Cultivation member and use thereof
Patent Information
- Application Number
- CN202180084225.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-12-23
- Filing Date
- 2021-12-06
- Publication Date
- 2026-09-22
- Estimated Expiration
- 2041-12-06
AI Technical Summary
[0028]根据本发明,可以提供能够对细胞等进行培养而形成球状体的培养构件和培养器具。此外,根据本发明,能够提供形状稳定性优异且能够实现适合于细胞、组织或器官的培养的氧环境、不发出自身荧光而不损害细胞观察性、不易吸附药物的培养构件和培养器具。进一步,根据本发明,尤其可以提供能够以分化细胞纯度高的状态对干细胞来源的分化细胞进行培养的培养构件和培养器具。此外,本发明的培养构件和培养器具容易使iPS细胞向心肌细胞分化。
Smart Images

Figure BDA0004284535910000301 
Figure BDA0004284535910000302 
Figure BDA0004284535910000311
Abstract
Description
Technical Field
[0001] This invention relates to culture components and their uses. Background Technology
[0002] In the organs and tissues of living organisms, the cells that constitute them form a three-dimensional network to express their functions. Therefore, with the aim of fully utilizing the inherent functions of cells, spheroids obtained through three-dimensional cell culture, unlike traditional planar cell culture, have attracted considerable attention. Reports indicate that spheroids can yield results more closely resembling those of living organisms in cell function evaluation and drug screening than planar cultured cells, and they are expected to serve as an important tool for bridging the gap between in vitro and in vivo experiments in new drug development. Furthermore, stem cells, represented by iPS cells, are expected to be an important cell source for regenerative medicine and cell therapy, requiring the large-scale production of high-quality cells. If stem cells are cultured in three dimensions to form spheroids, high-density culture can be achieved while maintaining the pluripotency (undifferentiated state) of the cells, thus the usefulness of spheroids in regenerative medicine is also attracting significant attention. Consequently, there is an increasing demand for new cell culture techniques to obtain large quantities, stably, and easily uniformly shaped and sized cell spheroids.
[0003] In view of the above, various methods for forming spherical bodies are being developed. For example, there are methods using culture containers whose surfaces have been processed or treated to hinder cell adhesion (Patent Document 1), methods for culturing in a suspended state within a container with a resin layer having low cell adhesion (Patent Document 2), and methods for forming spherical bodies by making the amount of proteoglycan adsorbed in the culture container reach a specific value or higher, thereby forming spherical bodies adsorbed on the surface of the culture container (Patent Document 3), etc. Especially in the case of forming spherical bodies by culturing non-adhesive cells, treatments are usually performed to prevent cells from adhering to the surface of the culture container (e.g., superhydrophilizing the surface of the culture container, making it hydrophobic, or making it a structure that is difficult to adhere to, etc.).
[0004] Existing technical documents
[0005] Patent documents
[0006] Patent Document 1: International Publication No. 2020 / 013345
[0007] Patent Document 2: Japanese Patent Application Publication No. 2008-061609
[0008] Patent Document 3: Japanese Patent Application Publication No. 2017-77241 Summary of the Invention
[0009] The problem that the invention aims to solve
[0010] The present invention was made in view of the above circumstances, and its objective is to provide culture components and apparatus capable of culturing cells and the like to form spherical bodies. Furthermore, the objective is to provide culture components and apparatus with excellent shape stability, capable of providing an oxygen environment suitable for the culture of cells, tissues, or organs, not emitting autofluorescence to avoid impairing cell observation, and not easily adsorbing drugs. More particularly, the objective is to provide culture components and apparatus capable of culturing stem cell-derived differentiated cells in a state of high purity of differentiated cells.
[0011] Methods for solving problems
[0012] In order to solve the above-mentioned problems, the inventors conducted in-depth research. As a result, they found that the above-mentioned problems could be solved by using a culture component having the following structure, and thus completed the present invention. The present invention is exemplified by the following [1] to
[12] .
[0013] [1] A culture member for culturing cells, tissues, or organs on its culture surface, the culture member containing a 4-methyl-1-pentene polymer (X), wherein the water contact angle of the culture surface is greater than 100° and less than 160°, and the oxygen permeability at a temperature of 23°C and a humidity of 0% is 4500–90000 cm⁻¹. 3 / (m 2 (×24h×atm).
[0014] [2] According to the culture component described in [1], the above-mentioned 4-methyl-1-pentene polymer (X) is a copolymer (x1) of 4-methyl-1-pentene and at least one of ethylene and α-olefins (excluding 4-methyl-1-pentene) having 3 to 20 carbon atoms.
[0015] [3] According to the culture member described in [1] or [2], the culture surface is not processed to form an uneven structure.
[0016] [4] The culture member according to any one of [1] to [3] is used to form spherical bodies.
[0017] [5] The culture component according to any one of [1] to [4], wherein the cells, tissues or organs described above contain differentiated cells derived from iPS cells.
[0018] [6] The culture component according to any one of [1] to [5] contains cardiomyocytes.
[0019] [7] The culture member according to any one of [1] to [6] is in the shape of a membrane or a sheet.
[0020] [8] A culture apparatus, wherein at least the culture surface is formed of a culture member as described in any one of [1] to [7].
[0021] [9] A method for culturing cells, tissues, or organs, comprising:
[0022] The process (A) of bringing cells, tissues, or organs into contact with the culture surface of any one of the culture components described in [1] to [7] or the culture apparatus described in [8]; and
[0023] The process (B) involves culturing cells, tissues, or organs that are in contact with the culture surface to form spheroids.
[0024]
[10] The cell, tissue or organ culture method according to [9] further includes a step (C) of inducing the above-mentioned cells to differentiate into cardiomyocytes, wherein step (C) is a step of inducing iPS cells to differentiate into cardiomyocytes by protein-free cardiomyocyte differentiation induction (PFCD) method.
[0025]
[11] The cell, tissue or organ culture method described in [9] or
[10] increases the purity of the myocardium.
[0026]
[12] A spherical body formed by any one of the cultivation methods described in [9] to
[11] .
[0027] Invention Effects
[0028] According to the present invention, culture components and apparatuses capable of culturing cells and the like to form spherical bodies can be provided. Furthermore, according to the present invention, culture components and apparatuses with excellent shape stability, capable of providing an oxygen environment suitable for the culture of cells, tissues, or organs, not emitting autofluorescence to avoid impairing cell observation, and not easily adsorbing drugs can be provided. Further, according to the present invention, culture components and apparatuses particularly capable of culturing stem cell-derived differentiated cells in a state of high differentiated cell purity can be provided. Moreover, the culture components and apparatuses of the present invention facilitate the differentiation of iPS cells into cardiomyocytes. Attached Figure Description
[0029] [ Figure 1 ] Figure 1 A diagram illustrating the experimental timeline for inducing cardiomyocytes from iPS cell differentiation.
[0030] [ Figure 2 ] Figure 2 Photographs taken to observe cell morphology on day 12 of myocardial differentiation induction.
[0031] [ Figure 3 ] Figure 3 Photographs showing cell morphology on day 19 of myocardial differentiation induction.
[0032] [ Figure 4 ] Figure 4 A photograph showing the formation of spheroids in human bone tumor-derived cancer cells (HOF-143B) as observed in Example 3. Detailed Implementation
[0033] Unless otherwise specified, the description of numerical ranges as "A~B" means above A and below B. For example, the description of "1~5%" means above 1% and below 5%.
[0034] [Cultivation Components]
[0035] The culture member of the present invention is a member for culturing cells, tissues, or organs (hereinafter also referred to as cells, etc.) on its culture surface. It is characterized in that the culture member contains a 4-methyl-1-pentene polymer (X), the water contact angle of the culture surface is greater than 100° and less than 160°, and the oxygen permeability at a temperature of 23°C and a humidity of 0% is 4500–90000 cm⁻¹. 3 / (m 2 (×24h×atm).
[0036] Here, a culture member means a component that constitutes at least a part of a culture apparatus used for culturing cells, etc. When the culture member is part of the aforementioned culture apparatus, at least the culture surface for culturing cells, etc., is constituted by the culture member of the present invention. Here, a culture surface means, during the culturing of cells, etc., the surface on which culture medium is formed, the surface on which cells, etc., are inoculated, or the surface on which both culture medium is formed and cells, etc., are inoculated. That is, the culture surface is a concept that includes both the predetermined surface for forming culture medium and the predetermined surface for inoculating cells, etc.
[0037] In this instruction manual, the term "culture" is used in a broad sense, encompassing not only the proliferation and maintenance of cells, but also processes such as cell inoculation, passage, differentiation induction, and self-organization induction.
[0038] The shape of the culture member of the present invention is not particularly limited; for example, it can be membrane-like or sheet-like. When the culture member is membrane-like or sheet-like, it can be suitably used as a culture device with at least one side of the membrane-like or sheet-like culture member as the culture surface.
[0039] The term "culture component" in this invention refers to a component whose culture surface is not coated with a natural polymer, synthetic polymer, or inorganic material used as an anchoring base for cells, etc.
[0040] The thickness of the culture member of the present invention is not particularly limited. However, although the thickness of the culture member of the present invention is not particularly limited, it is preferably 20 to 500 μm, more preferably 25 to 400 μm, and particularly preferably 50 to 200 μm. If the thickness of the culture member is within the above range, a suitable oxygen concentration in the culture medium necessary for cell proliferation can be obtained, and suitable culture equipment, especially culture containers whose bottom surfaces do not flex, can be easily manufactured.
[0041] When the culture component of the present invention is disposed on the bottom surface of a container to manufacture culture vessels such as petri dishes (also called culture dishes), flasks, inserts, or plates, the thickness of the culture component is not particularly limited, but is preferably 20 μm to 400 μm, more preferably 20 μm to 300 μm, and even more preferably 20 μm to 200 μm. The thickness of the culture component is appropriately selected according to the shape of the culture vessel. By adjusting it to the above range, it is easy to obtain the appropriate oxygen concentration in the culture medium necessary for cell proliferation, and it is easy to manufacture suitable culture vessels with sufficient strength.
[0042] The surface of the culture component of the present invention can be processed, as long as it does not impair the effect of the present invention. Examples of surface processing include surface modification treatments such as forming an uneven structure, hydrophilic treatment, and hydrophobic treatment.
[0043] Even without surface processing, cells are difficult to adhere to the culture member of the present invention, thus enabling the formation of spherical structures. Therefore, the culture member of the present invention preferably has an unprocessed surface, and more preferably has not undergone processing to form an uneven structure.
