Use of genes ZmIDD14 and ZmIDD15 in controlling corn plant type
Patent Information
- Application Number
- CN202211307622.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-24
- Publication Date
- 2026-09-18
- Estimated Expiration
- 2042-10-24
AI Technical Summary
[0005]目前对玉米中IDD家族基因的功能研究的报道较少,涉及到成花转变与糖代谢、种子的发育与萌发和芽的向地性,而对于塑造玉米紧凑株型还未有研究报道
[0013] This invention utilizes CRISPR/Cas9 technology to edit two homologous genes, ZmIDD14 and ZmIDD15, encoding C2H2-type zinc finger proteins in maize. The results showed that double mutants of these two genes exhibited a reduced leaf angle. This invention provides new genes for maize plant architecture improvement and offers theoretical guidance for developing superior, high-density-tolerant varieties and selecting ideal plant architectures.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology. Specifically, it relates to the application of genes ZmIDD14 and ZmIDD15 in controlling maize plant architecture. Genes ZmIDD14 and ZmIDD15 belong to the maize IDD (Indeterminate Domain) transcription factor family and are located on chromosomes 7 and 1 of maize, respectively. These two genes jointly control the important plant architecture trait of leaf angle in maize. Background Technology
[0002] Corn (Zea may L.) is an excellent animal feed, an important industrial raw material, and a food crop. It has great strategic significance in ensuring human food security and promoting economic development. How to increase the planting density of corn is one of the major scientific problems that need to be solved.
[0003] Among the main components of maize plant architecture, traits such as leaf angle, plant height, and ear height directly determine the spatial distribution of maize and thus its planting density. Semi-dwarf, compact maize varieties can mitigate lodging and yield reduction caused by increased planting density and also increase the light energy utilization rate of the maize population. Therefore, analyzing the genetic basis of plant height and leaf angle traits is crucial for understanding the formation of maize plant architecture and population structure, and provides theoretical guidance for developing superior, density-tolerant varieties and selecting ideal plant architectures.
[0004] Based on this, the applicant identified two homologous genes that jointly regulate leaf angle, named ZmIDD14 and ZmIDD15. These two genes belong to the maize IDD (Indeterminate Domain) transcription factor family, encode C2H2 type zinc finger protein, and participate in the gibberellin pathway.
[0005] Current research on the function of IDD family genes in maize is limited, covering topics such as flowering transition and sugar metabolism, seed development and germination, and bud geotropism. However, no studies have been reported on their role in shaping a compact maize plant architecture. Based on bioinformatics analysis, phenotypic data analysis, and related molecular biological analysis, the biological functions of these two genes in regulating leaf angle traits have been confirmed. Genetic transformation studies of ZmIDD14 and ZmIDD15 can provide genetic resources and theoretical support for maize plant architecture breeding. Summary of the Invention
[0006] The purpose of this invention is to provide the application of genes ZmIDD14 and ZmIDD15 in controlling maize plant architecture. By knocking out both ZmIDD14 and ZmIDD15 genes in maize, strains with reduced leaf angles can be obtained, which is beneficial for creating densely planted varieties. The protein encoded by the ZmIDD14 gene is shown in SEQ ID NO.2, and the protein encoded by the ZmIDD15 gene is shown in SEQ ID NO.8.
[0007] To achieve the above objectives, the present invention adopts the following technical measures:
[0008] The application of genes ZmIDD14 and ZmIDD15 in controlling maize plant architecture includes using conventional methods in the art to simultaneously prevent the expression of ZmIDD14 and ZmIDD15 genes in maize to obtain plants with reduced leaf angles. The protein encoded by the ZmIDD14 gene is shown in SEQ ID NO.2, and the protein encoded by the ZmIDD15 gene is shown in SEQ ID NO.8.
[0009] The conventional methods mentioned include, but are not limited to, knocking out or silencing the gene;
[0010] When a knockout technique is used, the CRISPR / Cas9 technique is employed, and the ZmIDD14 gene is shown in SEQ ID NO. 6, and the ZmIDD15 gene is shown in SEQ ID NO. 12;
[0011] The guide RNA sequences for ZmIDD14 gene knockout are: Guide RNA1: GCGATCTGCAGCGAACAGAACGG and Guide RNA2: GCTGGCTGCAGACCCGGACGCGG; the guide RNA sequences for ZmIDD15 gene knockout are: Guide RNA1: GCGCTTACCAGGAGTGCCGGCGG and Guide RNA2: GTGAGAGACGGGCGCTTACCAGG.
