicide tolerance are genetically linked to the marker nucleic acid molecule.

[0039] In one embodiment, the marker nucleic acid molecule comprises at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence.

[0040] Furthermore, the labeled nucleic acid molecule comprises a sequence selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:5 or its complementary sequence, and SEQ ID NO:6 or its complementary sequence.

[0041] To achieve the above objectives, the present invention also provides a DNA detection kit comprising at least one DNA molecule, wherein the DNA molecule comprises at least 11 consecutive nucleotides in the homologous sequence of SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in the homologous sequence of SEQ ID NO:4 or its complementary sequence, which can serve as a DNA primer or probe specific to the transgenic maize event KJ1183 or its progeny.

[0042] Further, the DNA molecule comprises consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:2 or its complementary sequence.

[0043] Furthermore, the DNA molecule includes the homologous sequence of SEQ ID NO:1 or its complementary sequence, the homologous sequence of SEQ ID NO:2 or its complementary sequence, the homologous sequence of SEQ ID NO:5 or its complementary sequence, or the homologous sequence of SEQ ID NO:6 or its complementary sequence.

[0044] To achieve the above objectives, the present invention also provides a plant cell comprising nucleic acid sequences encoding insect resistance vip3Aa19 protein, cry2Ab2 protein, and cry1A.105 protein, nucleic acid sequences encoding glyphosate herbicide tolerance CP4-EPSPS protein, and nucleic acid sequences in a specific region, wherein the nucleic acid sequences in the specific region include the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:6.

[0045] To achieve the above objectives, the present invention also provides a method for protecting maize plants from insect infestation, comprising providing at least one transgenic maize plant cell to the diet of target insects. The transgenic maize plant cell contains in its genome at least one nucleic acid sequence selected from the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. Target insects that ingest the transgenic maize plant cell are inhibited from further ingesting the maize plant. Specifically, the transgenic maize plant cell originates from the transgenic maize event KJ1183.

[0046] To achieve the above objectives, the present invention also provides a method for protecting maize plants from damage caused by herbicides, comprising applying a glyphosate herbicide containing an effective dose to a field planted with at least one transgenic maize plant, wherein the transgenic maize plant contains at least one nucleic acid sequence selected from the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8 in its genome, and the transgenic maize plant is tolerant to glyphosate herbicide. Specifically, the transgenic maize plant is a transgenic maize plant containing the transgenic maize event KJ1183.

[0047] To achieve the above objectives, the present invention also provides a method for controlling weeds in a field where maize plants are grown, comprising applying a glyphosate herbicide containing an effective dose to a field where at least one transgenic maize plant is grown, wherein the transgenic maize plant contains at least one nucleic acid sequence selected from the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8 in its genome, and the transgenic maize plant is tolerant to glyphosate herbicide. Specifically, the transgenic maize plant is a transgenic maize plant containing the transgenic maize event KJ1183.

[0048] To achieve the above objectives, the present invention also provides a method for cultivating maize plants resistant to insects, comprising: planting at least one maize seed, wherein the genome of the maize seed includes nucleic acid sequences encoding insect resistance proteins vip3Aa19, cry2Ab2, and cry1A.105, and nucleic acid sequences of specific regions; specifically, the maize seed may be a maize seed from the transgenic maize event KJ1183.

[0049] The corn seeds are allowed to grow into corn plants;

[0050] The maize plants were attacked with target insects, and the plants with reduced plant damage were harvested compared with other plants that do not have the specific region of the nucleic acid sequence or do not have the transgenic maize event KJ1183.

[0051] The nucleic acid sequence of the specific region is selected from at least one nucleic acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8.

[0052] To achieve the above objectives, the present invention also provides a method for cultivating maize plants tolerant to glyphosate herbicides, comprising: planting at least one maize seed, wherein the genome of the maize seed includes a nucleic acid sequence encoding a glyphosate herbicide tolerance cp4-epsps protein and a nucleic acid sequence of a specific region;

[0053] The corn seeds are allowed to grow into corn plants;

[0054] The corn plants were sprayed with an effective dose of glyphosate herbicide, and the plants with reduced plant damage compared to other plants that did not have a specific region of nucleic acid sequence were harvested.

[0055] The nucleic acid sequence in the specific region is selected from at least one nucleic acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8. Specifically, the maize seed is a maize seed from the transgenic maize event KJ1183.

[0056] To achieve the above objectives, the present invention also provides a method for cultivating maize plants that are resistant to insects and tolerant to glyphosate herbicides, comprising: planting at least one maize seed, wherein the genome of the maize seed includes nucleic acid sequences encoding insect resistance vip3Aa19 protein, cry2Ab2 protein, and cry1A.105 protein, nucleic acid sequence encoding glyphosate herbicide tolerance cp4-epsps protein, and nucleic acid sequences of a specific region;

[0057] The corn seeds are allowed to grow into corn plants;

[0058] The corn plants were sprayed with an effective dose of glyphosate herbicide, and the plants with reduced plant damage compared to other plants without specific regions of nucleic acid sequence were harvested. The plants with reduced plant damage were also resistant to insect feeding damage.

[0059] The nucleic acid sequence in the specific region is selected from at least one nucleic acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8. Specifically, the maize seed is a maize seed from the transgenic maize event KJ1183.

[0060] To achieve the above objectives, the present invention also provides a method for producing maize plants resistant to insects, comprising introducing nucleic acid sequences encoding insect resistance vip3Aa19 protein, cry2Ab2 protein, and cry1A.105 protein, and a nucleic acid sequence of a specific region into the genome of the maize plant, wherein the nucleic acid sequence of the specific region is selected from at least one nucleic acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8.

[0061] Specifically, the method for producing corn plants resistant to insects includes:

[0062] The first parent maize plant of the insect-resistant transgenic maize event KJ1183 was sexually crossed with the second parent maize plant lacking insect resistance, thereby producing a large number of offspring plants;

[0063] The offspring plants were invaded with target insects;

[0064] The progeny plants that exhibit reduced plant damage compared to other plants that do not have specific regions of nucleic acid sequence were selected.

[0065] The genetically modified maize event KJ1183 contains at least one nucleic acid sequence selected from the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8 in its genome.

[0066] To achieve the above objectives, the present invention also provides a method for producing maize plants resistant to glyphosate herbicides, comprising introducing into the genome of the maize plant a nucleic acid sequence encoding a glyphosate-resistant cp4-epsps protein and a nucleic acid sequence of a specific region, wherein the nucleic acid sequence of the specific region is selected from at least one nucleic acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8.

[0067] Specifically, the method for producing maize plants tolerant to glyphosate herbicides includes: sexually crossing the first parent maize plant of transgenic maize event KJ1183, which is tolerant to glyphosate herbicides, with the second parent maize plant lacking glyphosate tolerance, thereby producing a large number of offspring plants.

[0068] The progeny plants were treated with glyphosate herbicide;

[0069] Select the progeny plants that are tolerant to glyphosate;

[0070] The genetically modified maize event KJ1183 contains at least one nucleic acid sequence selected from the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8 in its genome.

[0071] To achieve the above objectives, the present invention also provides a method for producing maize plants that are resistant to insects and tolerant to glyphosate herbicide application, comprising: sexually crossing a first parent maize plant of glyphosate-tolerant and insect-resistant transgenic maize event KJ1183 with a second parent maize plant lacking glyphosate tolerance and / or insect resistance, thereby producing a large number of progeny plants;

[0072] The corn plants were attacked with target insects, and the progeny plants were treated with glyphosate.

[0073] Select plants that are tolerant to glyphosate and have reduced damage from insect feeding;

[0074] The genetically modified maize event KJ1183 contains at least one nucleic acid sequence selected from the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8 in its genome.

[0075] To achieve the above objectives, the present invention also provides a processed product derived from the genetically modified corn event KJ1183, the processed product being corn flour, cornmeal, corn oil, corn silk, corn starch, corn gluten, corn cake, cosmetics, or fillers.

[0076] In the present invention for detecting nucleic acid sequences of maize plants and the detection method thereof, the following definitions and methods are intended to better define the present invention and guide those skilled in the art to implement it. Unless otherwise stated, the terms shall be understood according to their conventional usage by those skilled in the art.

[0077] Transformation procedures that induce random integration of exogenous DNA result in transformants containing distinct flanking regions, which are unique to each transformant. When recombinant DNA is introduced into plants via conventional hybridization, these flanking regions typically remain unchanged. Transformants also contain unique junctions between segments of the heterologous insert DNA and genomic DNA, or between two segments of genomic DNA, or between two segments of heterologous DNA.

[0078] This invention provides a transgenic maize event known as KJ1183 and its progeny, wherein the transgenic maize event KJ1183 is the maize plant KJ1183, which includes the plant and seeds of the transgenic maize event KJ1183 and its plant cells or renewable parts thereof. The plant parts of the transgenic maize event KJ1183 include, but are not limited to, cells, pollen, ovules, flowers, buds, roots, stems, silks, inflorescences, ears, leaves and products from the maize plant KJ1183, such as corn flour, cornmeal, corn oil, corn steep liquor, corn silks, corn starch and biomass remaining in the maize crop field.

[0079] The present invention relates to a transgenic maize component KJ1183 comprising a DNA construct that, when expressed in plant cells, acquires resistance to insects and tolerance to glyphosate herbicides.

