Molecular markers of black-brown deer antler mushroom changli 1 strain and application thereof

Abstract

The application provides a kind of black brown deer mushroom Changli No.1 strain molecular marker, specific PCR amplification primer pair sequence as follows: forward primer-F: 5'-TCTCTCTCTCTCTCTCCCACTCTCTCACACGCTCCCT-3' and, reverse primer-R: 5'-GGTTCCGATTCCTCCTCTCG-3';The fragment size of molecular marker is 1582bp, and the nucleotide sequence of molecular marker is shown as SEQ ID NO.1.The molecular marker of black brown deer mushroom Changli No.1 strain provided by the application can be used for the identification and detection of black brown deer mushroom Changli No.1, and compared with the conventional edible fungus strain detection method, has the characteristics of short detection time and high accuracy.

Description

Technical Field

[0001] This invention relates to the field of edible fungi technology, specifically to the molecular markers of the dark brown *Pleurotus ostreatus* strain Changli 1 and their applications. Background Technology

[0002] Deer antler mushroom, scientifically known as *Lyophyllum decastes*, belongs to the genus *Lyophyllum* of the family Tricholomataceae in the order Agaricales of the subphylum Basidiomycotina. In Europe, it is called Friedchicken mushroom, and also known as "roadside mushroom," "iron road mushroom," and "lotus leaf mushroom." In China, it is named deer antler mushroom because its slices resemble the valuable traditional Chinese medicine deer antler. It is a large fungus used for both food and medicine.

[0003] Currently, most deer antler mushrooms on the market are light gray varieties, and they mainly suffer from the following problems: 1. The fruiting bodies have a uniform color, resulting in obvious homogeneity and low product distinctiveness; 2. The cultivation and planting cycle is relatively long; 3. The fibers are relatively coarse, and the texture is not delicate enough. These problems undoubtedly lead to increased production costs and reduce the product's market competitiveness.

[0004] The dark brown antler mushroom strain Changli No. 1 has unique color, short growth cycle, relatively firm and delicate fruiting body fibers, and crisp and tender taste. The product is highly recognizable, and its short growth cycle, carbon dioxide tolerance, and longer shelf life make it suitable for large-scale industrial cultivation.

[0005] With the development of molecular biology, molecular markers are increasingly being used for the identification of fungal species. SCAR (Sequence-characterized Amplified Region) markers are a very stable molecular marker that can be used for simple, rapid and stable fungal species identification. However, there is currently no SCAR molecular marker for the *Pleurotus ostreatus* strain Changli 1 for rapid identification and detection of *Pleurotus ostreatus* Changli 1. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the purpose of this invention is to provide a molecular marker for the dark brown antler mushroom strain Changli No. 1, which can be used for the identification and detection of this strain. Compared with conventional methods for detecting edible fungi strains, this marker has the advantages of shorter detection time and higher accuracy.

[0007] The first aspect of this invention provides a molecular marker for the dark brown *Pleurotus ostreatus* strain Changli 1, and the specific PCR amplification primer pair sequence is as follows: Forward primer-F: 5'-TCTCTCTCTCTCTCTCTCCCACTCTCTCACACGCTCCCT-3' and, Reverse primer-R: 5'-GGTTCCGATTCCTCCTCTCG-3'; The molecular marker fragment size is 1582 bp, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1.

[0008] The second aspect of the present invention provides the application of the molecular markers of the above-mentioned black-brown antler mushroom strain Changli 1 in the identification and detection of black-brown antler mushroom strain Changli 1.

[0009] Compared with the prior art, the embodiments of the present invention have the following beneficial effects: The molecular marker of the black-brown antler mushroom Changli No. 1 strain provided by the embodiments of the present invention can be used for the identification and detection of black-brown antler mushroom Changli No. 1. Compared with conventional edible fungi strain detection methods (morphological detection, antagonism test and fruiting test, etc.), it has the characteristics of short detection time and high accuracy. Attached Figure Description

[0010] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings: Figure 1 The image shows the alignment results of the band sequences obtained from SCAR in GenBank. Figure 1 Gel electrophoresis image for verification of molecular markers; Figure 2 The image shows the alignment results of the band sequences obtained from SCAR in GenBank. Figure 3 Image showing the alignment results of the designed molecular marker amplification bands in GenBank. Figure 4 Gel electrophoresis image for verification of molecular markers (reproducibility verification); Figure 5 Gel electrophoresis image for verification of molecular markers (reproducibility verification); Figure 6 This is a gel electrophoresis image of the polymorphic bands of the parent strain corresponding to the variant strain in the ISSR-PCR system. Detailed Implementation

[0011] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make several changes and improvements without departing from the concept of the present invention. These all fall within the protection scope of the present invention.