[0044] The methods used for surface modification are not particularly limited, and examples include hydrophilication treatments such as corona treatment, plasma treatment, ozone treatment, and ultraviolet treatment; hydrophobication treatments such as esterification, silanization, and fluorination; surface graft polymerization; chemical vapor deposition; etching; addition of specific functional groups such as hydroxyl, amino, sulfonyl, mercapto, and carboxyl groups; treatments utilizing specific functional groups such as silane coupling, titanium coupling, and zirconium coupling; surface roughening using oxidants; and physical treatments such as friction and sandblasting. These surface modification treatments can be performed individually or in combination of two or more. It should be noted that when performing surface modification treatments, it is preferable to perform them on at least the culture surface.
[0045] There are no particular limitations on the manufacturing method of the culture component of the present invention, nor on the equipment used for manufacturing. For example, a film or sheet containing a 4-methyl-1-pentene polymer (X) can be formed, and the film or sheet can be molded into a molded article with a desired shape as needed, thereby producing the culture component. The film, sheet or other molded article that becomes the culture component can also be obtained by direct molding using methods such as extrusion molding, solution casting molding, injection molding, blow molding, etc.
[0046] As a method for forming the aforementioned film or sheet, specifically, conventional blow molding or T-die extrusion can be employed. Manufacturing is typically carried out under heating. When using T-die extrusion, the extrusion temperature is preferably 100°C to 400°C, particularly preferably 200°C to 300°C. Furthermore, the roll temperature is preferably 45°C to 75°C, particularly preferably 55°C to 65°C.
[0047] In addition, the aforementioned films or sheets can also be manufactured using a solution casting method, in which the 4-methyl-1-pentene polymer (X) is dissolved in a solvent, poured onto a resin or metal, and slowly dried while leveling to achieve film formation (sheet formation). There are no particular limitations on the solvent used; hydrocarbon solvents such as cyclohexane, hexane, decane, and toluene can be used. Furthermore, two or more solvents can be mixed, taking into account the solubility and drying efficiency of the 4-methyl-1-pentene polymer (X). The polymer solution can be coated using methods such as benchtop coating, spin coating, dip coating, die coating, spray coating, rod coating, roller coating, and curtain flow coating, followed by drying and peeling to process it into films or sheets.
[0048] The culture component of the present invention is preferably a culture component for forming spheroids, and more preferably a cell culture component for forming spheroids.
[0049] [4-Methyl-1-pentene polymer]
[0050] In this invention, 4-methyl-1-pentene homopolymer and copolymers of 4-methyl-1-pentene with other monomers are collectively referred to as "4-methyl-1-pentene polymer (X)".
[0051] As an example of a 4-methyl-1-pentene polymer, a copolymer of 4-methyl-1-pentene with other monomers can be any of a random copolymer, an alternating copolymer, a block copolymer, or a graft copolymer. As a copolymer of 4-methyl-1-pentene with other monomers, copolymers of 4-methyl-1-pentene with at least one olefin selected from ethylene and α-olefins having 3 to 20 carbon atoms (excluding 4-methyl-1-pentene) are preferred because they have high strength, are difficult to break or crack even when used as components, and exhibit minimal flexural stress.
[0052] As a 4-methyl-1-pentene polymer, it is preferably at least one polymer selected from 4-methyl-1-pentene homopolymer and copolymers of 4-methyl-1-pentene with at least one olefin selected from ethylene and α-olefins having 3 to 20 carbon atoms (excluding 4-methyl-1-pentene), more preferably copolymers of 4-methyl-1-pentene with at least one olefin selected from ethylene and α-olefins having 3 to 20 carbon atoms (excluding 4-methyl-1-pentene).
[0053] Examples of the olefins mentioned above include ethylene, propylene, 1-butene, 1-hexene, 1-heptene, 1-octene, 1-decene, 1-tetradecene, 1-hexadecene, 1-heptadecene, 1-octadecene, and 1-eicosene. The olefins can be appropriately selected based on the physical properties required for the culture component. For example, from the viewpoint of moderate oxygen permeability and excellent rigidity, α-olefins with 8 to 18 carbon atoms are preferred, and at least one selected from 1-octene, 1-decene, 1-dodecene, 1-tetradecene, 1-hexadecene, 1-heptadecene, and 1-octadecene is more preferred. If the number of carbon atoms of the olefin is within the above range, the processability of the polymer becomes better, and the tendency for poor appearance of the culture component due to cracking or end breakage is less likely to occur. Furthermore, the defect rate of the culture component is reduced.
[0054] One or more of the aforementioned olefins may be used. From the viewpoint of material strength, it is preferable to have 2 or more carbon atoms, and more preferably 10 or more carbon atoms. In the case of combining two or more different α-olefins, it is particularly preferable to combine at least one selected from 1-tetradecene and 1-hexadecene with at least one selected from 1-heptadecene and 1-octadecene.
[0055] The content of the constituent units derived from 4-methyl-1-pentene in the above-mentioned 4-methyl-1-pentene polymer is preferably 60 to 100 mol%, more preferably 80 to 98 mol%.
[0056] Furthermore, when the 4-methyl-1-pentene polymer is a copolymer of 4-methyl-1-pentene and at least one olefin selected from ethylene and α-olefins having 3 to 20 carbon atoms (excluding 4-methyl-1-pentene), the content of the constituent units derived from at least one olefin selected from ethylene and α-olefins having 3 to 20 carbon atoms (excluding 4-methyl-1-pentene) in the copolymer is preferably 0 to 40 mol%, more preferably 2 to 20 mol%. It should be noted that the content of these constituent units is based on setting the total amount of all repeating constituent units in the 4-methyl-1-pentene polymer to 100 mol%. If the content of the constituent units is within the above range, a homogeneous culture surface with excellent processability can be obtained; furthermore, the balance between the toughness and strength of the membrane is good, thus reducing deflection.
[0057] Without impairing the effects of the present invention, the above-described 4-methyl-1-pentene polymer may further comprise constituent units other than those derived from 4-methyl-1-pentene and those derived from ethylene and α-olefins having 3 to 20 carbon atoms (hereinafter also referred to as "other constituent units"). The content of other constituent units is, for example, 0 to 10.0 mol%. When the above-described 4-methyl-1-pentene polymer has other constituent units, there may be one or more other constituent units.
[0058] Examples of monomers from which other constituent units are derived include cyclic olefins, aromatic vinyl compounds, conjugated dienes, non-conjugated polyenes, functional vinyl compounds, hydroxyl-containing olefins, and haloolefins. For example, compounds described in paragraphs
[0035] to
[0041] of Japanese Patent Application Publication No. 2013-169685 may be used as cyclic olefins, aromatic vinyl compounds, conjugated dienes, non-conjugated polyenes, functional vinyl compounds, hydroxyl-containing olefins, and haloolefins.
[0059] The above-mentioned 4-methyl-1-pentene polymer can be used alone or in combination of two or more.
[0060] Commercially available polymers can also be used as 4-methyl-1-pentene polymers. Specifically, examples include TPX MX001, MX002, MX004, MX0020, MX021, MX321, RT18, RT31, and DX845 (all trademarks) manufactured by Mitsui Chemicals Co., Ltd. Furthermore, polymers manufactured by other companies that meet the above requirements are preferred. These commercially available polymers can be used individually or in combination of two or more.
[0061] 4-Methyl-1-pentene polymers typically have a melting point of 200°C to 240°C and exhibit high heat resistance. Furthermore, they do not hydrolyze and possess excellent water resistance, boiling water resistance, and steam resistance, allowing culture components, such as culture vessels containing 4-methyl-1-pentene polymers, to be autoclaved. 4-Methyl-1-pentene polymers also exhibit high visible light transmittance (typically above 90%) and do not emit autofluorescence, facilitating the observation of cultured cells in culture vessels containing them. Moreover, they show excellent drug resistance to most drugs and do not readily adsorb drugs, making them suitable for new drug development screening and diagnostic applications. 4-Methyl-1-pentene polymers are heat-sealable, easily allowing for heat fusion between materials and heat bonding with other materials. Additionally, their thermoforming capability allows for easy molding into culture vessels of any shape, such as through embossing or insert molding.
[0062] The weight-average molecular weight (Mw) of the 4-methyl-1-pentene polymer, determined by gel permeation chromatography (GPC) using standard polystyrene as a reference, is preferably 10,000 to 2,000,000, more preferably 20,000 to 1,000,000, and even more preferably 30,000 to 500,000. Here, the sample concentration for GPC determination can be set to, for example, 1.0 to 5.0 mg / ml. Furthermore, the molecular weight distribution (Mw / Mn) of the 4-methyl-1-pentene polymer is preferably 1.0 to 30, more preferably 1.1 to 25, and even more preferably 1.1 to 20. The solvent used in GPC is preferably dichlorobenzene. Furthermore, as an example of determination conditions, the conditions shown in the examples described later can be listed, but are not limited to these determination conditions.
[0063] By setting the weight-average molecular weight (Mw) below the aforementioned upper limit, the films produced by melt molding in the later-described molding method of the 4-methyl-1-pentene polymer are more likely to suppress defects such as gelation and to produce films with uniform surfaces. Furthermore, when produced by solution casting, the films exhibit better solubility in solvents, making it easier to suppress defects such as gelation and to produce films with uniform surfaces.
[0064] Furthermore, by setting the weight-average molecular weight (Mw) to or above the aforementioned lower limit, there is a tendency for the strength of the cultured component to become sufficiently high. Moreover, by setting the molecular weight distribution within the aforementioned range, there is a tendency for the surface stickiness of the manufactured cultured component to be easily suppressed, and the toughness of the cultured component to be sufficiently high, making it easier to suppress bending during molding and cracking during cutting.
[0065] Regarding the weight-average molecular weight (Mw) and molecular weight distribution (Mw / Mn) of the above-mentioned 4-methyl-1-pentene polymers, when using two or more 4-methyl-1-pentene polymers, their respective Mw and Mw / Mn should be within the above ranges.
[0066] Because 4-methyl-1-pentene polymer has such excellent properties as described above, at least the culture vessel formed by the culture component of the present invention will not have an adverse effect on the culture. Moreover, it has good stability, light transmittance, molding processability and can be sterilized, so it is an excellent material for culture components.