[0080] In some embodiments of the invention, the DNA construct comprises four tandem expression cassettes. The first expression cassette contains a suitable promoter and terminator for expression in plants. The promoter is operatively linked to the cp4-epspsp gene from Agrobacterium sp. strain CP4. The cp4-epsps protein has a low affinity for glyphosate. Expression of the cp4-epsps protein in plants can reconstruct the shikimic acid synthesis pathway in plants when glyphosate is applied, allowing the transgenic plants to continue synthesizing aromatic amino acids and resist glyphosate herbicides. The second expression cassette contains a suitable promoter and terminator for expression in plants. The promoter is operatively linked to a gene from Bacillus thuringiensis. The first expression cassette contains the nucleic acid sequence of the insect resistance vip3Aa19 protein from Bacillus thuringiensis (Bt), which exhibits resistance to lepidopteran insects and is highly effective against armyworms, cutworms, fall armyworms, and cotton bollworms. The second expression cassette contains a suitable promoter and terminator for expression in plants. The promoter is operatively linked to the nucleic acid sequence of the Cry1Ab.105 protein from Bacillus thuringiensis (Bt), which is composed of components of the Cry1Ab, Cry1Ac, and Cry1F protein sequences and exhibits high insecticidal activity against armyworms, cutworms, and corn borers. The fourth expression cassette contains a suitable promoter and terminator for expression in plants, wherein the promoter is operatively linked to the nucleic acid sequence of the insect-resistant cry2A2 protein from Bacillus thuringiensis (Bt), which possesses lepidopteran insect resistance and can efficiently kill the larvae of lepidopteran pests such as bollworm, corn borer, and fall armyworm.

[0081] Among the three different insect-resistant proteins simultaneously expressed in the maize transgenic event KJ1183 of this invention, cry1A.105 and cry2Ab2 proteins belong to insecticidal crystal proteins (ICPs) formed by Bacillus thuringiensis during sporulation, while vip3Aa19 protein belongs to vegetative insecticidal proteins (VIPs) secreted extracellularly by Bacillus thuringiensis during the vegetative phase. ICPs and VIPs have similar toxicological activities and specificity, but their molecular structures and toxicological mechanisms are different. Although cry1A.105 and cry2Ab2 proteins both belong to insecticidal crystal proteins, their structures are very different, and their amino acid similarity is only 14%. They each have different affinities for binding receptor proteins on the gut of different lepidopteran insects, resulting in different toxic efficiencies against different lepidopteran pests. The insect-resistant mechanism of Vip protein is similar to that of Cry protein, and membrane competition experiments show that Vip protein has completely different binding receptors on the midgut epithelial membrane of the insect gut. The three proteins bind to different receptors on the intestinal epithelial cell membranes of the target pests. Due to their different resistance mechanisms, there is no cross-resistance, which can effectively delay the development of pest resistance and extend the product's life cycle. Co-expression of the three proteins enables the transgenic maize product KJ1183 to effectively resist damage from major lepidopteran pests of maize, thereby increasing the profits of maize growers.

[0082] Furthermore, the promoter can be a suitable promoter isolated from plants, including but not limited to the rice TubA promoter, the maize ubiquitin protein (ZmUbiInt) promoter, the cauliflower mosaic virus (CaMV) 35S promoter, and the Scrophularia mosaic virus (FMV) 35S promoter. The terminator can be a suitable terminator isolated from plants, including but not limited to the rice TubA terminator TubA Ter, the pea rbcs2E9 gene terminator E9, the cauliflower mosaic virus (CaMV) 35S terminator, the wild barley Hsp17 terminator, and the Agrobacterium tumefaciens carmine synthase (NOS) gene terminator nos.

[0083] In addition, the expression cassette may also include other genetic elements, including but not limited to enhancers and signal peptide / transporter nucleic acid coding sequences. The enhancers can enhance gene expression levels, and include, but are not limited to, ZmHsp70 (the first intron of maize heat shock protein 70, enhancing stable expression of cry2Ab2 protein), Cab (the 5'UTR sequence of wheat chlorophyll a / b binding protein, enhancing stable expression of cry1A.105), and Ract1 (the first intron sequence of rice actin 1, enhancing stable expression of cry1A.105). The signal peptide / transporter includes, but is not limited to, CTP2 (encoding a chloroplast transport peptide that localizes cp4-epsps protein to chloroplasts for processing into mature protein) and SSU-CTP (encoding a chloroplast transport peptide that localizes cry2Ab2 protein to chloroplasts for processing into mature protein).

[0084] The DNA construct is introduced into plants using transformation methods, including but not limited to Agrobacterium-mediated transformation, gene gun transformation, and pollen tube pathway transformation.

[0085] DNA constructs are combinations of interconnected DNA molecules that provide one or more expression cassettes. Preferably, the DNA constructs are plasmids capable of self-replication within bacterial cells and containing various restriction endonuclease sites for introducing DNA molecules that provide functional genetic elements, i.e., promoters, introns, leader sequences, coding sequences, 3' terminator regions, and other sequences. The expression cassettes contained in the DNA constructs include genetic elements necessary for the transcription of messenger RNA, and these cassettes can be designed for expression in prokaryotic or eukaryotic cells. The expression cassettes of the present invention are designed, most preferably, for expression in plant cells.

[0086] The transgenic maize event KJ1183, which is resistant to lepidopteran insects and tolerant to glyphosate herbicide, is cultivated through the following steps: First, a first parent maize plant is sexually crossed with a second parent maize plant to produce diverse first-generation offspring plants. The first parent maize plant consists of maize plants bred from the transgenic maize event KJ1183 and its offspring, which are obtained by transformation using the expression cassette of the present invention that is resistant to lepidopteran insects and tolerant to glyphosate herbicide. The second parent maize plant lacks resistance to lepidopteran insects and / or is tolerant to glyphosate herbicide. Then, offspring plants that are resistant to lepidopteran insect invasion and / or tolerant to glyphosate herbicide are selected to cultivate maize plants that are resistant to lepidopteran insects and tolerant to glyphosate herbicide. These steps may further include backcrossing progeny plants that are lepidopteran-resistant and / or glyphosate-tolerant with a second or third parent maize plant, and then selecting progeny by lepidopteran invasion, glyphosate herbicide application, or by identification through trait-related molecular markers (such as DNA molecules containing the 5' and 3' junction sites identified in the transgenic maize event KJ1183), thereby producing maize plants that are lepidopteran-resistant and glyphosate-tolerant.

[0087] It should also be understood that two different transgenic plants can be hybridized to produce offspring containing two independent, segregated foreign genes. Self-pollination of appropriate offspring can yield plants that are homozygous for both added foreign genes. Backcrossing of parental plants and heteromorphic hybridization with non-transgenic plants, as mentioned above, are also to be expected, as is asexual reproduction.

[0088] The term "probe" refers to a segment of isolated nucleic acid molecule bound with a conventionally detectable marker or reporter molecule, such as a radioisotope, ligand, chemiluminescent agent, or enzyme. This probe is complementary to one strand of the target nucleic acid. In this invention, the probe is complementary to one strand of the genome of the transgenic maize event KJ1183, regardless of whether the genomic DNA originates from the transgenic maize event KJ1183, its seeds, or from plants, seeds, or extracts of the transgenic maize event KJ1183. The probes of this invention include not only deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), but also polyamides and other probe materials that specifically bind to the target DNA sequence and can be used to detect the presence of that target DNA sequence.

[0089] Primers and probes for the flanking genomic DNA and insert sequence based on the present invention can be determined by conventional methods, for example, by isolating the corresponding DNA molecule from plant material derived from the transgenic maize event KJ1183 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule contains the transgenic insert sequence and a flanking region of the maize genome, and fragments of the DNA molecule can be used as primers or probes.

[0090] The nucleic acid probes and primers of this invention hybridize with target DNA sequences under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from the transgenic maize event KJ1183 in a sample. Nucleic acid molecules or fragments thereof can specifically hybridize with other nucleic acid molecules under certain conditions. As used in this invention, if two nucleic acid molecules can form antiparallel double-stranded nucleic acid structures, it can be said that the two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules exhibit perfect complementarity, one nucleic acid molecule is said to be a "complement" of the other nucleic acid molecule. As used in this invention, when every nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to exhibit "perfect complementarity". If two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under at least conventional "low stringent" conditions, the two nucleic acid molecules are said to be "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under conventional "high stringent" conditions, the two nucleic acid molecules are said to be "complementary". Deviations from perfect complementarity are permissible, as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. For a nucleic acid molecule to function as a primer or probe, it only needs to be sufficiently complementary in sequence to form a stable double-stranded structure under the specific solvent and salt concentration used.

[0091] As used in this invention, the substantially homologous sequence is a nucleic acid molecule that, under highly stringent conditions, can specifically hybridize with the complementary strand of a matching nucleic acid molecule. Suitable stringent conditions that promote DNA hybridization, such as treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C followed by washing with 2.0× SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from approximately 2.0× SSC, 50°C for low-stringent conditions to approximately 0.2× SSC, 50°C for high-stringent conditions. Furthermore, the temperature conditions in the washing step can be increased from approximately 22°C (room temperature) for low-stringent conditions to approximately 65°C for high-stringent conditions. Both the temperature conditions and the salt concentration can be changed, or one can remain constant while the other is changed. Preferably, a nucleic acid molecule of this invention can specifically hybridize with one or more nucleic acid molecules or their complementary sequences, or any fragment of the sequences in SEQ ID NO:1-8, under moderately stringent conditions, such as approximately 2.0× SSC and approximately 65°C. More preferably, a nucleic acid molecule of the invention specifically hybridizes under highly stringent conditions with one or more nucleic acid molecules of SEQ ID NO:1-8 or their complementary sequences, or any fragment of the aforementioned sequences. In this invention, the preferred marker nucleic acid molecule has SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:6 or their complementary sequences, or any fragment of the aforementioned sequences.

[0092] SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:5, and SEQ ID NO:6 can be used as markers in plant breeding methods to identify offspring of genetic hybridization. Hybridization of the probe with the target DNA molecule can be detected by any method well known to those skilled in the art, including but not limited to fluorescent labeling, radioactive labeling, antibody labeling, and chemiluminescent labeling.

[0093] Regarding amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "strict conditions" refer to conditions in which primers are allowed to hybridize only with the target nucleic acid sequence during a DNA thermal amplification reaction. Primers having a wild-type sequence (or its complementary sequence) corresponding to the target nucleic acid sequence are able to bind to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.

[0094] The term "specific binding (target sequence)" means that, under strict hybridization conditions, the probe or primer hybridizes only with the target sequence in a sample containing the target sequence.