[0012] Compared with the prior art, the present invention has the following advantages:
[0013] This invention utilizes CRISPR / Cas9 technology to edit two homologous genes, ZmIDD14 and ZmIDD15, encoding C2H2-type zinc finger proteins in maize. The results showed that double mutants of these two genes exhibited a reduced leaf angle. This invention provides new genes for maize plant architecture improvement and offers theoretical guidance for developing superior, high-density-tolerant varieties and selecting ideal plant architectures. Attached Figure Description
[0014] Figure 1Spatiotemporal representation pattern diagrams for ZmIDD14 and ZmIDD15;
[0015] Where: A and B: subcellular localization results of ZmIDD14 and ZmIDD15; C and D: relative expression levels of ZmIDD14 and ZmIDD15 genes in various tissues and organs such as roots, stems, leaves, female ears, and male ears; SAM represents shoot apical meristem.
[0016] Figure 2 CRISPR / Cas9 knockout of the ZmIDD14 gene structure;
[0017] Where A represents the gene structure of ZmIDD14 and two CRISPR / Cas9 knockout target sites designed on the gene;
[0018] B is a PCR amplification diagram of wild-type KBN5585 and gene-edited plant ZmIDD14-KO between two targets of gene ZmIDD14. KO-homo represents homozygous editing and KO-het represents heterozygous editing.
[0019] C is a diagram showing the difference in base sequence between ZmIDD14 in the wild-type material KBN5585 and the gene-edited plant ZmIDD14-KO.
[0020] Figure 3 CRISPR / Cas9 knockout of the ZmIDD15 gene structure;
[0021] Where: A represents the gene structure of ZmIDD15 and two CRISPR / Cas9 knockout target sites designed on the gene;
[0022] B is a PCR amplification diagram of wild-type KBN5585 and gene-edited plant ZmIDD15-KO between two targets of gene ZmIDD15. KO-homo represents homozygous editing and KO-het represents heterozygous editing.
[0023] C is a diagram showing the difference in base sequence between ZmIDD15 in the wild-type material KBN5585 and the gene-edited plant ZmIDD15-KO.
[0024] Figure 4 Phenotypic diagrams and statistical data of single and double protrusions in ZmIDD14 and ZmIDD15 knockout materials;
[0025] The results showed that the leaf angle and auricle angle of the single process were significantly increased, but the leaf angle of the double process was significantly decreased, while the auricle angle remained unchanged (D, E, F).
[0026] Figure 5A schematic diagram of the CPB-ZmUbi-hspCas9 vector for knocking out the ZmIDD14 and ZmIDD15 genes. Detailed Implementation
[0027] The following embodiments further define the present invention. Based on the following description and examples, those skilled in the art can determine the basic features of the present invention, and can make appropriate improvements and modifications to the present invention without departing from its spirit and scope to make it suitable for various uses and conditions. Unless otherwise specified, the technical solutions described in this invention are all conventional molecular biology techniques.
[0028] Example 1:
[0029] Spatiotemporal representation modes of ZmIDD14 and ZmIDD15
[0030] Leaves of maize inbred line B73 were collected, total RNA was extracted from maize using the Trizol method, and maize cDNA was synthesized by reverse transcription.
[0031] Using cDNA as a template, PCR amplification yielded the complete coding sequence (CDS) of ZmIDD14 and ZmIDD15 (primer sequences are shown in Table 1, primer IDs are 1-2). The CDS sequence of ZmIDD14 is shown in SEQ NO.1, and the CDS sequence of ZmIDD15 is shown in SEQ NO.7. The CDS fragments of ZmIDD14 and ZmIDD15 were ligated into the PM999 vector. Using the known nuclear localization gene HX5 in rice as a reference, confocal microscopy revealed that ZmIDD14 and ZmIDD15 co-localized with HX5 in the cell nucleus. Figure 1 (AB).
[0032] Total RNA was extracted from 11 tissues, including roots, stems, and leaves, of maize B73, and cDNA was synthesized via reverse transcription. Using the cDNA as a template, quantitative PCR analysis was performed using gene-specific primer pairs (primer sequences are shown in Table 1, primer IDs are 3-4). The results showed that both ZmIDD14 and ZmIDD15 were highly expressed in young female and male ears. Figure 1 Medium CD).