[0067] [Method for manufacturing 4-methyl-1-pentene polymer]
[0068] Regarding the method for manufacturing the above-mentioned 4-methyl-1-pentene polymer, any method can be used to polymerize 4-methyl-1-pentene, olefins, and other monomers. Furthermore, chain transfer agents, such as hydrogen coexisting, can be used to control molecular weight and molecular weight distribution. There are no restrictions on the equipment used for manufacturing. The polymerization method can be a known method, such as a gas-phase method, slurry method, solution method, or bulk method. Slurry and solution methods are preferred. Furthermore, the polymerization method can be a method of blending multiple polymers with different molecular weights in a polymerization system through single-step polymerization or multi-step polymerization (such as two-step polymerization). Whether it is a single-step or multi-step polymerization method, when using hydrogen as a chain transfer agent, it can be added all at once or in batches, for example, at the beginning, middle, and end of polymerization. Polymerization can be carried out at room temperature or heated as needed. From the viewpoint of polymerization efficiency, it is preferred to carry out the polymerization at 20°C to 80°C, and particularly preferred at 40°C to 60°C. There are no restrictions on the catalysts used in the manufacturing process. From the viewpoint of polymerization efficiency, it is preferable to use, for example, the solid titanium catalyst composition (I) described in International Publication No. 2006 / 054613, or the olefin polymerization catalyst (metallocene catalyst) containing a transition metal compound (A) described in International Publication No. 2014 / 050817.
[0069] It should be noted that when the culture component is formed from a composition containing 4-methyl-1-pentene polymer (X), in 100% by mass of the culture component, the 4-methyl-1-pentene polymer (X) is preferably 90% by mass or more and less than 100% by mass, more preferably 95% by mass or more and less than 100% by mass, and particularly preferably 99% by mass or more and less than 100% by mass. If a large amount of components other than 4-methyl-1-pentene polymer (X) are present, it will not only lead to a decrease in oxygen permeability, but also to a decrease in transparency and strength.
[0070] The material forming the culture component of the present invention may also contain components other than 4-methyl-1-pentene polymer (X). Examples of components other than 4-methyl-1-pentene polymer (X) include heat stabilizers, light stabilizers, processing aids, plasticizers, antioxidants, lubricants, defoamers, antiblocking agents, colorants, modifiers, antibacterial agents, antifungal agents, antifogging agents, and other additives.
[0071] [Water contact angle]
[0072] The water contact angle of the culture surface of the culture member of the present invention is greater than 100° and less than 160°. Preferably, the water contact angle is greater than 100° and less than 150°, more preferably greater than 100° and less than 130°, and even more preferably greater than 105° and less than 130°. If the water contact angle of the culture surface of the culture member is less than 100°, cells and the like will adhere to the culture member, making it difficult to form spherical bodies. Furthermore, if the water contact angle of the culture surface of the culture member is greater than 160°, the contact between the culture surface and the culture medium is insufficient, and the efficiency of oxygen supply to the culture medium will decrease.
[0073] There are no particular limitations on the method for measuring the water contact angle; known methods can be used, with the static drop method being preferred. The water contact angle can be measured, for example, by the following method: Following Japanese Industrial Standard JIS-R3257 (Test Method for Wettability of Substrate Glass Surfaces), under constant temperature and humidity conditions of 25±5°C and 50±10%, a water droplet of approximately 4 μL or less, which can be considered spherical in shape, is added to the surface of a culture member or a test sample made of the same material as the culture member. The angle of the contact interface between the test sample and the water droplet is measured within one minute after the water droplet contacts the test sample surface using the static drop method.
[0074] [Oxygen permeability]
[0075] The culture component of this invention has an oxygen permeability of 4500–90000 cm⁻¹ at a temperature of 23°C and a humidity of 0%. 3 / (m 2 (×24h×atm), preferably 4500~67500cm 3 / (m 2 (×24h×atm), more preferably 4500~47000cm 3 / (m 2 (×24h×atm), further preferably 4500~45000cm 3 / (m 2 (×24h×atm).
[0076] If the oxygen permeability of the culture medium is too low, the oxygen concentration in the medium decreases, and cells cannot proliferate sufficiently. On the other hand, if the oxygen permeability is too high, the oxygen concentration in the medium is too high, leading to decreased cell function due to oxygen stress. When the oxygen permeability is within the aforementioned upper and lower limits, the cells maintain good morphology and can proliferate efficiently according to the culture time.
[0077] For the culture element or the test sample made using the same material as the culture element, the oxygen permeability coefficient [cm] at 23°C and 0% humidity was determined by differential pressure gas permeability measurement. 3 ×mm / (m 2The oxygen permeability [cm²] is calculated by dividing the oxygen permeability coefficient by the thickness (μm) of the culture structure. 3 / (m 2 (×24h×atm)]. There are no particular restrictions on the equipment used for the measurement, as long as it employs a differential pressure gas permeability measurement method. For example, the MT-C3 differential pressure gas permeability measuring device manufactured by Toyo Seiki Co., Ltd. is suitable. Preferably, the test sample is prepared by cutting a 90×90mm test piece from a 50μm thick membrane, with the measuring section diameter set to 70mm (permeable area of 38.46cm²). 2 Because of its high oxygen permeability, it is preferable to pre-apply an aluminum mask to the sample, setting the actual permeable area to 5.0 cm². 2 The culture element used for oxygen permeability measurement, or the test sample made of the same material as the culture element, may be micro-processed or surface-modified, or it may not be, preferably without any treatment.
[0078] [Cells, tissues, or organs]
[0079] In this specification, cells, tissues, or organs are also referred to simply as "cells, etc." The source of cells, etc., is not particularly limited and can be any living organism such as animals, plants, insects, fungi, protozoa, and bacteria, preferably animals or plants, more preferably animals, and particularly preferably mammals. The culture member of the present invention can prevent cell, etc., adhesion during culture and has excellent oxygen permeability; therefore, cells, etc., are preferably non-adhesive.
[0080] The cells used in this invention are not particularly limited, and examples include plant cells, animal cells, insect cells, etc., with animal cells being preferred, and mammalian cells being more preferred. As mammalian cells, cells derived from humans, monkeys, mice, rats, pigs, dogs, sheep, cats, and goats are preferred, with human-derived cells being more preferred. The cells can be two-dimensionally cultured cells or three-dimensionally cultured cells, including spheroids obtained by culturing cells. The cells used in this invention can be frozen and refrozen cells. Furthermore, the cells used in this invention can be passaged cells, and the number of passages is not particularly limited.
[0081] Animal cells can be normal cells, fused cells such as cancer cells and hybridomas, or cells that have undergone artificial treatment such as gene introduction. Animal cells can be primary cultured cells or cells passaged from lineages. Animal cells can be suspension cells or adhesive cells. Examples of animal cells include undifferentiated pluripotent stem cells, differentiated cells derived from pluripotent stem cells (including pluripotent stem cells that have begun differentiation induction and are already in the process of differentiation), undifferentiated somatic stem cells, differentiated cells derived from somatic stem cells (including somatic stem cells that have begun differentiation induction and are already in the process of differentiation), and differentiated cells derived from animal tissues.
[0082] In this invention, the differentiated cells are not limited to mature cells that have reached the final stage of differentiation (finally differentiated mature cells). The differentiated cells mentioned above can be cells that have differentiated from the ectoderm, cells that have differentiated from the mesoderm, or cells that have differentiated from the endoderm.
[0083] Pluripotent stem cells are cells that possess the ability to differentiate into all the cells that make up an organism (pluripotency) and the capacity to self-replicate and maintain this ability even after cell division. Pluripotent stem cells include embryonic stem cells (ES cells), embryonic germ cells (EG cells), induced pluripotent stem cells (iPS cells), Muse cells (multi-lineage differentiating stress enduring cells), embryonic carcinoma cells (EC cells), trophoblast stem cells (TS cells), and epiblast stem cells (EpiS cells). Pluripotent stem cells are preferably ES cells or iPS cells, more preferably iPS cells.
[0084] ES cells can be established by culturing the inner cell mass extracted from the blastocyst of mammalian fertilized eggs on a fibroblast feeder layer. Furthermore, cell maintenance via passage culture can be performed using culture media supplemented with substances such as leukemia inhibitory factor (LIF) and basic fibroblast growth factor (bFGF). Methods for establishing and maintaining ES cells in humans and monkeys are described, for example, in USP 5,843,780; Thomson JA et al. (1995), Proc Natl. Acad. Sci. USA (Proceedings of the National Academy of Sciences of the United States of America) 92:7844-7848; Thomson The following journals have documented this information: JA et al. (1998), Science 282:1145-1147; H. Suemori et al. (2006), Biochem. Biophys. Res. Commun. 345:926-932; M. Ueno et al. (2006), Proc. Natl. Acad. Sci. USA, 103:9554-9559; H. Suemori et al. (2001), Dev. Dyn. 222:273-279; H. Kawasaki et al. (2002), Proc. Natl. Acad. Sci. USA, 99:1580-1585; Klimanskaya I et al. (2006), Nature 444:481-485.
[0085] In addition, human ES cell lines, such as WA01(H1) and WA09(H9), can be obtained from the WiCell Research Institute, while KhES-1, KhES-2 and KhES-3 can be obtained from the Institute for Regenerative Medicine, Kyoto University (Kyoto, Japan).
[0086] iPS cells can be created by introducing specific initialization factors into somatic cells in the form of DNA or protein (K. Takahashi and S. Yamanaka (2006), Cell 126:663-676; K. Takahashi et al. (2007), Cell 131:861-872; J. Yu et al. (2007), Science 318:1917-1920; Nakagawa, M. et al. Nat. Biotechnol. 26:101-106 (2008); International Publication WO 2007 / 069666).
[0087] The term "somatic cells" refers to all animal cells (preferably mammalian cells, including humans) other than reproductive cells such as eggs, oocytes, and ES cells, or totipotent cells. This includes fetal (infant) somatic cells, neonatal (infant) somatic cells, and mature healthy or diseased somatic cells. Furthermore, primary cultured cells, passaged cells, and lineage cells are also included. Examples of somatic cells include, for instance, tissue stem cells (somatic stem cells) such as neural stem cells, hematopoietic stem cells, mesenchymal stem cells, and dental pulp stem cells; tissue progenitor cells; and differentiated cells such as lymphocytes, epithelial cells, endothelial cells, muscle cells, fibroblasts, hair cells, hepatocytes, gastric mucosal cells, intestinal cells, spleen cells, pancreatic cells, brain cells, lung cells, kidney cells, and adipocytes.
[0088] The aforementioned initialization factors can consist of genes specifically expressed in ES cells, their gene products, or non-coding RNAs, or genes, their gene products, or non-coding RNAs that play an important role in the maintenance of undifferentiated ES cells, or low-molecular-weight compounds. Examples of genes included as initialization factors include Oct3 / 4, Sox2, Sox1, Sox3, Sox15, Sox17, Klf4, Klf2, c-Myc, N-Myc, L-Myc, Nanog, Lin28, Fbx15, ERas, ECAT15-2, Tcl1, beta-catenin, Lin28b, Sal1, Sal4, Esrrb, Nr5a2, Tbx3, or Glis1. These initialization factors can be used individually or in combination of two or more.