[0095] As used in this invention, "amplified DNA" or "amplifier" refers to the nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a maize plant is produced by sexual hybridization containing the transgenic maize event KJ1183 of this invention, or whether a maize sample collected from a field contains the transgenic maize event KJ1183, or whether maize extracts, such as flour, powder, or oil, contain the transgenic maize event KJ1183, DNA extracted from maize plant tissue samples or extracts can be amplified using a primer pair to generate an amplifier that is diagnostic for the presence of DNA related to the transgenic maize event KJ1183. The primer pair includes a first primer derived from a flanking sequence in the plant genome adjacent to the insertion site of the foreign DNA, and a second primer derived from the inserted foreign DNA. The amplifier has a specific length and sequence that is also diagnostic for the transgenic maize event KJ1183. The length of the amplicon can be the binding length of the primer pair plus one nucleotide base pair, preferably about fifty nucleotide base pairs, more preferably about two hundred and fifty nucleotide base pairs, and most preferably about four hundred and fifty nucleotide base pairs or more.

[0096] Optionally, primer pairs can be derived from flanking genomic sequences on either side of the inserted DNA to produce an amplicon comprising the entire inserted nucleotide sequence. One of the primer pairs derived from plant genome sequences can be located at a distance from the inserted DNA sequence, ranging from one nucleotide base pair to approximately 20,000 nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed during thermal amplification of DNA.

[0097] The inserted exogenous DNA sequence and the flanking DNA sequence from transgenic maize event KJ1183 can be used to amplify the genome of transgenic maize event KJ1183 using the provided primer sequences, followed by standard DNA sequencing of the PCR amplicon or cloned DNA.

[0098] DNA detection kits based on DNA amplification methods contain DNA primer molecules that specifically hybridize to target DNA and amplify diagnostic amplicones under appropriate reaction conditions. The kits provide agarose gel-based detection methods or many other methods known in the art for detecting diagnostic amplicones. Kits containing DNA primers homologous to or complementary to any portion of the maize genome region of SEQ ID NO:3 or SEQ ID NO:4, and homologous to or complementary to any portion of the transgenic insert region of SEQ ID NO:8, are provided by this invention. The amplicones produced by these methods can be detected using a variety of techniques. One such method is Genetic Bit Analysis, which designs a DNA oligonucleotide chain spanning the insert DNA sequence and adjacent flanking genomic DNA sequences. This oligonucleotide chain is immobilized in the wells of a microplate. After PCR amplification of the target region (using one primer each in the insert sequence and adjacent flanking genomic sequences), the single-stranded PCR product hybridizes with the immobilized oligonucleotide chain and serves as a template for a single-base extension reaction using DNA polymerase and ddNTPs specifically labeled for the next expected base. Results can be obtained using fluorescence or ELISA-like methods. The signal indicates the presence of the inserted / flanking sequence, signifying that the amplification, hybridization, and single-base extension reactions were successful.

[0099] Another method is pyrosequencing. This method designs an oligonucleotide chain that spans the insertion DNA sequence and the binding site of adjacent genomic DNA. This oligonucleotide chain is hybridized with single-stranded PCR products of the target region (using one primer each within the insertion sequence and in adjacent flanking genomic sequences), and then incubated with DNA polymerase, ATP, thioacylase, luciferase, adenosine triphosphate diphosphatase, adenosine-5'-phosphate sulfate, and luciferin. dNTPs are added separately, and the resulting light signal is measured. The light signal represents the presence of the insertion / flanking sequence, indicating that amplification, hybridization, and single- or multi-base extension reactions were successful.

[0100] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9:492-498, 1999) can also be used to detect the amplicon of this invention. This method requires designing an oligonucleotide chain that spans the insertion DNA sequence and the binding site of adjacent genomic DNA. This oligonucleotide chain is hybridized with a single-stranded PCR product of the target region (using one primer within the insertion sequence and one primer in adjacent flanking genomic sequences), and then incubated with DNA polymerase and a fluorescently labeled ddNTP. Single-base extension results in the insertion of the ddNTP. This insertion can be measured using a fluorometer to determine the change in polarization. The change in polarization indicates the presence of the insertion / flanking sequence, signifying that the amplification, hybridization, and single-base extension reactions were successful.

[0101] Taqman is described as a method for detecting and quantifying the presence of DNA sequences, detailed in the manufacturer's instructions for use. A brief example is provided below: a FRET oligonucleotide probe is designed to bind across the insert DNA sequence and adjacent flanking genomic regions. This FRET probe and PCR primers (one primer within the insert sequence and one primer in adjacent flanking genomic sequences) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the splitting of the fluorescent and quenched portions of the probe, and the release of the fluorescent portion. The generation of a fluorescent signal indicates the presence of the insert / flanking sequence, signifying successful amplification and hybridization.

[0102] Based on the principle of hybridization, suitable techniques for detecting plant material derived from the KJ1183 transgenic maize event can also include Southern blot hybridization, Northern blot hybridization, and in situ hybridization. Specifically, these suitable techniques include incubating the probe and sample, washing to remove unbound probes, and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe; for example, radiolabeled probes can be detected by X-ray exposure and development, or enzyme-labeled probes can be detected by a color change resulting from substrate transformation.

[0103] Tyangi et al. (Nature Biotech 14:303-308, 1996) described the application of molecular markers in sequence detection. Briefly, a FRET oligonucleotide probe was designed that spans the insertion DNA sequence and the adjacent flanking genomic region. The unique structure of this FRET probe results in a secondary structure that allows for the retention of fluorescent and quenched portions in close proximity. The FRET probe and PCR primers (one primer within the insertion sequence and one primer in the adjacent flanking genomic sequence) were cyclically reacted in the presence of a thermostable polymerase and dNTPs. Upon successful PCR amplification, hybridization of the FRET probe and the target sequence leads to the loss of the probe's secondary structure, causing spatial separation of the fluorescent and quenched portions and generating a fluorescent signal. The generation of the fluorescent signal indicates the presence of the insertion / flanking sequence, signifying successful amplification and hybridization.

[0104] Other described methods, such as microfluidics, provide methods and devices for isolating and amplifying DNA samples. Optical dyes are used to detect and determine specific DNA molecules. Nanotube devices containing electronic sensors for detecting DNA molecules or nanobeads that bind specific DNA molecules and are thus detectable are useful for detecting the DNA molecules of this invention.

[0105] DNA detection kits can be developed using the primer pairs described in this invention and methods described or known in the field of DNA detection. These kits are advantageous for identifying the presence of DNA from the transgenic maize event KJ1183 in samples and can also be used to cultivate maize plants containing DNA from the transgenic maize event KJ1183. The kits may contain DNA primers or probes homologous to or complementary to at least a portion of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8, or other DNA primers or probes homologous to or complementary to the DNA contained in the transgenic genetic element. These DNA sequences can be used for DNA amplification reactions or as probes in DNA hybridization methods.

[0106] In the DNA amplification method, the DNA molecule used as a primer can be any part of the transgenic insertion sequence from the transgenic maize event KJ1183, or any part of the DNA region of the flanking maize genome from the transgenic maize event KJ1183.

[0107] The transgenic maize event KJ1183 can be combined with other transgenic maize varieties, such as herbicide-tolerant maize (e.g., glufosinate, dicamba, etc.) or transgenic maize varieties carrying other insect-resistant genes. Various combinations of all these different transgenic events, bred together with the transgenic maize event KJ1183 of this invention, can provide improved hybrid transgenic maize varieties resistant to multiple insect pests and multiple herbicides. These varieties can exhibit superior characteristics such as increased yield compared to non-transgenic varieties and single-trait transgenic varieties.

[0108] This invention provides a method for detecting the nucleic acid sequence of maize plants. The transgenic maize species KJ1183 is resistant to feeding damage from lepidopteran pests and tolerates the phytotoxic effects of glyphosate-containing agricultural herbicides.

[0109] This dual-trait maize plant expresses the Bacillus thuringiensis vip3Aa19, cry1A.105, and cry2Ab2 proteins, providing resistance to feeding damage from lepidopteran pests such as fall armyworm, Asian corn borer, cotton bollworm, or armyworm. It also expresses the glyphosate-resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein from Agrobacterium CP4, conferring glyphosate tolerance. This dual-trait maize effectively resists damage from major lepidopteran pests, including corn borer, cotton bollworm, fall armyworm, and armyworm, and tolerates high concentrations of glyphosate herbicides, allowing maize growers to use less pesticide and reduce production inputs. Furthermore, it enables convenient weed management using highly effective, broad-spectrum, and inexpensive glyphosate, reducing labor costs. Based on reducing farmers' labor input and economic costs, the multi-insect-resistant genes of vip3Aa19, cry1A.105 and cry2Ab2 proteins work together to resist insects. In addition to reducing the amount of pesticides used, they also provide an integrated management strategy to delay the development of resistance in target pests, reduce the area of ​​shelter required for resistance control, and thus generate comprehensive benefits in agriculture, economy and environment.

[0110] Furthermore, the genes encoding insect resistance and glyphosate tolerance traits are linked to the same DNA segment and reside at a single locus in the genome of the transgenic maize event KJ1183. This provides enhanced breeding efficiency and enables the use of molecular markers to track transgenic insertion fragments in breeding populations and their progeny. Simultaneously, the DNA primers or probes provided in the detection method of this invention can generate amplification products that diagnose transgenic maize event KJ1183 or its offspring, enabling rapid, accurate, and stable identification of the presence of plant material derived from the transgenic maize event KJ1183. Attached Figure Description

[0111] Figure 1This is a schematic diagram of the binding site between the transgenic insertion sequence and the maize genome in the present invention for detecting the nucleic acid sequence of maize plant KJ1183 and its detection method;

[0112] Figure 2 This is a schematic diagram of the recombinant expression vector used in this invention for detecting the nucleic acid sequence of maize plant KJ1183 and its detection method;

[0113] Figure 3 The present invention describes the in vitro resistance effect of transgenic maize containing transgenic maize event KJ1183 against lepidopteran pests.

[0114] Figure 4 The image shows the effect of artificially inoculating cotton bollworms with transgenic maize containing transgenic maize event KJ1183 during the silking stage in the field.