[0012] This invention provides a molecular marker that enables simple, rapid, and stable identification and detection of the black-brown mushroom strain Changli No. 1, which is deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M2023595 and deposit date of April 23, 2023.

[0013] The molecular markers of the dark brown velvet mushroom strain Changli No. 1 are further described below through specific implementation methods.

[0014] Example 1

[0015] 1. Experimental Materials 1.1 Test strains Experimental strain: Dark brown velvet mushroom Changli No. 1 strain ('LY-PPX-BY'), test number: B, strain provided by Jiangsu Pinpinxian Biotechnology Co., Ltd.

[0016] Control varieties: (1) 'LY-PPX-QB', test number: Q; (2) 'LY-SD', test number: S; The strains of the above two control varieties were purchased from Jiangsu Pinpin Fresh Biotechnology Co., Ltd.

[0017] 1.2 Reagents 2×HippoQ3fastTaqpremix (EasyBio); primers synthesized by Fuzhou Qingke Biotechnology Co., Ltd.; DNAmarket (Shanghai Baisai Biotechnology Co., Ltd.); fungal DNA extraction mini kit (OmegaBio-Tek, USA). 1.3 Instruments: Main instruments and equipment

[0018] 1.4 Primers: Sixty-seven primers were randomly selected from the 100 primers published by the University of British Columbia, and named P1-29 and ISSR1-38, respectively.

[0019] Table 1 Primer sequences for ISSRs (P1-29)

[0020] Table 2 Primer sequences for ISSRs (ISSR1-38)

[0021] 2. Experimental Methods 2.1 DNA Extraction (Kit Method) Mycelial collection: After inoculating the strain onto PDA plates and culturing in the dark for activation, cut off edge mycelial blocks and inoculate them onto PDA plates lined with cellophane, culturing in the dark until the plate is full. Scrape the mycelia off with a sterilized spatula, place them in 1.5 mL centrifuge tubes, and freeze for preservation. Extract DNA using a kit method.

[0022] Liquid nitrogen grinding: 1. Clean and cauterize the mortar and pestle, and prepare a container with some liquid nitrogen. 2. Carefully add liquid nitrogen to the mortar and pestle, immersing them completely. (Add the liquid nitrogen slowly to prevent splashing.) 3. After the first addition of liquid nitrogen evaporates, immediately and slowly add about half the volume of liquid nitrogen to the mortar (if the tissue pieces are large or numerous, the mortar can be completely submerged). Quickly transfer the tissue into the liquid nitrogen, ensuring that the tissue is completely submerged. 4. Gently tap the tissue in the liquid nitrogen with the pestle to break it into small pieces. Be careful not to use excessive force to prevent tissue pieces from splashing out of the mortar. 5. When the liquid nitrogen is about to evaporate completely, use a pestle to grind the tissue sample; 6. After the liquid nitrogen has evaporated completely, immediately add 1 / 3 of the volume of liquid nitrogen to the mortar (note that the liquid nitrogen should be added slowly to avoid excessive impact that could dislodge the tissue sample from the mortar), and quickly grind the tissue with the pestle. Depending on the degree of change in the tissue's condition, replenish the liquid nitrogen as needed while ensuring the tissue remains frozen (generally replenish every 30 seconds to 1 minute, at least 3 times), until the tissue is ground into powder. 7. Once the tissue is ground into powder, immediately transfer it to a centrifuge tube for later use. DNA Extraction: Collect the ground fungal tissue (30-100 mg) in a 2.0 mL microcentrifuge tube and immediately add 500 μL Buffer CPL and 10 μL 2-mercaptoethanol. Vortex vigorously to disperse all clumps. Incubate at 65 °C for 15 minutes, mixing the sample twice during incubation by inverting the tube. Add 500 μL chloroform / isoamyl alcohol (24:1) and vortex to mix. Centrifuge at 13,000 x g, 4 °C for 5 minutes. Carefully aspirate 300 μL of the supernatant into a new 1.5 mL microcentrifuge tube. Add 150 μL Buffer CPL, then add 300 μL anhydrous ethanol and vortex to obtain a homogeneous mixture. Add the entire sample (including any precipitate that may have formed) to a HiBind DNA column placed in a 2.0 mL collection tube (provided). Centrifuge the column at 10,000 x g for 1 minute to bind DNA, discarding the 2.0 mL collection tube and flow-through. Transfer the column to a second collection tube and wash with 650 μL LSPW wash buffer diluted with anhydrous (96%–100%) ethanol. Centrifuge at 10,000 x g for 1 minute and discard the flow-through. In the next step, reuse the collection tube and repeat the washing step for 1 minute at 10,000 x g using an additional 650 μL LSPW wash buffer. Place the column in the collection tube and centrifuge the empty column at maximum speed for 2 minutes to dry. Transfer the column to a clean 1.5 mL tube and add 35 μL of elution buffer preheated to 65°C and incubated at room temperature for 2 minutes. Centrifuge at 10,000 x g for 1 minute to elute and store at -20°C for later use.