[0089] Somatic stem cells are cells that possess the limited differentiation capacity to differentiate into specific cell types and the ability to self-replicate and maintain this limited differentiation capacity even after cell division. Somatic stem cells include mesenchymal stem cells, hematopoietic stem cells, and neural stem cells.
[0090] Differentiated cells derived from animal tissues include, for example, various progenitor cells such as adipocytes, hepatocytes, kidney cells, pancreatic cells, mammary cells, endothelial cells, epithelial cells, smooth muscle cells, myoblasts, cardiomyocytes, nerve cells, glial cells, dendritic cells, chondrocytes, osteoblasts, osteoclasts, osteocytes, fibroblasts, various blood system cells, retinal cells, corneal-derived cells, gonadal-derived cells, and various glandular cells.
[0091] The above-mentioned cells can be used alone or in combination of two or more.
[0092] From the perspective of suitability for spheroid formation, the animal cells are preferably pluripotent stem cells and differentiated cells derived from pluripotent stem cells, more preferably iPS cells and differentiated cells derived from iPS cells, further preferably cardiomyocytes derived from iPS cells, and particularly preferably human cardiomyocytes derived from iPS cells. Alternatively, from the perspective of suitability for spheroid formation, the animal cells are preferably somatic stem cells, more preferably mesenchymal stem cells. Alternatively, from the perspective of suitability for spheroid formation, the animal cells are preferably cancer cells. Alternatively, from the perspective of making the cell state closer to the state of an organism with a three-dimensional structure, the animal cells are preferably cells that generally require three-dimensional culture, more preferably cells that form spheroids, such as hepatocytes, nerve cells, cardiomyocytes, pancreatic β cells, vascular endothelial cells, adipocytes, adipose-derived stem cells, chondrocytes, mesenchymal stem cells, hair follicle epithelial stem cells, dermal papilla cells, skin fibroblasts, skin keratinocytes, and osteoblasts.
[0093] When the animal cells are differentiated cells derived from pluripotent stem cells, these cells can be produced from pluripotent stem cells using known differentiation induction methods. Alternatively, differentiated cells derived from pluripotent stem cells can also be commercially available cells. When the animal cells are somatic stem cells, cells collected from animals or commercially available cells can be used.
[0094] Differentiated cells derived from pluripotent stem cells are preferably cardiomyocytes derived from iPS cells.
[0095] iPS cell-derived cardiomyocytes can be produced, for example, by the well-known protein-free cardiomyocyte differentiation induction (PFCD) method (see International Publication No. 2015 / 182765). The protein-free cardiomyocyte differentiation induction (PFCD) method can achieve high cardiomyocyte differentiation efficiency, and therefore iPS cell-derived cardiomyocytes produced by this method can achieve high cardiomyocyte purity.
[0096] In this invention, a spheroid refers to a cluster of cells aggregated together; in other words, it can also be called a cell clump or cell mass. A spheroid can be a single cell containing a cardiomyocyte, or it can be a spheroid containing two or more different cell types than cardiomyocytes, such as various fibroblasts and vascular endothelial cells. The various cells mentioned above can be used as examples. Spheroids formed using the culture member or culture apparatus of this invention are preferably spheroids containing pluripotent stem cells or spheroids containing differentiated cells derived from pluripotent stem cells; more preferably, they are spheroids containing iPS cells or spheroids containing differentiated cells derived from iPS cells; and even more preferably, they are spheroids containing cardiomyocytes derived from iPS cells.
[0097] The spheroids preferably have a differentiated cell purity of 10% or more, more preferably 13% or more, further preferably 15% or more, further preferably 20% or more, and particularly preferably 30% or more (number of differentiated cells / number of cells constituting the spheroids × 100). When iPS cells are induced to differentiate into spheroids using cardiomyocytes as the target cell, the spheroids preferably contain cardiomyocytes derived from iPS cells with a cardiomyocyte purity of 10% or more, more preferably 20% or more, and further preferably 30% or more. The number of differentiated cells can be determined by known methods, for example, by flow cytometry analysis using antibodies against cardiac troponin T (cTnT), troponin, myosin regulatory light chain 2 (MYL2), and myosin regulatory light chain 7 (MYL7), which are markers for cardiac function. The number of cells constituting the aforementioned spheroids can be determined by known methods, such as by treating the spheroids with trypsin to unicellularize them, and then determining the number of cells in each unicellular unit.
[0098] When pluripotent stem cells are differentiated to obtain differentiated cells, the resulting spheroids will contain, in addition to the target differentiated cells, a small portion of undifferentiated cells and cells that have undergone differentiation other than the target differentiation. Therefore, if the purity of the differentiated cells is within the above range, the reliability of the data obtained when using the spheroids of differentiated cells for various tests is improved, and reproducibility is also easily improved.
[0099] There is no particular limitation on the size of the spheroids. It varies depending on the cell type, cell number, culture medium, and culture days. Regarding the size of the spheroids, the average diameter is preferably 10–10000 μm, more preferably 10–8000 μm, and even more preferably 10–5000 μm. The diameter of the spheroids can be determined, for example, by observing under a microscope and measuring the diameter on a photograph, or by using a particle size analyzer.
[0100] There is no particular limit to the number of cells that make up the spheroids. It varies depending on the type of cells forming the spheroids, the culture medium, the number of days of culture, etc., and each spheroid may, for example, contain 1 × 10⁶ cells. 1 More than one, 1×10 2 More than one, 1×10 3 More than one, 1×10 4 More than one, 1×10 5 More than one, 1×10 6 More than one, 1×10 7 More than one, 1×108 More than one, 1×10 9 More than one. Furthermore, no upper limit is specifically set. The number of cells constituting the spheroid can be calculated, for example, from the fluorescence intensity after cell staining with a fluorescent reagent and a standard curve of cell number versus fluorescence intensity.
[0101] The culture medium used for cell culture can be selected appropriately based on the cell type. There are no particular limitations on the type of culture medium; for example, any basal cell culture medium, differentiation medium, or primary culture-specific medium can be used. Specifically, examples include Essential 8, Eagle Minimum Basal Medium (EMEM), Dulbecco Modified Eagle Medium (DMEM), α-MEM, Glasgow's MEM (GMEM), IMDM, RPMI 1640, Ham's F-12, MCDB medium, William's E medium, hepatocyte thaw medium, and mixtures thereof. However, these media are not limited to; any medium containing the components necessary for cell proliferation and differentiation can be used. Furthermore, media supplemented with serum, various growth factors, differentiation-inducing factors, antibiotics, hormones, amino acids, sugars, and salts can also be used. There are no particular restrictions on the culture temperature, which is typically around 25–40°C.
[0102] There is no particular limitation on the amount of culture medium, but the height of the culture medium is preferably 3 to 30 mm, more preferably 3 to 25 mm, and even more preferably 4 to 20 mm.
[0103] In this invention, "organism" refers to a collection of similar cells performing the same function, a concept distinct from "spheroid." The term "organism" is not particularly limited and can include, for example, epithelial tissue, connective tissue, muscle tissue, and nerve tissue. Preferably, the tissue contains cells that form spheroids. Examples of such tissues include neural tissue containing nerve cells, myocardial tissue containing cardiomyocytes, adipose tissue containing adipocytes or adipose-derived stem cells, cartilage tissue containing chondrocytes, and bone tissue containing osteoblasts. From the perspective of high aerobic demand, neural tissue and myocardial tissue are preferred, with myocardial tissue being more preferred. Furthermore, from the perspective of suitability for spheroid formation, tissue containing somatic stem cells is preferred.
[0104] In this invention, "organ" refers to a collection of the aforementioned tissues that work synergistically for a single purpose. The term "organ" is not particularly limited, and examples include the lungs, heart, liver, kidneys, spleen, pancreas, gallbladder, esophagus, stomach, skin, and brain. Preferably, the organs contain cells that form spheroids. Examples of such organs include the liver containing hepatocytes, the pancreas containing pancreatic β-cells, blood vessels containing vascular endothelial cells, bone marrow containing mesenchymal stem cells, hair follicles containing hair follicle epithelial stem cells or dermal papilla cells, the kidneys, and skin containing dermal fibroblasts or keratinocytes. From the perspective of high oxygen demand, the organs are preferably skin, kidneys, liver, pancreas, heart, and hair follicles, with the heart being more preferred. Furthermore, from the perspective of suitability for spheroid formation, the organs are preferably organs containing somatic stem cells.
[0105] [Culturing Equipment]
[0106] In this invention, "culture apparatus" refers to all apparatus used for culturing cells, etc. At least a portion of the aforementioned culture apparatus is composed of the culture member described above. The culture apparatus may be entirely composed of the culture member, or only a portion thereof. In the case where only a portion of the culture apparatus is composed of the culture member, at least the culture surface for culturing cells, etc., is composed of the culture member of this invention.
[0107] The aforementioned culture equipment is typically used in devices such as incubators, mass culture devices, or perfusion culture devices.
[0108] As the aforementioned culture apparatus, various known culture apparatuses can be used, and there are no particular restrictions on shape or size. Examples of such culture apparatuses include, in addition to culture containers such as petri dishes, flasks, plates, bottles, bags, and tubes, inserts, cups, liners, and glass slides, with culture containers being preferred.
[0109] The aforementioned culture apparatus can be a culture apparatus or a culture container with at least one well. A culture container with at least one well is, for example, a disc with at least one well, and more specifically, a disc with 6, 12, 24, 48, 96, 384, or 1536 wells. Generally, in culture apparatuses with a concave shape like a well on the bottom surface, it is necessary to increase the thickness of the bottom surface to stabilize the complex shape, which makes it difficult to adequately supply oxygen to cells, etc. If the culture component of the present invention is used, even discs with 1, 6, 12, 24, 48, 96, 384, or 1536 wells have a stable shape, and the oxygen supply to cells, etc., is adequate.
[0110] To maintain or store the culture medium, the aforementioned culture apparatus is preferably one with its bottom surface as the culture surface. When the culture apparatus is a petri dish, flask, insert, or tray, the bottom surface is the culture surface; therefore, the culture member of the present invention preferably constitutes at least part or all of the bottom surface among its bottom, side, and top surfaces. If at least the bottom surface (culture surface) is constituted by the culture member of the present invention, oxygen can be supplied to the culture medium more effectively, and cells in the culture medium can proliferate more effectively. Furthermore, higher density culture is possible while maintaining cell function.