[0115] Figure 5 The image shows the effect of artificially inoculating the oriental armyworm with the transgenic maize containing transgenic maize event KJ1183 during the large trumpet stage in the field.

[0116] Figure 6 This is a diagram showing the effect of artificially inoculating fall armyworm with transgenic maize containing the transgenic maize event KJ1183 of the present invention during the large trumpet stage in the field.

[0117] Figure 7 The image shows the effect of artificially inoculating the corn borer with the transgenic corn of the present invention, which includes transgenic corn event KJ1183, during the silking stage in the field.

[0118] Figure 8 The image shows the effect of artificially inoculating the corn borer at the whorl stage of the transgenic corn containing transgenic corn event KJ1183 in the field.

[0119] Figure 9 The field effect diagram shows the field effect of the genetically modified maize containing the genetically modified maize event KJ1183 of the present invention when sprayed with 4 times the recommended spraying concentration of glyphosate herbicide.

[0120] Figure 10 The alignment results of the 3' end flanking sequence of the inserted sequence in the database;

[0121] Figure 11 The results of the 3' insertion site sequence verification for transformant KJ1183 are shown in the following table: M: molecular weight marker; 1: amplification product using maize B104 genomic DNA as template; 2: blank control, amplification product using water as template; 3: amplification product using transformant KJ1183 genomic DNA as template.

[0122] Figure 12Electrophoresis diagram of 3' end-specific PCR detection of transformant KJ1183, where M: molecular weight marker; 0: blank control, amplified product using water as template; 1: recipient control, amplified product using maize B104 genomic DNA as template; 2: amplified product using pK0528 plasmid as template; 3: amplified product using maize transformant KJ1004 genomic DNA as template; 4-7: amplified product using T2 generation maize transformant KJ1183 genomic DNA as template; 8-11: amplified product using T3 generation maize transformant KJ1183 genomic DNA as template; 12-15: amplified product using T4 generation maize transformant KJ1183 genomic DNA as template.

[0123] Figure 13 This is a Southern hybridization pattern of the cp4-epsps gene probe of KJ1183. Figure A shows HindIII digestion, and Figure B shows KpnI digestion. In Figure A, 1-3: HindIII digestion of the T2, T3, and T4 generations of the KJ1183 transformant; 4: HindIII digestion of B104; 5: Marker; 6: Blank; 7: pK528 plasmid (SmaI digestion (260 pg) + HindIII digestion of B104 (30 μg)). In Figure B, 1: Marker; 2: Blank; 3: pK528 plasmid (SmaI digestion (260 pg) + HindIII digestion of B104 (30 μg)); 4: KpnI digestion of B104; 5-7: KpnI digestion of the T2, T3, and T4 generations of the KJ1183 transformant.

[0124] Figure 14 Figure A shows the Southern hybridization patterns of the vip3Aa19 gene probe of KJ1183. In Figure A, 1-3: HindIII digestion of the T2, T3, and T4 generations of the KJ1183 transformant; 4: HindIII digestion of B104; 5: Marker; 6: Blank; 7: pK528 plasmid (SmaI digestion (260 pg) + HindIII digestion of B104 (30 μg)). In Figure B, 1: Marker; 2: Blank; 3: pK528 plasmid (SmaI digestion (260 pg) + HindIII digestion of B104 (30 μg)); 4: KpnI digestion of B104; 5-7: KpnI digestion of the T2, T3, and T4 generations of the KJ1183 transformant.

[0125] Figure 15Figure A shows the Southern hybridization patterns of the cry1A.105 gene probe of KJ1183. In Figure A, 1-3: KJ1183 T2, T3, and T4 generations digested with HindIII; 4: B104 HindIII digested; 5: Marker; 6: Blank; 7: pK0528 plasmid (SmaI digestion (260 pg) + B104 HindIII digestion (30 μg)). In Figure B, 1-3: KJ1183 T2, T3, and T4 generations digested with KpnI; 4: B104 KpnI digested; 5: Marker; 6: Blank; 7: pK0528 plasmid (SmaI digestion (260 pg) + B104 HindIII digestion (30 μg)).

[0126] Figure 16 Figure A shows the Southern hybridization patterns of the cry2Ab2 gene probe of KJ1183. In Figure A, 1-3: KJ1183 T2, T3, and T4 generations digested with HindIII, 4: B104 HindIII digested, 5: Marker, 6: Blank, 7: pK528 plasmid (SmaI digestion (260 pg) + B104 HindIII digestion (30 μg)); In Figure B, 1: Marker, 2: Blank, 3: pK528 plasmid (SmaI digestion (260 pg) + B104 HindIII digestion (30 μg)), 4: B104 KpnI digested, 5-7: KJ1183 T2, T3, and T4 generations digested with KpnI.

[0127] Figure 17 Comparison of differences in the migration rates of digoxigenin markers used in Southern hybridization;

[0128] Figure 18 This is an example of a resistance grading standard for glyphosate resistance in transgenic plants, where 0-4 represent grades 0-4 respectively. Detailed Implementation

[0129] The present invention will be further described and illustrated below with reference to embodiments. However, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the present invention and the embodiments, all other inventions and embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0130] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0131] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0132] Example 1: Cloning and Transformation

[0133] 1.1 Vector Cloning

[0134] The recombinant expression vector pK0528 was constructed using standard gene cloning techniques. Figure 2 (As shown). The vector pK0528 contains four tandem transgenic expression cassettes located in the flanking genomic region of transgenic maize event KJ1183 at the 5' end of the transgenic insertion sequence. The first expression cassette is operatively linked to the rice TubA promoter, specifically to the chloroplast transport peptide CTP2, which localizes the cp4-epsps protein to chloroplasts for processing into a mature protein. It is also operatively linked to the glyphosate-resistant 5-enol-pyruvylshikimate-3-phosphate synthase (cp4-epsps) of Agrobacterium CP4 strain and operatively linked to the rice TubA terminator. The second expression cassette is operatively linked to the maize ubiquitin promoter (ZmUbiInt), specifically to the insect-resistant vip3Aa19 protein of Bacillus thuringiensis and operatively linked to the E9 terminator of the pea rbcs2E9 gene and the 35S terminator of cauliflower mosaic virus (CaMV). The third expression cassette consists of the cauliflower mosaic virus 35S promoter (e35S), operably linked to the 5'UTR sequence Cab of the wheat chlorophyll a / b binding protein that enhances stable expression of cry1A.105, and the first intron sequence Ract1 of rice actin 1, operably linked to the insect-resistant cry1A.105 protein of Bacillus thuringiensis, and operably linked to the Hsp17 terminator of wild barley. The fourth expression cassette consists of the Scrophularia mosaic virus 35S promoter (FMV), operably linked to the chloroplast transport peptide SSU-CTP that localizes the cry2Ab2 protein to chloroplasts for processing into mature protein, operably linked to the insect-resistant cry2Ab2 protein of Bacillus thuringiensis, and operably linked to the transcription terminator (nos) of alkaloid synthase. The T-DNA transfer requires a portion of the right boundary (RB) sequence of T-DNA from Agrobacterium C58, as well as the genomic region flanking the transgenic maize event KJ1183 located at the 3' end of the transgenic insertion sequence (SEQ ID NO:8).

[0135] 1.2 Plant Transformation

[0136] Transformation was performed using the conventional Agrobacterium infection method. Aseptically cultured maize (maize inbred line B104) embryos were co-cultured with Agrobacterium to transfer T-DNA from the constructed recombinant expression vector pK0528 into the maize chromosome, generating the transgenic maize event KJ1183. The specific procedures are as follows:

[0137] 1) Prepare Agrobacterium tumefaciens culture solution PK0528

[0138] The bacterial culture stored at -80℃ was spread onto YEB medium containing the antibiotics rifampicin and kanamycin and incubated in the dark at 28℃ for 48 hours.

[0139] Before use, collect the Agrobacterium bacteria growing on the plate with an inoculation loop, suspend them in inf-AS medium, and dilute the bacterial solution to an OD600 of 0.5.

[0140] 2) Preparing the embryo

[0141] Harvest corn ears approximately 12 days after pollination. Remove the husks, surface treat with 75% alcohol for 30 seconds, treat with 1% sodium hypochlorite for 40 minutes, and wash three times with sterile water. Peel off the immature embryos at room temperature and place them in centrifuge tubes containing 2 mL of inf medium. Wash twice with fresh inf wash solution, leaving just enough inf to submerge the immature embryos in the tube.

[0142] 3) Pretreatment of immature embryos

[0143] Place the centrifuge tubes containing the embryos into a 45°C water bath and process for 5 minutes.

[0144] After the water bath is complete, quickly remove the centrifuge tubes and place them in an ice bath for 2 minutes.

[0145] 4) Agrobacterium infection of immature embryos

[0146] Remove the remaining inf from the centrifuge tube, add 1 mL of the prepared Agrobacterium tumefaciens solution, invert the centrifuge tube 20 times, and let it stand for 5 minutes.

[0147] 5) Co-cultivation

[0148] After infection, the embryos and infection solution are transferred to a co-culture medium. Excess Agrobacterium suspension on the medium is aspirated with a pipette. The embryos are then positioned so that their hypocotyl surface is in contact with the medium, i.e., the scutellum is facing upwards. The culture dish is sealed with sealing film and incubated in the dark at 28°C for 3 days.

[0149] 6) Restore culture

[0150] After co-culturing for 3 days, the embryos were transferred to recovery medium and cultured in the dark at 28°C for 14 days.

[0151] 7) Screening and Cultivation

[0152] The embryos, after 14 days of recovery culture, were transferred to selection medium and cultured in the dark at 28°C for 14 days. After 14 days, they were subcultured once using the same medium.

[0153] 8) Differentiation culture

[0154] After two rounds of screening, the vigorous callus was transferred to differentiation medium and cultured at 28°C under light for 14 days.

[0155] 9) Rooting of regenerated seedlings

[0156] After differentiation culture, the seedlings, which are about 2cm long, are transferred to rooting tanks containing rooting medium and cultured at 28℃ under light for 14 days.