[0023] 2.2 ISSR-PCR System The reaction system was 25 μL. The pre-denaturation was carried out at 94 °C for 4 min, followed by denaturation at 94 °C for 30 s, annealing at 38 °C for 1 min, extension at 72 °C for 1 min, and amplification was performed for 38 cycles. Finally, the extension was carried out at 72 °C for 10 min.

[0024] Sixty-seven primers were selected from 100 random primers published by the University of British Columbia, Canada, for ISSR analysis.

[0025] Figure 6 shows the polymorphic bands of the mutant strain and its corresponding parent strain via gel electrophoresis. After screening, 18 primers were obtained that could amplify polymorphic bands using *Pleurotus ostreatus* DNA as a template. Among them, two primers could amplify specific bands using *Pleurotus ostreatus* DNA as a template. Primer ISSR 5 (TCTCTCTCTCTCTCTCTC) amplified the characteristic band, which appeared only in the dark brown *Pleurotus ostreatus* strain Changli 1.

[0026] 2.2 Feature Strip Analysis of SCAR Markers The DNA fragment amplified by the ISSR 5 (TCTCTCTCTCTCTCTCC) primers, which is characteristic of the *Pleurotus ostreatus* mutant strain, was gel-purified, cloned, and sequenced to obtain a 2007 bp sequence (SEQ ID NO.4): Figure 2 As shown, the bands obtained from gel recovery are indeed from *Pleurotus ostreatus*, and the sequencing results are reliable.

[0027] 2.3 Design, synthesis, and validation of SCAR-labeled primers Design and synthesis of SCAR-labeled primers Based on the sequence obtained from TA cloning of the characteristic band and subsequent sequencing, and following primer design principles, amplification primer pairs for this characteristic band were designed, numbered 5. Forward primer 5-F: TCTTCTCTCTCTCTCTCCCACTCTCTCACACGCTCCCT; Reverse primer 5-R: GGTTCCGATTCCTCCTCTCG. Synthesis was commissioned to SequencingTech Biotech Co., Ltd.

[0028] The alignment results of this molecular marker sequence in GenBank are as follows: Figure 3 As shown, the designed molecular marker sequence results are reliable.

[0029] SCAR mark verification PCR amplification of DNA from various *Agaricus esculentus* species was performed using SCAR-labeled primer 5. The reaction system was 25 μL. The amplification cycle consisted of 33 cycles: pre-denaturation at 94 °C for 4 min, followed by denaturation at 94 °C for 30 s, annealing at 69 °C for 1 min, extension at 72 °C for 1 min, and a final extension at 72 °C for 10 min. PCR products were detected by 1% agarose gel electrophoresis.

[0030] The results of three repeated PCR experiments are as follows: Figure 1 , 4

[0031] Specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various changes or modifications within the scope of the claims, which do not affect the essence of the present invention. Unless otherwise specified, the embodiments and features described in this application can be arbitrarily combined with each other.

Claims

1. A molecular marker for a dark brown *Pleurotus ostreatus* strain, Changli No. 1, characterized in that, The specific PCR amplification primer pair sequences are as follows: Forward primer-F: 5'-TCTCTCTCTCTCTCTCTCCCACTCTCTCACACGCTCCCT-3' and, Reverse primer-R: 5'-GGTTCCGATTCCTCCTCTCG-3'; The molecular marker fragment size is 1582 bp, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; The dark brown *Pleurotus ostreatus* strain Changli 1 is deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M2023595 and deposit date of April 23, 2023.

2. The application of the molecular marker of the *Pleurotus ostreatus* strain Changli 1 as described in claim 1 in the identification and detection of *Pleurotus ostreatus* strain Changli 1, wherein, The dark brown *Pleurotus ostreatus* strain Changli 1 is deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M2023595 and deposit date of April 23, 2023.

Images