[0111] The shape of the bottom surface of the aforementioned culture apparatus is not particularly limited, and examples include flat bottoms, spherical bottoms (U-shaped bottoms), flat bottoms (F-shaped bottoms), conical bottoms (V-shaped bottoms), and flat bottoms with curved edges. When manufacturing spherical bottoms (U-shaped bottoms), flat bottoms (F-shaped bottoms), conical bottoms (V-shaped bottoms), or flat bottoms with curved edges, a one-time process such as injection molding or compression molding can be used, or a membrane or sheet can be fabricated first and then further processed using vacuum forming or compression molding. The shape of the bottom surface is selected based on the culture purpose. For two-dimensional cell culture, a flat bottom is generally preferred, while for three-dimensional culture, a spherical bottom (U-shaped bottom) or a conical bottom (V-shaped bottom) is generally preferred.
[0112] The parts of the culture apparatus other than the aforementioned culture components can be made of materials other than the aforementioned culture components. There are no particular limitations on the materials other than the aforementioned culture components, and known materials can be used. Examples of such materials include polystyrene, polydimethylsiloxane (PDMS), cyclic olefin polymers, cyclic olefin copolymers, and glass.
[0113] The above-mentioned culture equipment can be used after coating its culture surface and / or parts other than the culture surface with natural polymer materials, synthetic polymer materials or inorganic materials.
[0114] If the culture surface of the culture vessel is coated with natural polymer materials, synthetic polymer materials, or inorganic materials, the proliferation of cells will be better, but the cells will easily adhere to the culture surface.
[0115] Whether or not to coat the culture surface depends on the type of cells, etc., but it is generally preferred not to coat it.
[0116] To prevent contamination, the culture equipment of this invention can be disinfected or sterilized. There are no particular limitations on the methods of disinfection or sterilization, and examples include: physical disinfection methods such as flowing steam, boiling, intermittent methods, and ultraviolet light; chemical disinfection methods using gases such as ozone or disinfectants such as ethanol; heating sterilization methods such as high-pressure steam and dry heat; irradiation sterilization methods such as gamma ray, electron beam, and high-frequency methods; and gas sterilization methods such as ethylene oxide gas sterilization and hydrogen peroxide plasma sterilization. Among these, ethanol disinfection, high-pressure steam sterilization, gamma ray sterilization, electron beam sterilization, or ethylene oxide gas sterilization are preferred for ease of operation and thorough sterilization. These disinfection or sterilization treatments can be performed individually or in combination of two or more.
[0117] The method for manufacturing the culture apparatus of the present invention is not particularly limited. When the entire culture apparatus is composed of the aforementioned culture components, it can be manufactured using the same method as the method for manufacturing the culture components. When a portion of the culture apparatus is formed from the aforementioned culture components, the culture apparatus can be obtained by appropriately joining the culture components with other components. There are no particular limitations on the joining method; the culture components can be integrally formed with the other components, or they can be bonded together using an adhesive or bonding agent.
[0118] The culture apparatus of the present invention is preferably a culture apparatus for forming spheroids, and more preferably a cell culture apparatus for forming spheroids.
[0119] [Cultivation Methods]
[0120] The cell culture method of the present invention is a method for culturing cells, tissues, or organs, comprising: a step (A) of bringing cells, tissues, or organs into contact with a culture member, or at least a culture surface of a culture vessel formed by the culture member, wherein the culture member is a culture member on which cells, tissues, or organs are cultured, the culture member contains a 4-methyl-1-pentene polymer (X), the water contact angle of the culture surface is greater than 100° and less than 160°, and the oxygen permeability at a temperature of 23°C and a humidity of 0% is 4500 to 90000 cm⁻¹. 3 / (m 2 (×24h×atm); and the process (B) of culturing cells, tissues or organs in contact with the above culture surface to form spheroids.
[0121] The culture method of the present invention enables cells, etc., to efficiently form spheroids when cultured using the culture surface of the aforementioned culture member or culture apparatus. Furthermore, according to the present invention, pluripotent stem cells readily and efficiently differentiate into differentiated cells.
[0122] [Process (A)]
[0123] Regarding methods for bringing cells or the like into contact with the culture surface of culture components or vessels, there are no particular limitations as long as contact between the cells or the like and the culture surface of the culture components or vessels is achieved. For example, seeding cells or the like on the culture surface of culture components or vessels can be cited. More specifically, for example, cells or the like suspended in culture medium can be added to a culture container using a pipette or the like, and after shaking the culture container as needed to evenly disperse the cells within the culture container, the container can be left to stand in an incubator.
[0124] Regarding the density of seeded cells, there are no particular restrictions as long as the cells can proliferate and differentiate. When the cells are undifferentiated pluripotent stem cells or differentiated cells derived from pluripotent stem cells, the preferred seeding density is 0.1 × 10⁻⁶ cells / year. 5 cells / cm 2 (cells / cm 2 )~10.0×10 5 cells / cm 2 More preferably 0.3×10 5 cells / cm 2 ~5.0×10 5 cells / cm 2 A further preferred value is 0.5 × 10⁻⁶. 5 cells / cm 2 ~3.0×10 5 cells / cm 2 .
[0125] If the cell seeding density is within the above range, cell proliferation and differentiation will proceed more efficiently compared to when it is outside the above range, and therefore this is preferred.
[0126] There are no particular restrictions on the culture medium used for inoculation, as long as it is a medium in which cells can survive; the appropriate medium should be selected based on the type of cells used. The culture medium used for inoculation can be the same as the medium used in step (B) described later.
[0127] When the cells are undifferentiated pluripotent stem cells or differentiated cells derived from pluripotent stem cells, the culture medium used for seeding can be any basal cell culture medium, differentiation medium, or primary culture medium. Specifically, examples include Essential 8, StemFit, ReproFF2, Stem-Partner SF, Eagle Minimum Basal Medium (EMEM), Dulbecco Modified Eagle Medium (DMEM), α-MEM, Glasgow's MEM (GMEM), IMDM, RPMI 1640, Ham's F-12, MCDB, William's E medium, and mixtures thereof. Furthermore, culture media supplemented with serum, various growth factors, differentiation-inducing factors, antibiotics, hormones, amino acids, sugars, salts, minerals, metals, vitamins, etc., can also be used.
[0128] There is no particular limitation on the amount of culture medium used for inoculation. When added to the culture container, the height of the culture medium is preferably 3 to 30 mm, more preferably 3 to 25 mm, and even more preferably 4 to 20 mm.
[0129] There are no particular restrictions on the culture temperature; it is usually carried out at around 25–40°C.
[0130] [Process (B)]
[0131] Regarding methods for culturing cells or other objects in contact with the culture surface to form spheroids, there are no particular limitations as long as oxygen, nutrients, etc., can be supplied to the cells or other objects in contact with the culture surface and the cells or other objects can be cultured to form spheroids. For example, oxygen can be supplied to an incubator containing culture medium, oxygen can be supplied to the cells or other objects using culture components, and the temperature can be maintained at 37°C for a certain period of time.
[0132] The culture medium used for cell culture can be selected appropriately based on the cell type. There are no particular limitations on the type of medium; for example, any basal cell culture medium, differentiation medium, or primary culture-specific medium can be used. Specifically, examples include Essential 8, Eagle Minimum Basal Medium (EMEM), Dulbecco Modified Eagle Medium (DMEM), α-MEM, Glasgow's MEM (GMEM), IMDM, RPMI 1640, Ham's F-12, MCDB medium, William's E medium, hepatocyte thawing medium, and mixtures thereof, but these are not the only options. Any medium containing the components necessary for cell proliferation and differentiation can be used. Furthermore, media supplemented with serum, various growth factors, differentiation-inducing factors, antibiotics, hormones, amino acids, sugars, and salts can also be used. There are no particular restrictions on the culture temperature, which is typically around 25–40°C.
[0133] There is no particular limitation on the amount of culture medium, but the height of the culture medium is preferably 3 to 30 mm, more preferably 3 to 25 mm, and even more preferably 4 to 20 mm.
[0134] The culture time can be appropriately selected based on the type, size, and degree of differentiation of the cells and the desired spheroids. When forming spheroids containing cardiomyocytes derived from iPS cells, the culture time is preferably 7–30 days, more preferably 10–25 days, and most preferably 11–20 days.
[0135] [Process (C)]
[0136] The cell culture method of the present invention may further include a step (C) of inducing the differentiation of the aforementioned cells.
[0137] There are no particular restrictions on the methods for inducing the differentiation of the aforementioned cells. Differentiation induction towards the desired target cells can be performed by following well-known operating procedures, and commercially available differentiation induction culture media and differentiation kits can be used.
[0138] There are no particular restrictions on the conditions for differentiation induction; they can be appropriately set according to the type of cells used and the target cell type. Differentiation is usually induced by adding predetermined cytokines, proliferation factors, or other compounds to the culture medium at predetermined concentrations.
[0139] When the cell culture method of the present invention includes step (C), the cells are preferably undifferentiated pluripotent stem cells, differentiated cells derived from pluripotent stem cells (including pluripotent stem cells that have begun differentiation induction and are already in the process of differentiation), undifferentiated somatic stem cells, differentiated cells derived from somatic stem cells (including somatic stem cells that have begun differentiation induction and are already in the process of differentiation), more preferably undifferentiated pluripotent stem cells or differentiated cells derived from pluripotent stem cells, and even more preferably undifferentiated iPS cells or differentiated cells derived from iPS cells.
[0140] There are no particular restrictions on the target differentiated cells mentioned above; they can be any differentiated cell type. These target differentiated cells include various progenitor cells, such as adipocytes, hepatocytes, kidney cells, pancreatic cells, mammary cells, endothelial cells, epithelial cells, smooth muscle cells, myoblasts, cardiomyocytes, nerve cells, glial cells, dendritic cells, chondrocytes, osteoblasts, osteoclasts, osteocytes, fibroblasts, various blood system cells, retinal cells, corneal-derived cells, gonadal-derived cells, and various glandular cells.
[0141] The target differentiated cells are preferably cells that form spheroids, and more preferably cells with high aerobic requirements. The target differentiated cells are preferably hepatocytes, nerve cells, cardiomyocytes, pancreatic β cells, vascular endothelial cells, adipocytes, adipose-derived stem cells, chondrocytes, mesenchymal stem cells, hair follicle epithelial stem cells, dermal papilla cells, skin fibroblasts, skin keratinocytes, osteoblasts, and hematopoietic progenitor cells, etc., more preferably cardiomyocytes, nerve cells, and hepatocytes, and even more preferably cardiomyocytes.
[0142] Step (C) is preferably a step of inducing pluripotent stem cells to differentiate into cardiomyocytes, and more preferably a step of inducing iPS cells to differentiate into cardiomyocytes.