[0157] 10) Seedling transplanting

[0158] After 14 days of rooting culture, seedlings with well-developed root systems were transplanted into small pots in a greenhouse, covered to retain moisture, and the covers were removed after 3 days. After 2 weeks of acclimatization and PCR testing, positive plants were transplanted into large pots and cultured at 26℃ for 16 hours under light until flowering and seed production.

[0159] 1.3 Identification and Screening of Genetically Modified Events

[0160] The presence of the cp4-epsps, vip3Aa, cry1A.105, and cry2Ab2 genes in regenerated transgenic maize plants was detected using TaqMan™ analysis (see Example 2), and the copy numbers of insect resistance and glyphosate herbicide tolerance lines were characterized. Based on the copy number of the target genes, good insect resistance, glyphosate herbicide tolerance, and agronomic traits (see Examples 5 and 6), event KJ1183 was selected as superior through screening, possessing a single-copy transgenic structure, good insect resistance, glyphosate herbicide tolerance, and agronomic traits.

[0161] Example 2: Detection of transgenic maize event KJ1183 using TaqMan

[0162] Genomic DNA was extracted from 20 mg of leaves from the KJ1183 transgenic maize plant. The copy numbers of cp4-epsps, vip3Aa19, cry1A.105, and cry2Ab2 were detected using TaqMan probe-based quantitative PCR. The primers and probe sequences used are shown in Tables 2-5 below. Wild-type maize plants were used as controls for the analysis.

[0163] Table 2 Primer and probe sequences used for detecting cp4-epsps

[0164] Primer 1 GGCAGCCTTCGTATCGGAG SEQ ID NO:11 Primer 2 CTCGTGTCGGAAAACCCTGT SEQ ID NO:12 Probe 1 CAGGTCCATGAACTCCGGGAAGCTC SEQ ID NO:13

[0165] Table 3 Primer and probe sequences used for detecting VIP3Aa19

[0166] Primer 3 TCCACTACGAGGACACCAACAAC SEQ ID NO:14 Primer 4 CCGTTCTGGCTCTTCAGGATC SEQ ID NO:15 Probe 2 TGGAGGACTACCAGACCATCAACAAGCG SEQ ID NO:16

[0167] Table 4 Primer and probe sequences used for detecting cry2Ab2

[0168] Primer 5 CCAGAACTTCAACTGCTCCAC SEQ ID NO:17 Primer 6 AAGGGTGGTCTCGAAGGAC SEQ ID NO:18 Probe 3 CACCGTCACCAACTGGCAAACC SEQ ID NO:19

[0169] Table 5 Primer and probe sequences used for detecting cry1A.105

[0170] Primer 7 CACCGATGAACGGAATGCTAAC SEQ ID NO:20 Primer 8 GACCACTACCACGACCGCAA SEQ ID NO:21 Probe 4 CGTGTCGCTGATCTTGCCTCCTTCTGT SEQ ID NO:22

[0171] The reaction system of 10 μL is as follows:

[0172]

[0173] Each 50× primer-probe mixture contains 15 μL of each primer at a concentration of 1 mM, 50 μL of probe at a concentration of 100 μM, and 920 μL of sterile water, and is stored at 4°C in a brown, light-protected test tube.

[0174] The amplification procedure is as follows:

[0175]

[0176] Data was analyzed using QuantStudio Design & Analysis Software (Applied Biosystems) to obtain single-copy transgenic maize events.

[0177] Example 3: Analysis of the insertion site of transformant KJ1183 and transformation-specific PCR detection

[0178] 1. Experimental Objective

[0179] The flanking sequences of the insertion site of the transformant insertion sequence were amplified using Tail-PCR technology. Based on the flanking sequence information, a transformant-specific PCR detection system for KJ1183 was established, and the genetic stability of the insertion sequence integration site was determined by detecting the T2 and T3 generations of transformants.

[0180] 2. Test materials

[0181] The insertion site analysis of the inserted sequence was performed using genomic DNA of the transformant KJ1183 as a template. Tail-PCR analysis and insertion site-specific PCR verification were conducted to establish a transformant-specific PCR detection method.

[0182] The establishment of a transformant-specific PCR system and the detection of the stability of the insertion sequence at the integration site in the genome were carried out using randomly selected maize transformants that grew well after being sprayed with glyphosate. Four plants each from the T2 and T3 generations of KJ1183 were randomly selected for testing. The pK0528 plasmid was used as a vector control, the receptor B104 was used as a negative control, water was used as a template as a blank control, and the transformant KJ1004 was used as a sister transformant control.

[0183] 3. Test Methods

[0184] 1) Genome extraction:

[0185] DNA was extracted from plant leaves using the CTAB method.

[0186] 2) Method for analyzing the 3' flanking sequence of the inserted sequence:

[0187] Based on the literature (reference: Liu YG, High-efficiency thermalasymmetric interlaced PCR for amplification of unknown flanking sequences. Biotechniques, 2007), specific primers pK0528-F1, pK0528-F2, and pK0528-F3 were designed, and Tail-PCR degenerate primers LAD1, LAD2, LAD3, LAD4, and AC1 were designed. The specific sequences are shown in Table 6 below.

[0188] Table 6 Primer names and sequences

[0189] pK0528-F1 CAACCAGACACGCACCTTCATCTCC SEQ ID NO:23 pK0528-F2 ACGATGGACTCCAGTCCGGCCGTACCTGCGCGTCAGCTCCATTGG SEQ ID NO:24 pK0528-F3 CTGGACATCAACGTGACCCTGAACTCT SEQ ID NO:9 LAD1 ACGATGGACTCCAGAGCGGCCGCVNVNNNGGAA SEQ ID NO:25 LAD2 ACGATGGACTCCAGAGCGGCCGCBNBNNNGGTT SEQ ID NO:26 LAD3 ACGATGGACTCCAGAGCGGCCGCVVNVNNNCCAA SEQ ID NO:27 LAD4 ACGATGGACTCCAGAGCGGCCGCBDNBNNCGT SEQ ID NO:28 AC1 ACGATGGACTCCAGAG SEQ ID NO:29

[0190] The process involved three rounds of Tail-PCR: The first round used transformant genomic DNA as a template, with primer pK0528-F1 for LAD1, LAD2, LAD3, and LAD4, respectively. The second round used the first-round amplification products as a template, with primers pK0528-F2 and AC1. The third round used the second-round amplification products as a template, with primers pK0528-F3 and AC1. After the three rounds of amplification, the Tail-PCR products were subjected to agarose gel electrophoresis, and the target band was recovered. Sequencing was performed using primer pK0528-F3 to obtain the flanking sequences of the insertion site. The accuracy of the insertion site was confirmed by specific PCR detection primers.

[0191] a. First round of Tail-PCR

[0192] Amplification system:

[0193]

[0194]

[0195] Amplification procedure:

[0196]

[0197] b. Second round of Tail-PCR

[0198] Amplification system:

[0199]

[0200] Amplification procedure:

[0201]

[0202]

[0203] c. Third round of Tail-PCR

[0204] Amplification system:

[0205]

[0206] Amplification procedure:

[0207]

[0208] 3) Validation of the 3' flanking sequence of the inserted sequence

[0209] Based on the 3' flanking sequence information obtained by Tail PCR, primers 183Chr4-2R (SEQ ID NO:10) and pK0528-F3 (Tail PCR third-round specific primer SEQ ID NO:9) were designed for the genome and the insert sequence, respectively. Amplification was performed using KJ1183 genomic DNA as a template, and the amplification product (predicted amplified fragment length 851 bp) was sequenced and analyzed to verify the accuracy of the Tail PCR results, determine the specific information of the insertion site of the insert sequence and the true situation of its flanking sequences.

[0210] T-DNA 3' insertion site specific PCR detection amplification system:

[0211]

[0212]

[0213] T-DNA 3' insertion site specific PCR detection reaction procedure:

[0214]

[0215] 4) Establishment of a transformant-specific PCR method

[0216] Based on the specific insertion sequence and flanking sequences of the obtained transformant KJ1183, 3' end-specific detection primers were designed for specific PCR detection to qualitatively identify the transformant KJ1183. The 3' end-specific detection primers are pK0528-183-3R (SEQ ID NO:30) and pK0528-3'R (SEQ ID NO:31), with an expected amplification length of 285 bp.

[0217] 5' end PCR reaction system:

[0218]

[0219] 3' end PCR reaction system:

[0220]

[0221] Specific PCR reaction conditions:

[0222]

[0223] 4. Experimental Results

[0224] 1) Insertion site at the 3' end of the insertion sequence

[0225] The 3' end boundary of the T-DNA was determined based on the sequencing results of the Tail PCR product: Alignment with the B104ISU_USDA 0.1 assembly database (https: / / maizegdb.org / ) revealed that position 19029 of the vector sequence was inserted into position 222956353 of the Chr4 genome. The results are as follows: Figure 10 As shown. Based on the 3' flanking sequence information obtained by Tail PCR, primers 183Chr4-2R and pK0528-F3 (Tail PCR third-round specific primers) were designed for the genome and insert sequence, respectively. Amplification was performed using KJ1183 genomic DNA as a template, yielding an 851 bp band. Figure 11 The amplified product was sequenced and analyzed to determine that the inserted sequence was inserted into chromosome 4 of the genome, specifically at Chr4:222956353, and the adjacent inserted sequence corresponds to the 19029th bp of the vector sequence.

[0226] 2) Transformant-specific PCR detection results and their stability

[0227] Three plants each of the T2 and T3 generations of glyphosate-treated maize transformants and KJ1183 were randomly selected as test samples after successful glyphosate spraying. The pK0528 plasmid was used as a vector control, the receptor B104 as a negative control, water as a template as a blank control, and transformant KJ1004 as a sister transformant control. PCR detection was performed using the 3' end specific detection primers pK0528-183-3R (SEQ ID NO:30) and pK0528-3'R (SEQ ID NO:31). Figure 12The results showed that a 285bp target fragment of the same size could be detected in four randomly selected plants from the T2, T3, and T4 generations, consistent with expectations. No bands were amplified in any of the other controls, indicating that the 3' end-specific PCR detection system for the transformant could specifically detect the KJ1183 transformant. The results also showed that the integration of the exogenous gene of KJ1183 into chromosome 4 (chr4:222956353) is stably inherited.