[0033] PCR amplification program: pre-denaturation at 95℃ for 5 min, followed by 34 cycles of denaturation at 95℃ for 40 s, annealing at 58℃ for 40 s, extension at 72℃ for 1 min, and a final extension at 72℃ for 10 min.
[0034] Amplification system:
[0035]
[0036]
[0037] Example 2: Genetic transformation and genotyping of ZmIDD14 in maize
[0038] The genetic transformation for ZmIDD14 gene knockout utilized the full-length ZmIDD14 gene sequence from maize KN5585 as the application gene. Gene target design was performed according to the website http: / / cbi.hzau.edu.cn / crispr / , ultimately yielding two guide RNAs. Figure 2 (A)
[0039] Guide RNA sequence for ZmIDD14 gene knockout:
[0040] Guide RNA1: GCGATCTGCAGCGAACAGAACGG
[0041] Guide RNA2:GCTGGCTGCAGACCCGGACGCGG;
[0042] The company synthesized Guide RNA1 and Guide RNA2 primers with homologous arms, namely Target-1F and Target-2F. pU6F1 / pU6R was used as a primer to amplify the U6 promoter of the first target, and pU6F2 / pU6R was used as a primer to amplify the U6 promoter of the second target. Simultaneously, Target-1F / gRR0 was used as a primer to amplify the target+SgRNA fragment of the first target, and Target-2F / gRR1 was used as a primer to amplify the target+SgRNA fragment of the second target. Then, pU6F1 / gRR0 was used as a primer to overlap the U6 promoter fragment and the target+SgRNA fragment of the first target into a single "Promotor-target-SgRNA" insert. Similarly, pU6F2 / gRR1 was used as a primer to overlap the U6 promoter fragment and the target+SgRNA fragment of the second target. Finally, the two resulting insert fragments were ligated into the CPB-ZmUbi-hspCas9 vector linearized with Hind3 restriction endonuclease using multi-fragment homologous recombination (Li CX et al, 2017). Figure 5 The primer sequences are shown in Table 1 (primer ID is 5).
[0043] Then, the obtained clones were sequenced using CRISPR vector detection primers (primer sequences are shown in Table 1, primer ID is 6) to confirm that the gene was ligated into the vector. The plasmid of the correctly cloned gene was then transformed into the maize inbred line KN5585 via Agrobacterium-mediated genetic transformation (genetic transformation was performed by Jiangsu Weimi Company).
[0044] Primers were designed based on the ZmIDD14 genome sequence (primer sequences are shown in Table 1, primer ID is 7) to detect whether mutations occurred at the target site in the T0 generation plants, ultimately obtaining the gene-edited plant ZmIDD14-KO, i.e., the Zmidd14 single mutant. Amplification was performed using the DNA from the aforementioned T0 generation plants as a template; gel electrophoresis results are shown below. Figure 2 For the B-mode sequencing results, see [link to sequencing results]. Figure 2 In the middle C, a 250bp deletion was found between the two target sites, and an 82bp deletion of the CDS was found, which led to premature termination of translation (the sequence of the mutated ZmIDD14 gene is shown in SEQ ID NO. 13, and the CDS sequence of the mutated ZmIDD14 gene is shown in SEQ ID NO. 9).
[0045] Example 3: Genetic transformation and genotyping of ZmIDD15 in maize
[0046] The genetic transformation for ZmIDD15 gene knockout utilized the full-length ZmIDD15 gene sequence from maize KN5585 as the application gene. Gene target design was performed according to the website http: / / cbi.hzau.edu.cn / crispr / , ultimately yielding two guide RNAs. Figure 3 The guide RNA sequence for ZmIDD15 gene knockout (A) is as follows:
[0047] Guide RNA1: GCGCTTACCAGGAGTGCCGGCGG
[0048] Guide RNA2: GTGAGAGACGGGGCTTACCAGG;
[0049] The vector construction steps for ZmIDD15 gene knockout are the same as for ZmIDD14, with the only difference in primer sequences being Target-1F and Target-2F: the guide RNA for ZmIDD14 was replaced with the guide RNA for ZmIDD15, while the other amplification primers were identical. Figure 5 Primer sequences are shown in Table 1 (primer ID is 8).