[0143] There are no particular limitations on the methods for inducing pluripotent stem cells to differentiate into cardiomyocytes. Various methods are known for inducing pluripotent stem cells to differentiate into cardiomyocytes (e.g., Burridge et al. Cell Stem Cell 2012 Jan 6; 10(1):16-28; Kattman et al. Cell Stem Cell 2011; 8:228-240; Zhang et al. CircRes 2012; 111:1125-1136; Lian et al. Nat Protoc 2013; 8:162-175; WO 2016 / 076368; WO 2013 / 111875; Minami et al. Cell Reports 2012, 2(5):1448-1460, etc.), for example, methods using embryoid formation, methods using monolayer differentiation culture, methods using forced agglutination, etc. In any method, induction efficiency can be improved by sequentially acting on mesodermal inducing factors (e.g., activin A, BMP4, bFGF, VEGF, SCF, etc.), cardiac determinants (e.g., VEGF, DKK1, Wnt signaling inhibitors (e.g., IWR-1, IWP-2, IWP-4, etc.), BMP signaling inhibitors (e.g., NOGGIN, etc.), TGFβ / activin / NODAL signaling inhibitors (e.g., SB431542, etc.), retinoic acid signaling inhibitors, etc.), and cardiac differentiation factors (e.g., VEGF, bFGF, DKK1, etc.).
[0144] There are no particular limitations on the method for inducing iPS cells to differentiate into cardiomyocytes; for example, the well-known protein-free cardiomyocyte differentiation induction (PFCD) method can be used (refer to International Publication No. 2015 / 182765). The protein-free cardiomyocyte differentiation induction (PFCD) method can achieve high cardiomyocyte differentiation efficiency, therefore step (C) is preferably a step of inducing iPS cells to differentiate into cardiomyocytes by the protein-free cardiomyocyte differentiation induction (PFCD) method.
[0145] Step (C) can be performed after step (A) and before step (B), or simultaneously with step (B), or only during a portion of the time spent on step (B). For more efficient induction of pluripotent stem cell differentiation, it is preferable to perform step (C) and step (B) simultaneously.
[0146] The differentiation induction time in step (C) can be appropriately set according to the type of cells used, the type of target cells to be differentiated, the degree of differentiation, and the differentiation induction method. When inducing iPS cells to differentiate into cardiomyocytes, the differentiation induction time is preferably 7 to 30 days, more preferably 10 to 25 days, and even more preferably 11 to 20 days.
[0147] [Characteristics of the cultivation method]
[0148] The cell culture method of the present invention is preferably a method for culturing iPS cells or differentiated cells derived from iPS cells, and more preferably a method for culturing cardiomyocytes derived from iPS cells.
[0149] The cell culture method of the present invention is preferably a method that increases the purity of myocardium.
[0150] The aforementioned increase refers to differentiating pluripotent stem cells into cardiomyocytes under experimental conditions where a polystyrene culture element or apparatus is used instead of the aforementioned culture element or apparatus, and all other conditions are the same as those used in the cell culture method of the present invention. The cardiomyocyte purity at this point is used as a comparative control, and the cardiomyocyte purity is higher than that of the comparative control. Preferably, the cardiomyocyte purity is 1.3 times or more higher than that of the aforementioned comparative control, more preferably 2 times or more higher, and even more preferably 3 times or more higher.
[0151] The aforementioned cardiac purity refers to the percentage (%) of cardiomyocytes differentiated from pluripotent stem cells out of the total number of differentiated cells derived from pluripotent stem cells. There are no particular limitations on the method for determining this cardiac purity; for example, after a predetermined period of differentiation induction, the total number of cells and the number of cells expressing cardiomyocyte markers can be measured, and the percentage calculated. If cells form spheroids, the spheroids can be unicellularized using known methods, and the total number of cells constituting the spheroids can be taken as the total cell count.
[0152] Cell counts can be measured using, for example, a hemocytometer or FACS.
[0153] There are no particular limitations on the aforementioned cardiomyocyte markers, and examples include cardiac troponin C (cTnC), cardiac troponin I (cTnI), cardiac troponin T (cTnT), myosin light chain, α-actin, NKX2.5, KCNQ1, HERG1b, Cav1.2, Nav1.5, etc. The preferred cardiomyocyte marker is cardiac troponin T (cTnT).
[0154] The number of cells expressing cardiomyocyte markers can be determined, for example, using antibodies against cardiomyocyte markers via FACS.
[0155] The above-mentioned optimal myocardial purity can be calculated by dividing the number of cTnT positive cells by the total number of cells constituting the spheroids by 100.
[0156] The cell culture method of the present invention is preferably a method for increasing the expression of the myosin-regulatory light chain 2 (MYL2) gene in cardiomyocytes.
[0157] The aforementioned increase refers to the following: pluripotent stem cells are differentiated into cardiomyocytes under experimental conditions identical to those of the cell culture method of the present invention, except for the use of a polystyrene culture element or apparatus instead of the aforementioned culture element or apparatus. The expression level of the MYL2 gene in these cardiomyocytes is then used as a comparative control, and the MYL2 gene expression level is higher than that of the comparative control. Preferably, the MYL2 gene expression level is at least twice as high as that of the comparative control, and more preferably, at least three times as high.
[0158] The expression level of the MYL2 gene can be determined by known methods, such as quantitative RT-PCR.
[0159] The cell culture method of the present invention is preferably a method that increases the beat rate of cardiomyocytes.
[0160] The aforementioned increase refers to the following: under experimental conditions where pluripotent stem cells are differentiated into cardiomyocytes using a polystyrene culture element or apparatus instead of the aforementioned culture element or apparatus, and all other conditions are the same as those used in the culture method of the cells of the present invention, the cardiomyocytes are differentiated into cardiomyocytes, and the beating rate of the cardiomyocytes at this time is used as a comparative control, and the beating rate of the cardiomyocytes is higher than that of the comparative control. Preferably, the beating rate of the cardiomyocytes is more than twice that of the aforementioned comparative control, and more preferably, the beating rate of the cardiomyocytes is more than three times that of the comparative control.
[0161] The beat rate of cardiomyocytes can be measured using known methods, such as by filming a video of cardiomyocytes and measuring the BPM (beat rate per minute) of any cardiomyocyte.
[0162] [Spheroid]
[0163] The spherical bodies of the present invention are formed through the above-described cultivation method.
[0164] The spheroids of the present invention are characterized by a high tendency for uniform size and shape due to the oxygen supply reaching the cell interior during culture. Furthermore, since the cells contained in the spheroids of the present invention maintain normal function and have high cell purity, the reliability of data obtained when using the spheroids for various assays is improved, and reproducibility is also readily enhanced.
[0165] The spherical bodies of the present invention can be suitably used for cell function evaluation and drug screening, and can thus be suitably used as a cell source for regenerative medicine and cell therapy.
[0166] Example
[0167] The present invention will now be described in further detail by way of illustrative embodiments, but the present invention is not limited to these embodiments.
[0168] [Determination of weight-average molecular weight (Mw) and molecular weight distribution (Mw / Mn)]
[0169] The weight-average molecular weight Mw and molecular weight distribution (Mw / Mn) of the 4-methyl-1-pentene polymer used in the examples were determined by gel permeation chromatography (GPC).
[0170] Specifically, under the following conditions, the weight-average molecular weight (Mw) and number-average molecular weight (Mn) of polymers dissolved in dichlorobenzene were determined using standard polystyrene with corrected molecular weight.
[0171] • Apparatus: Gel permeation chromatograph HLC-8321GPC / HT (manufactured by Tosoh Corporation)
[0172] • Data analysis software: Empower3 (made by Waters Corporation)
[0173] • Detector: Differential refractometer
[0174] • Tandem-connected chromatographic columns: TSKgel GMH6-HT (2 columns) and TSKgel GMH6-HTL (2 columns)
[0175] Column temperature: 140℃
[0176] • Flow rate: 1.0 ml / minute
[0177] • Sample concentration: 1.5 mg / ml
[0178] [Measurement of drooping distance]
[0179] A test piece measuring 100mm x 10mm was cut from the membrane of the manufacturing example or the culture vessel of the comparative example. The test piece was fixed to the test stand, protruding exactly 50mm horizontally from the upper horizontal surface relative to its longitudinal dimension. After fixing for 3 minutes, the distance from the front end of the test piece protruding from the test stand, from the horizontal plane including the upper surface of the test stand, downwards was measured. The room temperature from fixing to measurement was 23°C. The results are shown in Table 1.
[0180] [Presence or absence of flexibility]
[0181] On day 19 of differentiation induction, the culture container was removed from the incubator, and the bottom surface of the container was observed laterally to check for membrane sagging in the culture environment. A case where there was no change compared to when the container was made and no membrane sagging was observed was evaluated as "no flexure," while a case where there was a change compared to when the culture container was made and membrane sagging was observed was evaluated as "flexure present."
[0182] [Determination of water contact angle]
[0183] The water contact angle was measured according to Japanese Industrial Standard JIS-R3257 (Test Method for Wettability of Substrate Glass Surface). Under constant temperature and humidity conditions of 25±5℃ and 50±10%, a water droplet with a volume of less than 4μL and a shape that can be regarded as spherical was added to the surface of the test sample. The angle of the contact interface between the sample and the water droplet was measured within 1 minute after the water droplet came into contact with the test sample surface by the static drop method.
[0184] [Measurement of oxygen permeability]
[0185] For the test samples, a differential pressure gas permeability measuring device MT-C3 manufactured by Toyo Seiki Co., Ltd. was used to measure the oxygen permeability coefficient in an environment with a temperature of 23°C and a humidity of 0%. The diameter of the measuring section was set to 70 mm (permeable area of 38.46 cm²). 2 Because a high oxygen permeability coefficient was expected, an aluminum mask was applied to the sample beforehand, and the actual permeable area was set to 5.0 cm². 2 .
[0186] The measured oxygen permeability coefficient [cm] 3 ×mm / (m 2 Divide the value of [×24h×atm)] by the thickness (μm) of the membrane (culture component) to calculate the oxygen permeability [cm]. 3 / (m 2 ×24h×atm).
[0187] [Manufacturing Example 1] Manufacturing of Cultivation Components
[0188] Using TPX (registered trademark) as a 4-methyl-1-pentene polymer (manufactured by Mitsui Chemicals, Ltd.: molecular weight (Mw) = 428,000, molecular weight distribution (Mw / Mn) = 4.1), a T-die extruder with a fully threaded screw and an extruded substrate layer was fed into the extruder. The extrusion temperature was set to 270°C, the roll temperature to 60°C, and the roll rotation speed was varied to obtain a 50 μm thick film. The water contact angle and oxygen permeability of the obtained film were measured. The results are shown in Table 1.
[0189] [Manufacturing Example 2] Fabrication of a culture container
[0190] The membrane was cut into 8cm × 12cm pieces and sealed to the bottom of a 24-well polystyrene (PS) container frame using a medical adhesive (made by 3M) to create a 24-well culture tray. Then, it was packaged in a gamma-ray resistant bag and sterilized by irradiation with 10kGy of gamma rays.