[0228] Example 4: Detection of transgenic maize event KJ1183 by Southern blot hybridization

[0229] Using the vector plasmid pK0528 as a positive control and the non-transgenic maize receptor B104 as a negative control, Southern hybridization was performed on different generations of the transformant KJ1183 to obtain transformant-specific molecular hybridization maps. The copy number of the exogenous inserted sequence in transgenic maize KJ1183 and the stability of this event across different generations were analyzed using Southern hybridization.

[0230] 1. DNA extraction for Southern blot hybridization

[0231] Take 2g of the sample leaf to be tested, add quartz sand and liquid nitrogen, grind thoroughly, and then pour the powder into a 50ml centrifuge tube;

[0232] After the liquid nitrogen in the centrifuge tube has completely evaporated, add 10 ml of DNA extraction buffer and shake vigorously at room temperature for 10-15 min.

[0233] Add 5ml of phenol and shake gently for 5-10 minutes; then add 5ml of chloroform and continue shaking gently for 10-15 minutes.

[0234] Centrifuge at 8000 rpm for vertical rotor and 3800 rpm for horizontal rotor at room temperature for 10 min.

[0235] Aspirate the supernatant, add an equal volume of isopropanol, and gently shake the centrifuge tube to mix the isopropanol with the supernatant thoroughly. White flocculent DNA will be visible.

[0236] Transfer the DNA precipitate into a new 1.5ml centrifuge tube, add 1ml of 70% ethanol, and wash the precipitate.

[0237] After the precipitate is dried, add 800 μL of sterile water (containing 50 μg / ml of RNase A) to dissolve it, and digest the RNA at 37°C for 0.5–1 hour; take 1 μL from each tube for electrophoresis to observe whether the RNase has been completely removed;

[0238] Add 10 μL of proteinase K (20 mg / ml) to each tube, dilute to 1x with 10x proteinase K buffer, and mix thoroughly. Incubate at 37°C for 1 hour.

[0239] Extract once with equal volumes of phenol / chloroform and chloroform; shake gently for 10-15 min, centrifuge at 12000 rpm for 15 min;

[0240] Add 1 / 10 volume of 3M NaAC to the supernatant, mix thoroughly, then add 2.5 volume of pre-cooled anhydrous ethanol, mix well, place at -20℃ for at least 30 min, centrifuge at 12,500 rpm, 4℃ for 15 min, and discard the supernatant.

[0241] Wash the DNA precipitate with 70% ethanol, dry it, and then dissolve it in an appropriate amount of TE or 300 μL of water.

[0242] Take a small amount of DNA, check its quality and label the amount of DNA on an agarose gel, and store the remaining DNA samples at -20℃ for later use.

[0243] 2. Probe Design

[0244] The probe primers for target gene detection were designed based on the target gene sequence information in the pK0528 vector, as shown in Table 7.

[0245] Table 7 Information on primers used to prepare the probe.

[0246]

[0247] 3. Restriction enzyme digestion

[0248] Take 10g of DNA samples from the test plants and wild-type control plants and digest them with a 120μl system. The enzymes used include HindIII and KpnI. Add 300μl of restriction enzyme and digest overnight. Add 75μl of restriction enzyme the next day and continue digestion for 3h.

[0249] 4. Gel electrophoresis

[0250] a. To prepare 0.7% agarose gel, EB needs to be added; to prepare large-plate gel, use a large-pore comb;

[0251] b. After enzyme digestion, add 500 μl of ultrapure water and 600 μl of isopropanol to the digestion product, precipitate at -20℃ for 2 h, and centrifuge at 12000 rpm for 10 min.

[0252] c. Discard the supernatant, add 75% ethanol and wash at 6000 rpm for 3 minutes. Place in a clean bench and air dry;

[0253] d. Dissolve in 50 μl of ultrapure water, add 6 μl of 10* lording buffer, and incubate in a 56°C water bath for 3 min;

[0254] e. Load the sample, let it stand for 2 minutes, and then perform electrophoresis overnight at 20V. The positive control sample loading amount is 10ng.

[0255] 5. Hybridization

[0256] a. Transfer: Photograph the gel, trim off excess gel, and cut off a corner from the upper right. Rinse with deionized water, place in denaturing buffer, and vortex for 45 minutes. Briefly soak in deionized water, then place in neutralization buffer and vortex for 30 minutes. Discard, replace with fresh neutralization buffer, and vortex for 15 minutes. Cut two 18×38cm filter papers, two sheets the size of the gel block, and one sheet the size of the nylon membrane gel block. Wet the nylon membrane with deionized water for 5-10 minutes. Find a white porcelain dish, place a glass plate on it (washed and dried with detergent, then wiped clean with alcohol). Pour 20×SSC into the white porcelain dish, cover the glass plate with the two sheets of filter paper, and wet with 20×SSC, removing any air bubbles. Place the gel block (inverted) on the filter paper, cut a corner of the nylon membrane at the same position as the gel block, and place two sheets of filter paper. Remove any air bubbles after each placement. Seal the film around the edges with a plastic bag, then place absorbent paper on top, and finally place a glass plate on the absorbent paper, weighing the glass plate down with a heavy object. Transfer the film over 1 day.

[0257] b. DNA fixation: After transfer, write a tally mark with a pencil on the side of the nylon membrane that was in contact with the gel block. Rinse the membrane with 10×SSC and crosslink it using a UV crosslinker for 2 min. Then rinse with deionized water and air dry at room temperature.

[0258] c. Pre-hybridization: Preheat an appropriate amount of DIG Easy Hyb (10ml / 100cm³). 2 (Membrane). Simultaneously, place the membrane in a hybridization tube with the DNA side facing up, add 10 ml (membrane area less than 100 cm2) of DIG Easy Hyb, pre-hybridize at 25°C for 30 min, while rotating the hybridization tube.

[0259] d. Hybridization: Dilute the DIG-labeled probe with DIG Easy Hyb to 25 ng / ml (3.5 ml / 100 cm³). 2 Boil the membrane in boiling water for 5 minutes, then quickly place it in an ice bath. Add the diluted probe to the preheated DIG Easy Hyb solution and mix well, while avoiding the formation of air bubbles. Discard the prehybridization solution, add the mixed probe, and hybridize overnight at 42°C while rotating the hybridization tube.

[0260] e. Washing: Discard or recover the hybridization solution, add 20 ml of 2×SSC containing 0.1% SDS, and wash in a hybridization oven at 25°C for 5 min x 2; discard the waste solution, add 20 ml of 0.5×SSC containing 0.1% SDS, and wash in a hybridization oven at 65°C for 15 min x 2; after hybridization and washing, discard the waste solution, add 20 ml of washing buffer, and wash in a hybridization oven at 37°C for 5 min; discard the waste solution, add 100 ml of blocking solution, and incubate in a hybridization oven at 37°C for 30 min; discard the waste solution, add 20 ml of antibody solution, and incubate in a hybridization oven at 37°C for 30 min; discard the waste solution, add 100 ml of washing buffer, and incubate in a hybridization oven at 37°C for 15 min x 2; discard the waste solution, add 10 ml of detection buffer, and incubate in a hybridization oven at 37°C for 5 min; cut open the hybridization bag, place the DNA-containing side up on the hybridization bag, and add 1 ml of CSPD. Apply the ready-to-use liquid to the membrane and immediately cover it with the second page of the hybridization bag, ensuring there are no air bubbles. Incubate at room temperature for 5 minutes. Squeeze out any excess liquid and any air bubbles, then seal the edges with an edge sealer. Place the membrane at 37°C for 10 minutes to enhance the luminescence reaction.

[0261] f. Imaging: Place the membrane in a Southern luminescence imaging system and adjust the exposure time to 1-15 min to obtain the best Southern hybridization image.

[0262] 6. Results and Discussion

[0263] (1) Analysis of specific probe hybridization results of the cp4-epsps gene in the KJ1183 event

[0264] like Figure 13As shown, after SmaI digestion of the positive control, the pK528 plasmid was added to the DNA of the receptor material B104 digested with HindIII. The hybridization band was slightly lower than the 23130bp band in the marker, and the expected size was 19.3kb, which was in line with expectations. When HindIII was used for digestion, the hybridization bands of the T2, T3, and T4 generations of KJ1183 were all about 25kb each, which was greater than 15kb and in line with expectations. The negative control B104 did not show any hybridization bands. When KpnI was used for digestion, the hybridization bands of the T2, T3, and T4 generations of KJ1183 were all about 6.5kb each (because the marker with digoxigenin was slightly larger than the actual indicated fragment), which was greater than 5.6kb and in line with expectations. The negative control B104 did not show any hybridization bands. Both digestions showed that the T-DNA region of pK528 had been integrated into the genome of the event KJ1183, and it was a single copy. The cross bands in the T2, T3, and T4 generations were completely identical in size and number, indicating that the inserted sequence of event KJ1183 could be stably inherited in different generations.

[0265] Table 8. Specific probe hybridization results of the cp4-epsps gene in KJ1183.

[0266]

[0267] (2) Analysis of specific probe hybridization results of the vip3Aa19 gene in the KJ1183 event

[0268] like Figure 14 As shown, after SmaI digestion of the positive control plasmid, pK0528 was added to the DNA of the recipient material B104 digested with HindIII. The hybridization band was slightly lower than the 23130bp band in the marker, and the expected size was 19.3kb, which was in line with expectations. When HindIII digestion was used, the hybridization bands of the T2, T3, and T4 generations of KJ1183 were all around 25kb each, which was greater than 15kb and in line with expectations. The negative control B104 did not show any hybridization bands. When KpnI digestion was used... At the time, the negative control B104 and KJ1183 T2, T3, and T4 generations all showed a 3.5kb hybridization band, which was a non-specific hybridization band. In addition, the KJ1183 T2, T3, and T4 generations all showed a hybridization band of approximately 19kb, greater than 13.7kb, which was as expected. The negative control B104 showed no hybridization band. Both enzyme digestions indicated that the pK0528 T-DNA region had been integrated into the genome of event KJ1183, and was a single copy. The size and number of hybridization bands in the T2, T3, and T4 generations were completely consistent, indicating that the inserted sequence of event KJ1183 can be stably inherited across different generations.