[0050] Then, the obtained clones were sequenced using CRISPR vector detection primers (primer sequences are shown in Table 1, primer ID is 6) to confirm that the gene was ligated into the vector. The plasmid of the correctly cloned gene was then transformed into the maize inbred line KN5585 via Agrobacterium-mediated genetic transformation (genetic transformation was performed by Jiangsu Weimi Company).
[0051] Primers were designed based on the ZmIDD15 genome sequence (primer sequences are shown in Table 1, primer ID is 9) to detect whether mutations occurred at the target site in the T0 generation plants, ultimately obtaining the gene-edited plant ZmIDD15-KO, i.e., the Zmidd15 single mutant. Amplification was performed using the DNA from the aforementioned T0 generation plants as a template; the gel electrophoresis results are shown below. Figure 3 For the B-mode sequencing results, see [link to sequencing results]. Figure 3 In the study, two target sites were found to have one base insertion and two base deletions, which led to premature termination of protein translation (the mutant ZmIDD15 gene sequence is shown in SEQ ID NO.14, and the CDS sequence of the mutant ZmIDD15 gene is shown in SEQ ID NO.3).
[0052] Example 4: Functional identification of ZmIDD14 and ZmIDD15
[0053] Negative transgenic plants containing single mutants of Zmidd14 and Zmidd15 without CRISPR / Cas9 recombinant plasmids were hybridized to obtain F1 plants, which were then planted and self-crossed to obtain F2 population. From the F2 population, single mutants of Zmidd14 (idd14ko) and double mutants of Zmidd15 (idd15ko), as well as wild-type homozygous families, were identified.
[0054] These four families were planted in Wuhan, Hubei Province and Sanya, Hainan Province for multi-season phenotypic observation. Individual plant type traits were investigated during pollen shedding. Compared to the wild type (29.9°), the leaf angles of Zmidd14 (32.6°) and Zmidd15 (38.7°) increased by 8.9% and 29.3%, respectively, but the leaf angle of the double-adducted type (21.22°) decreased significantly by 29.1%. Figure 4 (AB).
[0055] The results above indicate that ZmIDD14 and ZmIDD15 together positively regulate the leaf angle of maize, and knocking out these two genes can create a compact and ideal plant type, which can be applied to the breeding of high-yield maize materials with dense planting.
[0056] References:
[0057] 1.Li CX,Liu CL,Qi xt,Wu yc,Fei xh,ML,Cheng bj,Li xh,Xie cx.RNA-guided Cas9 as an in vivo desired-target mutator in maize.Plant BiotechnolJ.2017Dec;15(12):1566–1576.
[0058] Table 1. Primers and their sequences used in this invention
[0059]
[0060]
Claims
1. Application of knockout or silence of genes ZmIDD14 and ZmIDD15 in reducing the angle between maize leaves, wherein the protein encoded by the ZmIDD14 gene is shown in SEQ ID NO.2 and the protein encoded by the ZmIDD15 gene is shown in SEQ ID NO.
8.
2. In the application according to claim 1, when the knockout technology is used, the technology used is CRISPR / Cas9, the ZmIDD14 gene is shown in SEQ ID NO. 6, and the ZmIDD15 gene is shown in SEQ ID NO. 12; the guide RNA sequence for ZmIDD14 gene knockout is: Guide RNA1: GCGATCTGCAGCGAACAGAACGG and Guide RNA2: GCTGGCTGCAGACCCGGACGCGG; the guide RNA sequence for ZmIDD15 gene knockout is: Guide RNA1: GCGCTTACCAGGAGTGCCGGCGG and Guide RNA2: GTGAGAGACGGGCGCTTACCAGG.
3. The application process according to claim 2 includes: Will Zmidd14 and Zmidd15 Negative transgenic plants with single mutants and no CRISPR / Cas9 recombinant plasmids were hybridized to obtain F1 plants, which were then planted and self-crossed to obtain F2 population. Double knockout mutants were then identified from the F2 population. The aforementioned Zmidd14 The single mutant contains the gene shown in SEQ ID NO.
13. Zmidd15 The single mutant contains the gene shown in SEQ ID NO.14.
Citation Information
Patent Citations
Application of tobacco NtIDD9 gene in leaf included angle regulation and control
CN119752988A
Gene suitable for corn close planting plant type improvement and application thereof
CN120924599A