[0191] [Example 1] Induction of differentiation from iPS cells to cardiomyocytes
[0192] Using the culture vessel prepared in Manufacturing Example 2, differentiation from iPS cells to cardiomyocytes was induced to form spherical bodies via the method described later. The culture medium was used with a height of 5 mm (culture medium volume: 1 mL).
[0193] [Example 2]
[0194] Compared to Example 1, the amount of culture medium was increased and the height of the culture medium was set to 10 mm. Otherwise, the culture was carried out in the same manner as in Example 1 (culture medium volume: 1.8 mL).
[0195] [Comparative Example 1]
[0196] Culture containers were made using ultra-low adhesion PS with a surface thickness of 1000 μm (manufactured by Corning Incorporated, Costar). TM 3473 (a 24-well disc with an inner diameter of 15 mm for the culture surface of a single well), except that, cultivation was carried out using the same method as in Example 1. This ultra-low adhesion PS culture container was obtained by hydrophilizing a commercially available PS culture container (water contact angle 61°). The results of the water contact angle measurements are shown in Table 1.
[0197] [Comparative Example 2]
[0198] Compared with Comparative Example 1, the amount of culture medium was increased and the height of the culture medium was set to 10 mm. Otherwise, the culture was carried out in the same manner as Comparative Example 1.
[0199] [iPS cell culture]
[0200] <Preparation of Culture Media and Reagents>
[0201] Human-derived iPS cells cryopreserved in liquid nitrogen (provided by the iPS Cell Institute).
[0202] The reagents used are as follows.
[0203] • Essential 8 (Product No. A1517001, Gibco)
[0204] ·iMatrix-511silk (Product No. 387-10131, Nippi)
[0205] CultureSure TM Y-27632 (Product No. 034-24024, Fujifilm and Hikari Pure Chemicals)
[0206] • 0.5 mol / L EDTA solution (pH 8.0) (Product No. 06894-85, Nacalai Tesque)
[0207] •PBS(-) (Product No. 166-23555, Fujifilm and Koichi Pharmaceutical)
[0208] • 2.5% Trypsin (Product No. 15090-046, Gibco)
[0209] • Trypan blue (product number 145-0022, Bio-Rad)
[0210] Formaldehyde solution (product number 064-00406, Fujifilm and Koujun Pharmaceutical)
[0211] • Anti-Troponin TC(CT3) (Product No. SC-20025, Santacruz)
[0212] • Anti-Mouse IgG (H+L) Alexa Fluor 647 (Product No. A-21236, Thermo Fisher)
[0213] • Saponin from Soybeans (Product No. 192-08851, produced by Fujifilm and Koichi Chemicals)
[0214] • Myocardial differentiation induction medium (low molecular weight compound group A, low molecular weight compound group B): based on paragraphs
[0064] and
[0065] of International Publication No. 2015 / 182765.
[0215] The culture medium and reagents were prepared as follows.
[0216] • iPS cell culture medium: For Essential 8, use after setting to room temperature. When thawing and passaging, supplement the medium with CultureSure at a concentration of 3 μM. TM Y-27632 was used.
[0217] • Myocardial differentiation induction medium: Mix low molecular weight compound group A or low molecular weight compound group B into the myocardial differentiation induction medium and heat to 37°C before use.
[0218] • Stripping solution: Adjust the 0.5 mol / L EDTA solution (pH 8.0) to 0.5 mM with PBS(-). Heat to 37°C before use.
[0219] Y-27632 solution: Adjust to 10 mM with PBS(-).
[0220] • Single-cell preparation solution: Adjust 2.5% Trypsin to 0.25% with PBS(-). Heat to 37°C before use.
[0221] • Saponin solution: Adjust the soybean saponins to a 0.1% solution with PBS(-).
[0222] • Storage conditions: Y-27632 solution, single-cell solution, and other reagents necessary for cardiomyocyte culture should be frozen, while culture medium and stripping solution should be refrigerated.
[0223] <Training Schedule>
[0224] Cell culture was performed according to the following schedule. Cells passaged five times after iPS cell resuscitation were used for differentiation induction. Sampling was performed on day 12, when cardiomyocyte beating was confirmed, and on day 19, when cells were more mature.
[0225] Day 1: Reagent Preparation and Setup
[0226] Day 0: iPS cell resuscitation
[0227] Day 3 onwards: iPS cell passage (days 3, 6, 10, 15, and 19, a total of 5 passages)
[0228] Day 23: Induction of iPS cell myocardial differentiation begins (Day 0)
[0229] Day 45: Sampling and single-cell analysis (FACS, gene expression analysis) on day 12 of myocardial differentiation induction.
[0230] Day 39: Sampling and single-cell analysis (FACS, gene expression analysis) on day 19 of myocardial differentiation induction.
[0231] <iPS cell culture methods>
[0232] Thawing of iPS cells
[0233] 1) Before thawing iPS cells, add 10 mL of culture medium to the tube and heat in a 37°C water bath.
[0234] 2) The frozen iPS cell tubes were partially dissolved in a 37°C water bath and then slowly transferred in a clean bench to a tube containing 10 mL of heated culture medium.
[0235] 3) After centrifuging at 100×g at room temperature for 3 minutes, remove the supernatant.
[0236] 4) Add 10 mL of fresh culture medium, mix gently, and add 0.13 μg / cm. 2 After adding iMatrix-511silk to the cell suspension, the cells were seeded in 10cm petri dishes and cultured in a 37℃, 5% CO2 incubator.
[0237] iPS cell passage
[0238] 1) Observe the state of the cells using a phase contrast microscope and determine the split ratio for passage between 1:12 and 1:20.
[0239] 2) Collect the supernatant of the culture medium into a tube. After washing with PBS(-), add the stripping buffer and react in a 37°C, 5% CO2 incubator for about 5 minutes.
[0240] 3) After the reaction, tilt the plate to peel off the cells and use the pre-recovered supernatant to recover the cells into the tube.
[0241] 4) After centrifuging at 100×g for 3 minutes at room temperature, remove the supernatant.
[0242] 5) Add 10 mL of fresh culture medium, mix gently, and add 0.13 μg / cm. 2 After adding iMatrix-511silk to the cell suspension, the cells were seeded in 10cm petri dishes and cultured in a 37℃, 5% CO2 incubator.
[0243] <Methods for Inducing Myocardial Differentiation>
[0244] A summary of the experimental schedule is shown below. Figure 1 The differentiation of iPS cells into cardiomyocytes was induced using the protein-free cardiomyocyte differentiation induction (PFCD) method.
[0245] Day 0: After removing approximately 50% confluence of iPS cells with a stripping buffer, centrifuge at 100×g for 3 minutes at room temperature. Remove the supernatant, resuspend the cells in fresh culture medium, and seed them into untreated 55cm cells. 2 Petri dishes were incubated at 37°C in a 5% CO2 incubator for 4 hours. Afterward, the cells were collected into tubes and replaced with myocardial differentiation induction medium supplemented with low molecular weight compound A. The culture was then incubated at 2 × 10⁻⁶ cells / mL. 5 Cells were seeded into 24-well plates of the examples or comparative examples and cultured in an incubator at 37°C and 5% CO2. Experiments were performed in triplicate.
[0246] Day 3: Replace the culture medium with myocardial differentiation induction medium containing low molecular weight compound group B.
[0247] Day 5: Replace the culture medium with myocardial differentiation induction medium containing low molecular weight compound group B.
[0248] After day 7: Replace the culture medium with myocardial differentiation induction medium every 3-4 days. It should be noted that when replacing the culture medium on days 3 and 7 of differentiation induction, replace the entire well.
[0249] <Single-cell formation of cell clusters (sampling on day 12 and day 19 of differentiation induction)>
[0250] 1) Collect the cell clusters (considered to be myocardial clusters) into the tube. After the cell clusters settle naturally, remove the supernatant.
[0251] 2) Add 1 mL of single-cell solution, heat in a 37°C water bath for about 30 minutes, and stir until the cell cluster becomes a single cell.
[0252] 3) Dilute with 3 mL of PBS (-) to stop the reaction.
[0253] 4) Perform cell counting on the cell suspension for FACS or RNA extraction as described later.
[0254] <Preparation of FACS Samples>
[0255] 1×10 6 Single-celled cells were transferred to tubes and centrifuged at 300×g for 5 minutes at room temperature. The supernatant was removed, and the cells were resuspended in 1 mL of PBS(-). Formaldehyde (Fujifilm and photopurified reagent) was added to the cell suspension to a final concentration of 4%, and the suspension was allowed to stand at room temperature for 5 minutes. After centrifugation at 300×g for 3 minutes at room temperature, the supernatant was removed, and 1 mL of saponin solution was added for resuscitation. 0.7 mL (sample) and 0.3 mL (negative control) were injected into two tubes, one for the sample and the other for the negative control. After centrifugation again to remove the supernatant, 0.5 mL of a 1:1000 saponin solution containing anti-Troponin TC (CT3) antibody as the primary antibody was added to the sample. For the negative control, 0.5 mL of saponin solution without antibody was added to resuspend the cells, and the antibody reaction was allowed to occur overnight at 4°C. The next day, the primary antibody was removed, and 0.5 mL of a saponin solution containing the secondary antibody anti-Mouse IgG (H+L) Alexa Fluor 647 at a 1:500 ratio was added. The solution was incubated in the dark at room temperature for 1 hour. After 1 hour, the saponin solution containing the secondary antibody was replaced with 0.5 mL of PBS(-), and the reaction was performed using FACS (Accuracy). TM The analysis was performed using CS6 Plus (manufactured by BD).
[0256] <RNA extraction and RT-qPCR>
[0257] Troponin (a cardiomyocyte-specific gene), MYL2 (a ventricular myocardium-specific gene, which is a type of cardiomyocyte), and MYL7 (atrial myocardium-specific gene, which is a type of cardiomyocyte) were used as the subjects of analysis.
[0258] (1) Reagents and equipment for RNA extraction: miRNeasy Mini Kit (product number 217004, manufactured by QIAGEN)
[0259] cDNA synthesis: ReverTra Ace(R) qPCR RT Master Mix with gDNA Remover (Product No. FSQ-301, manufactured by TOYOBO).
[0260] qPCR reaction: PowerUp SYBR Green Master Mix (Product No. A25776, manufactured by Thermo Fisher Scientific)
[0261] QuantStudio 6Flex Real-time PCR system (manufactured by Thermo Fisher Scientific)
[0262] Nanophotometer C40 (manufactured by WakenBtech Co., Ltd.)