[0269] Table 9. Analysis of specific probe hybridization results of the vip3Aa19 gene in KJ1183.

[0270]

[0271]

[0272] (3) Analysis of specific probe hybridization results of the cry1A.105 gene in the KJ1183 event.

[0273] like Figure 15 As shown, after SmaI digestion of the positive control, the pK528 plasmid was added to the DNA of the receptor material B104 digested with HindIII. The hybridization band was slightly lower than the 23130bp band in the marker, and the expected size was 19.3kb, which was in line with expectations. When HindIII was used for digestion, the hybridization bands of the T2, T3, and T4 generations of KJ1183 were all about 25kb each, which was greater than 15kb and in line with expectations. The negative control B104 did not show any hybridization bands. When KpnI was used for digestion, the hybridization bands of the T2, T3, and T4 generations of KJ1183 were all about 19kb each, which was greater than 13.7kb and in line with expectations. The negative control B104 did not show any hybridization bands. Both digestion methods indicate that the T-DNA region of pK528 has been integrated into the genome of event KJ1183, and it is a single copy. The cross bands of the T2, T3, and T4 generations were completely identical in size and number, indicating that the inserted sequence of event KJ1183 could be stably inherited in different generations.

[0274] Table 10 Analysis of specific probe hybridization results of the cry1A.105 gene in KJ1183

[0275]

[0276] (4) Analysis of specific probe hybridization results of cry2Ab2 in KJ1183 event

[0277] like Figure 16As shown, after SmaI digestion of the positive control, the pK528 plasmid was added to the DNA of the receptor material B104 digested with HindIII. The hybridization band was slightly lower than the 23130bp band in the marker, and the expected size was 19.3kb, which was in line with expectations. When HindIII was used for digestion, the hybridization bands of KJ1183 T2, T3, and T4 generation materials were all about 8kb each, which was greater than 4.3kb and in line with expectations. The negative control B104 did not show any hybridization bands. When KpnI was used for digestion, the hybridization bands of KJ1183 T2, T3, and T4 generation materials were all about 19kb each, which was greater than 13.7kb and in line with expectations. The negative control B104 did not show any hybridization bands. Both digestion methods indicate that the T-DNA region of pK528 has been integrated into the genome of event KJ1183, and it is a single copy. The cross bands in the T2, T3, and T4 generations were completely identical in size and number, indicating that the inserted sequence of event KJ1183 could be stably inherited in different generations.

[0278] Table 11 Analysis of specific probe hybridization results for the cry2Ab2 gene in KJ1183

[0279]

[0280] Because the marker used was pre-labeled with digoxigenin, its migration rate during electrophoresis was slightly slower than that of unlabeled DNA samples, resulting in a smaller-than-expected band size. The specific degree of deviation can be found in [link to relevant documentation]. Figure 17 (The left side shows the digoxigenin marker, and the right side shows the 1kb marker purchased from Thermo. The agarose gel concentration is 1.5%).

[0281] Example 5: Insect resistance detection

[0282] 1. Bioassay of KJ1183 in maize plants

[0283] Transgenic maize plants (KJ1183 and wild-type B104) were inoculated with larvae at the 4-5 leaf stage by taking leaves the same size as the culture dish and placing them in the dish. After inoculation, the dish was sealed with breathable tape to prevent larvae escape and maintain humidity. The dishes were then placed in an incubator at 26.5-27℃, 70% humidity, and an L:D ratio of 16:8. Mortality was assessed 3 days after inoculation, and the corrected mortality rate was calculated. The mortality rate was statistically analyzed, and the resistance level was determined using the corrected mortality rate: Corrected mortality rate (%) = (1 - number of survivors / number of inoculated larvae - wild-type control mortality rate) / (1 - wild-type control mortality rate) × 100%.

[0284] like Figure 3As shown in Table 12, the results indicate that the corrected mortality rate of the four target insects was higher than 90% five days after feeding on the leaves of transgenic maize event KJ1183. In contrast, the mortality rate of the recipient control was 0 five days after feeding on the leaves of Asian corn borer, fall armyworm, and oriental armyworm. The mortality rate of the recipient control was 3.33% five days after feeding on the cotton bollworm. This demonstrates that the resistance level of transgenic maize event KJ1183 to the four target pests reached the "high resistance" level.

[0285] Table 12 Results of resistance of detached leaves of transgenic maize KJ1183 to target pests.

[0286]

[0287] 2. Field effects of genetically modified maize KJ1183

[0288] (1)Bollworm

[0289] The insect-resistant and herbicide-tolerant maize variety KJ1183 was used for field infestation verification against the main target pest, the cotton bollworm. The transformant KJ1183 and the recipient control B104 were each planted in triplicate, with an interval of more than 1 meter between each plant, a row spacing of 60 cm, and a plant spacing of 25 cm. Sowing was carried out according to the conventional sowing time, method, and seeding rate for summer maize. During the silking stage, artificial inoculation was performed, with at least 20 plants per treatment, and inoculation was repeated twice. Each plant was inoculated with 20-30 newly hatched larvae, placed on the maize silks. Three days after the first inoculation, a second inoculation was performed with the same number of larvae. A survey was conducted 14-21 days after artificial inoculation, investigating the infestation rate of female ears, the number of surviving larvae per ear, and the length of infested ears on a plant-by-plant basis. Based on the infestation rate, number of surviving larvae, and length of infested ears (cm), the average damage level at the ear stage was calculated for each plot. The results after inoculation were investigated and statistically analyzed according to the standards of Ministry of Agriculture Announcement No. 953-10.1-2007 to evaluate insect resistance. The resistance level of maize to bollworm at the ear stage was determined according to the established criteria. The resistance results of transgenic maize KJ1183 inoculated with bollworm at the silking stage are shown in Table 15.

[0290] The results showed that, through analysis of the insect resistance identification test results at the silking stage, it was found that two weeks after artificial inoculation with cotton bollworm, all the female ears of the recipient control B104 were eaten, with an average damage to the ear tip reaching 3-5 cm, and 4-5 instar larvae surviving on the kernels; while the female ears, ear tips, and kernels of the transformant KJ1183 were not damaged. The average leaf-eating grade of transgenic maize KJ1183 was 0.00, and the resistance type was "highly resistant"; the average leaf-eating grade of the recipient control B104 was 6.93, and the resistance type was "susceptible". The transgenic maize KJ1183 exhibited a good level of resistance to cotton bollworm, and the field effect of KJ1183 inoculation with cotton bollworm was as follows... Figure 4 As shown.

[0291] Table 13 Grading Standards for the Degree of Damage to Maize Ears by Cotton Bollworm

[0292] 0 The female ears were not damaged. 1 Only the filaments were damaged 2 Female ears damaged by 1cm 3+ For every 1cm increase in damage below the ear tip, the corresponding damage level increases by 1 grade. ...N

[0293] Table 14 Evaluation criteria for maize female ears' resistance to bollworm

[0294]

[0295]

[0296] Table 15. Resistance results of transgenic maize KJ1183 after inoculation with bollworm at the silking stage.

[0297] KJ1183 0.00 High anti-HR Compare with B104 6.93 Feel S

[0298] (2) Oriental slime bug

[0299] Transformer KJ1183 and recipient control B104 were each planted in triplicate, with an interval of more than 1 meter between each plant, a row spacing of 60 cm, and a plant spacing of 25 cm. Sowing was carried out according to the conventional sowing time, method, and amount for summer maize. Artificial inoculation was performed at the corn's large trumpet stage (11-13 leaves), with at least 20 plants inoculated per treatment. Each plant was inoculated with 20-30 newly hatched larvae, placed on the whorl of the corn plant. Three days after inoculation, a second inoculation was performed with the same number of larvae. Fourteen days after artificial inoculation, the degree of damage to corn leaves and the number of surviving larvae were investigated. The average damage level of corn leaves for each treatment was calculated. The results after inoculation were investigated and statistically analyzed according to the standards of Ministry of Agriculture Announcement No. 953-10.1-2007. Then, the resistance level of corn to the Eastern Armyworm was determined according to the standards.

[0300] Analysis of the results of the insect resistance identification test at the 6-8 leaf stage showed that two weeks after artificial inoculation with the Eastern armyworm, all leaves of the recipient control B104 were bitten, with 2-5 armyworms surviving on each leaf; while the transformant KJ1183 only had 1-4 insect holes with a diameter ≤1mm on a few leaves. The average leaf-eating grade of the transgenic maize was 1.20, and the resistance type was "highly resistant"; the average leaf-eating grade of the recipient control B104 was 7.67, and the resistance type was "susceptible". The resistance results of the transgenic maize KJ1183 to the Eastern armyworm at the large trumpet stage are shown in Table 5, and the field effects are as follows. Figure 5 As shown.

[0301] Table 16 Grading Standards for Damage to Maize Leaves by the Oriental Armyworm

[0302]

[0303]

[0304] Table 17 Evaluation Criteria for Corn Resistance to Armyworm

[0305] 1.0～2.0 High anti-HR 2.1～4.0 Anti-R 4.1～6.0 Chinese anti-MR 6.1～8.0 Feel S 8.1～9.0 High Sensitivity HS

[0306] Table 18. Resistance results of transgenic maize KJ1183 at the large trumpet stage to the Eastern armyworm.

[0307] KJ1183 1.20 High anti-HR Compare with B104 7.67 Feel S

[0308] (3) Fall armyworm

[0309] Transformer KJ1183 and recipient control B104 were each planted in triplicate, with an interval of more than 1 meter between each plant, a row spacing of 60 cm, and a plant spacing of 25 cm. Sowing was carried out according to the conventional sowing time, method, and amount for summer maize. Fall armyworm was artificially inoculated in the field during the large trumpet stage, with at least 20 plants inoculated for each treatment. Each plant was inoculated with 20-30 newly hatched larvae, placed on the whorl of the maize plant. A second inoculation was performed 3 days later, with the same number of larvae as the first. The inoculation was conducted 14-21 days after artificial inoculation, and the bite damage and the number of surviving larvae on each plant were investigated. Based on the bite damage and the number of surviving larvae per plant, the average damage level of the leaves for each treatment was calculated. The results after inoculation were investigated and statistically analyzed according to the armyworm damage grading standards and resistance evaluation standards described in the Ministry of Agriculture Announcement No. 953-10.1-2007 to evaluate resistance.

[0310] Analysis of the results of the resistance identification test at the large trumpet stage showed that two weeks after artificial inoculation with fall armyworm, all leaves of the recipient control B104 were bitten, a few leaves were eaten, and some leaves had large notches (≤10mm), with 2-5 larvae surviving on each leaf; while the transformant KJ1183 only had 1-6 insect holes ≤1mm in diameter on a few leaves. The average leaf-eating level of the transgenic maize was 1.06, and the resistance type was "highly resistant"; the average leaf-eating level of the recipient control B104 was 8.23, and the resistance type was "highly susceptible". The resistance results of the transgenic maize KJ1183 at the large trumpet stage to fall armyworm are shown in Table 6, and the field effects are as follows. Figure 6 As shown.

[0311] Table 19. Resistance level of fall moth in transformant KJ1183

[0312]

[0313]

[0314] (4) Corn borer

[0315] Transformer KJ1183 and recipient control B104 were each planted in triplicate, with an interval of more than 1 meter between each plant, a row spacing of 60 cm, and a plant spacing of 25 cm. Sowing was carried out according to the conventional sowing time, method, and amount for summer maize. Artificial inoculation was performed twice at the whorl stage (small trumpet stage, 6-8 leaf stage / 8-10 leaf stage) and the silking stage, with at least 20 plants in each treatment. The corn borer egg masses produced on waxed paper were cut into small pieces containing approximately 30-40 eggs each, depending on the density of the eggs. When the eggs developed to the blackhead egg stage, two waxed pieces containing approximately 40-60 eggs were inoculated into the whorl of each maize plant (the inoculation site during the silking stage was outside the silk cluster).

[0316] At the whorl stage, 14-21 days after inoculation, the damage to maize was investigated plant by plant, and the leaf-eating level of the Asian corn borer was recorded. 15-20 plants / rows were randomly selected from each treatment. The resistance to the Asian corn borer at the whorl stage was evaluated according to the grading standards for the degree of damage to maize leaves by the Asian corn borer as outlined in Ministry of Agriculture Announcement No. 953-10.1-2007 and NY / T1838.5-2006. The results showed that the average leaf-eating level of transgenic maize KJ1183 was 1.25, indicating a "highly resistant" resistance type; the average leaf-eating level of the recipient control B104 was 7.71, indicating a "susceptible" resistance type.

[0317] After inoculation during the silking stage, the extent of damage to female ears, plant damage, number of boreholes, length of borehole tunnels (cm), and surviving larval instars and numbers were investigated. 15-20 plants / rows were randomly selected from each treatment. The damage level of the female ears was evaluated based on these indicators. The results after inoculation were investigated and statistically analyzed according to the Ministry of Agriculture Announcement No. 953-10.1-2007 and NY / T1838.5-2006 standards to evaluate insect resistance. The results showed that all female ears of the recipient B104 were damaged, with an average tip damage of 3-5 cm, and 3-5 instar larvae survived. In contrast, the female ears and tips of the transformant KJ1183 were not damaged. The average leaf-eating grade of the transgenic maize was 0.00, and its resistance type was "highly resistant"; the average leaf-eating grade of the recipient control B104 was 7.57, and its resistance type was "highly susceptible". The resistance results of the transgenic maize event KJ1183 to the corn borer at the whorl and silking stages are shown in Table 22. Field effects are as follows: Figure 7 and Figure 8 As shown.

[0318] Table 20 Grading Standards for Damage Caused by Asian Corn Borer During the Maize Ear Stage

[0319]

[0320]

[0321] Table 21 Evaluation criteria for maize female ears' resistance to the Asian corn borer

[0322] 1.0～2.0 High anti-HR 2.1～3.0 Anti-R 3.1～5.0 Chinese anti-MR 5.1～7.0 Feel S ≥7.1 High Sensitivity HS

[0323] Table 22 Resistance level of Asian corn borer in transformant KJ1183

[0324]

[0325] Example 6: Herbicide Tolerance Testing of the Event

[0326] 1. Experimental Materials and Methods

[0327] (1) Plant materials: transgenic maize event KJ1183 and non-transgenic maize recipient control B104.

[0328] (2) Herbicide: Monsanto's 41% Roundup (recommended dosage: 150-250 ml / acre, with 200 ml / acre as 1×, 400 ml as 2×, and so on).

[0329] (3) Three replicates of the transformant and the control were planted, with a distance of more than 1 meter between each, a row spacing of 60 cm, and a plant spacing of 25 cm. Sowing was carried out according to the conventional sowing time, method, and amount of summer maize. A medium dose of 4 times the recommended dosage on the pesticide label and a water control were set up, with a water dilution rate of 450 L / ha. Post-emergence foliar treatment was carried out, and glyphosate was sprayed at the 3-5 leaf stage of maize. The pressure was kept constant, and a sprayer with a step and time recorder and a fan-shaped nozzle was used for foliar spraying of herbicides or water. The dosage of each herbicide was the same as that of the control. Other management was carried out according to local conventional methods.

[0330] (4) Investigation and Recording

[0331] Seedling survival rate, plant height (selecting the 5 tallest plants), and phytotoxicity symptoms (selecting the 15 plants with the least phytotoxicity) were investigated and recorded at 1 week, 2 weeks, and 4 weeks after application. The results were then recorded according to Table 23 below. Figure 18 The symptoms of pesticide damage were classified and statistically analyzed (refer to standard GB / T19780.42). After the corn harvest, 10 ears were selected from the middle two rows of each plot for indoor seed testing to determine the agronomic traits related to corn yield.

[0332] Note: Due to an error in the formula for calculating the damage level in the standard, if all plants show no signs of damage, the phytotoxicity level is 1. This is calculated based on a total of 100 plants. Therefore, this application downgraded all phytotoxicity levels by one level during the investigation, changing them from levels 1-5 to levels 0-4.

[0333] Table 23 Statistical Standards for Grading Pesticide Damage Symptoms

[0334] Level 0 The corn is growing normally, with no signs of damage. Level 1 Corn suffered minor herbicide damage, with damage levels less than 10%. Level 2 Corn suffered moderate pesticide damage, which can recover later, but it affected yield. Level 3 The corn suffered severe pesticide damage, which was difficult to recover from, resulting in reduced yield. Level 4 Severe pesticide damage to corn cannot be reversed, resulting in significant yield reduction or complete crop failure;

[0335] 2. Results and Analysis

[0336] (1) Seedling survival rate

[0337] Throughout the entire experimental phase, the seedling emergence rate of both the transformant KJ1183 and the recipient control B104 was 100% under water spraying conditions. Under 4× glyphosate spraying conditions, the seedling emergence rate of transgenic corn was 100% at 1, 2, and 4 weeks after spraying, with no difference from the water control; the recipient control, however, died completely, with a seedling emergence rate of 0%, significantly lower than the water control.

[0338] Table 24 Seedling survival rate (%) after glyphosate treatment at different time points

[0339]

[0340] Note: Data are expressed as mean ± standard deviation.

[0341] (2) Victimization rate

[0342] One, two, and four weeks after spraying 4x glyphosate, the phytotoxicity levels under different treatments were investigated and recorded according to Table 22, and the results were recorded using the formula. Calculate the herbicide damage rate. Where: X - damage rate, in percentage (%); N - number of affected plants; S - number of severity levels; T - total number of plants; M - highest severity level.

[0343] Table 25 shows the damage rate after spraying the KJ1183 transformant with 4 times the glyphosate concentration.

[0344]

[0345] Note: Data are expressed as mean ± standard deviation.

[0346] like Figure 9 As shown, after spraying with water, neither genetically modified nor non-genetically modified corn showed any damage. Transformer KJ1183, treated with a 4x concentration, maintained generally good growth at 1, 2, and 4 weeks. Some plants exhibited moderate phytotoxicity symptoms, including chlorosis, deformity, stunted growth, and slowed growth in a few individuals. The calculated damage rate ranged from 4.12% to 8.29%, all considered mild phytotoxicity. After 4 weeks, the damage rate decreased, and most plants recovered, with only a few leaves showing slight yellow spots. Non-genetically modified corn showed chlorosis 3 days after being treated with a 2x concentration of glyphosate. Over time, all plants gradually wilted, dried out, and died, with a 100% phytotoxicity rate.

Claims

1. A nucleic acid molecule, characterized in that, The sequence of the nucleic acid molecule is shown in SEQ ID NO:8 or its complementary sequence. The nucleic acid molecule is derived from the transgenic maize event KJ1183. The maize seeds of the transgenic maize event KJ1183 have been deposited at the China Center for Type Culture Collection with the accession number CCTCC NO:P202305.

2. A method for protecting corn plants from insect infestation, characterized in that, The invention includes providing at least one transgenic maize plant cell in the diet of a target insect, the genome of which contains the sequence shown in SEQ ID NO:8, and the target insect that feeds on the transgenic maize plant cell is inhibited from further feeding on the transgenic maize plant. The target insect is a lepidopteran insect, and the seeds of the transgenic maize plant have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202305.

3. A method for protecting corn plants from damage caused by herbicides, characterized in that, At least one transgenic maize plant, the genome of which contains the sequence shown in SEQ ID NO: 8, is planted and an effective dose of glyphosate herbicide is applied; the seeds of the transgenic maize plant have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO: P202305.

4. A method for controlling weeds in maize fields, characterized in that, The invention includes applying an effective dose of glyphosate herbicide to a field in which at least one transgenic maize plant is planted, the genome of which contains the sequence shown in SEQ ID NO: 8; the seeds of which have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO: P202305.

Images