[0263] (2) RNA extraction
[0264] On days 12 and 19 of induction of cardiomyocyte differentiation, after removing the culture supernatant, 0.5 mL of QIAZOL (QIAGEN) was added to suspend and lyse the cells. The lysate was then collected in 1.5 mL tubes. Subsequently, RNA was extracted according to the procedures included with the miRNeasy Mini Kit, and the RNA concentration was measured using a Nanophotometer C40.
[0265] (3) RT-qPCR
[0266] Using 1 μg of the extracted RNA, reverse transcription was performed according to the operating procedure included with the PowerUp SYBR Green Master Mix to synthesize cDNA. Then, 6 ng of cDNA was used for qPCR using standard methods. The standard curve was prepared by collecting 10 μL of each 10 ng / μL cDNA sample, diluting it 1 / 10, and creating 5 spots.
[0267] <Evaluation of myocardial-specific gene expression>
[0268] RNA extracted from cells on days 12 and 19 of differentiation induction was used to analyze gene expression levels using the QuantStudio 6Flex Real-time PCR system. The sequences of the primers used are shown in Table 2, and the PCR conditions are shown in Table 3. Gene expression levels are expressed as relative values with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene expression set to 1. The results are shown in Table 4.
[0269] <Evaluation of cell number>
[0270] After the cell clusters on day 12 and day 19 of differentiation induction were unicellularized, viable cell counts were performed by trypan blue staining (Bio-Rad) (using a TC20 fully automated cell counter, Bio-Rad).
[0271] Cell viability (%) (number of viable cells at measurement / total number of cells at measurement × 100) and cell proliferation rate (%) (number of viable cells at measurement / number of cells at the start of cell seeding (cell culture) × 100) were calculated from the measured values obtained above. The results are shown in Table 4.
[0272] <Evaluation of Myocardial Purity>
[0273] After the cell clusters on days 12 and 19 of differentiation induction were unicellularized, the cTnT positivity rate (number of cTnT-positive cells / total number of cells constituting the cell clusters × 100) was calculated using FACS and used as the myocardial purity (%). The results are shown in Table 4.
[0274] <Evaluation of Pulse Rate>
[0275] Videos of cells on day 19 of differentiation induction were captured, and the BPM (beats per minute) of any spheroid was calculated. The results are shown in Table 4.
[0276] [Table 1]
[0277]
[0278] [Table 2]
[0279] GAPDH Fw ATTGCCCTCAACGACCACTTTG 1 Rv TCTTCCTCTTGTGCTCTTGCTG 2 MYL2 Fw AGGCTCCGGGTCCAATTAAC 3 Rv TTGCCTTCAGGGTCAAACAC 4 MYL7 Fw TCAGCTGTATCGACCAGAATCG 5 Rv AGGAAGACGGTGAAGTTGATGG 6
[0280] [Table 3]
[0281]
[0282]
[0283] [Table 4]
[0284]
[0285] <Morphological Observation>
[0286] Phase-contrast microscopy was used to observe the formation of spheroids in individual cells. The results are presented below. Figure 2 , 3 .
[0287] <Results>
[0288] On day 12 of differentiation induction, the cell proliferation rate was higher in Examples 1 and 2 than in Comparative Examples 1 and 2 due to the higher oxygen permeability at the culture bottom, especially at a culture depth of 10 mm. The same trend was observed on day 19. Furthermore, the myocardial purity of Examples 1 and 2 was also higher than that of Comparative Examples 1 and 2 on days 12 and 19 of differentiation induction. Further comparison of the expression of myocardial-specific genes Troponin, MYL2, and MYL7 showed that, for all genes, the expression levels in Examples 1 and 2 were higher than in Comparative Examples 1 and 2, especially at a culture depth of 10 mm. On day 19 of differentiation induction, the pulsatility of Examples 1 and 2 was higher than that of Comparative Examples 1 and 2, and the pulsatility was higher at a culture depth of 10 mm than at 5 mm. In addition, morphological observations showed that Examples 1 and 2 formed multiple spherical bodies of more uniform size and shape than those in Comparative Examples 1 and 2. This also indicates that, compared to Comparative Examples 1 and 2, iPS cells differentiated into cardiomyocytes more efficiently in Examples 1 and 2.
[0289] [Example 3] Culture of human bone tumor-derived cancer cells (HOF-143B)
[0290] Using the culture container prepared in Manufacturing Example 2, human bone tumor-derived cancer cells (HOF-143B) were cultured by the method described later to form spheroids.
[0291] [Comparative Example 3]
[0292] Commercially available TCPS culture containers with a culture surface thickness of 1000 μm (16 mm inner diameter, 24-well plate, Corning Incorporated, polystyrene (PS)) were used, and the culture was otherwise carried out using the same method as in Example 3.
[0293] [Comparative Example 4]
[0294] As a high oxygen permeability container, a commercially available PDMS (polydimethylsiloxane) culture container with a culture component thickness of 350 μm was used (inner diameter of the culture surface 15 mm, 24-well plate, product name G-plate, manufactured by VECELL, model V24WGPB). Otherwise, the culture was carried out by the same method as in Example 3.
[0295] Culture of human bone tumor-derived cancer cells (HOF-143B)
[0296] <Cell Seeding>
[0297] Culture medium was added to centrifuge tubes (50 ml) containing a cell suspension of human bone tumor-derived cancer cells. The culture medium was prepared by adding 5 mL of fetal bovine serum (FBS, Fujifilm and Kodenori), 0.5 mL of 200 mM L-glutamine solution (Fujifilm and Kodenori), 0.05 mL of 1.5 mg / mL bromo-deoxyuridine (BUdR), 0.5 mL of non-essential amino acids (Fujifilm and Kodenori), and 43.95 mL of E-MEM medium (containing 10 mg / mL phenol red and 2200 mg / mL sodium bicarbonate, for culture, Fujifilm and Kodenori). Cell density was adjusted by varying the number of cells in the cell suspension containing human bone tumor-derived cancer cells to achieve a cell density of 1.0 × 10⁻⁶ cells per well. 4 cells / cm 2 Cell suspensions are prepared in a manner that allows for their preparation.
[0298] <Cell Culture>
[0299] Cell suspensions containing human bone tumor-derived cancer cells were seeded onto the culture surface using a micropipette and placed in an incubator at 37°C and 5% CO2. Culture was continued for 7 days. The culture medium was replaced on days 3 and 6 post-seeding. The medium replacement was performed as follows: the culture vessel was allowed to stand until the cells had fully settled, the supernatant was removed, and the removed portion of culture medium was added back.
[0300] <Morphological Observation and Evaluation>
[0301] On day 7 of culture, cell morphology was observed using a phase-contrast microscope and evaluated according to the following criteria.
[0302] A: It formed a spherical shape.
[0303] B: Cell adhesion, no spheroids formed.
[0304] The results of observation in Example 3 are shown below. Figure 4 Furthermore, the evaluation results are shown in Table 5.
[0305] [Table 5]
[0306] Material of the bottom of the container TPX TCPS PDMS Thickness of the container bottom (mm) 0.05 1 0.35 Morphological evaluation A B B
[0307] <Results>
[0308] In Comparative Examples 3 and 4, the cells adhered to the culture container and did not form spheroids, while in Example 3, the cells formed spheroids.
[0309] Industrial availability
[0310] Based on the above results, it is evident that using the culture component of the present invention enables the formation of spherical bodies of cells that maintain normal function. Furthermore, it is also evident that using the culture component of the present invention allows iPS cells to differentiate efficiently into cardiomyocytes. That is, the culture component of the present invention readily forms spherical bodies and also readily induces the differentiation of pluripotent stem cells. Therefore, the culture component of the present invention is also suitable for use in new drug development and screening, diagnostic applications, and regenerative medicine applications. sequence list <110> Mitsui CHEMICALS, INC. <120> Cultivation components and their uses <130> 2021P00553WO0 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> GAPDH Fw <400> 1 attgccctca acgaccactt tg 22 <210> 2 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> GAPDH Rv <400> 2 tcttcctctt gtgctcttgc tg 22 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <220> <223> MYL2 Fw <400> 3 aggctccggg tccaattaac 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <220> <223> MYL2 Rv <400> 4 ttgccttcag ggtcaaacac 20 <210> 5 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> MYL7 Fw <400> 5 tcagctgtat cgaccagaat cg 22 <210> 6 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> MYL7 Rv <400> 6 aggaagacgg tgaagttgat gg 22
Claims
1. The application of a culture component as a culture surface in a culture apparatus, said culture apparatus having a culture surface formed by said culture component, said culture surface being used for culturing cells, tissues or organs. The culture apparatus is a culture tray with at least one well. The well has a culture bottom surface for holding the culture medium. At least the culture bottom surface is formed by the membrane-like or sheet-like culture member and constitutes the culture surface. The culture component contains a 4-methyl-1-pentene polymer (X), the water contact angle of the culture surface is greater than 100° and less than 160°, and the oxygen permeability at 23°C and 0% humidity is 4500~90000 cm⁻¹. 3 / (m 2 (×24h×atm), The 4-methyl-1-pentene polymer (X) is a copolymer (x1) of 4-methyl-1-pentene and at least one olefin selected from ethylene and α-olefins having 3 to 20 carbon atoms, wherein, The α-olefins with 3 to 20 carbon atoms do not include 4-methyl-1-pentene. When the total amount of all repeating constituent units in the 4-methyl-1-pentene polymer (X) is set to 100 mol%, the content of constituent units derived from 4-methyl-1-pentene is 80-98 mol%, and the content of constituent units derived from at least one olefin selected from ethylene and α-olefins with 3-20 carbon atoms is 2-20 mol%, wherein the α-olefins with 3-20 carbon atoms do not include 4-methyl-1-pentene. Of 100% by mass the culture component, there are 99% by mass and less than 100% by mass of the 4-methyl-1-pentene polymer (X). The culture surface was not processed to form an uneven structure. The culture surface is not coated with natural polymer materials, synthetic polymer materials, or inorganic materials.
2. The application according to claim 1, wherein the culture member is used to form spherical bodies.
3. The application according to claim 1 or 2, wherein the cell, tissue or organ contains differentiated cells derived from iPS cells.
4. The application according to claim 1 or 2, wherein the cell, tissue or organ contains cardiomyocytes.
5. The application according to claim 1 or 2, wherein the cell, tissue or organ is a pluripotent stem cell or a differentiated cell derived from a pluripotent stem cell.
6. A method for culturing cells, tissues, or organs, comprising: The step (A) of bringing cells, tissues, or organs into contact with the culture surface of the culture member or culture apparatus described in any one of claims 1-5; and Step (B) involves culturing cells, tissues, or organs in contact with the culture surface to form spheroids.
7. The method for culturing cells, tissues or organs according to claim 6, further comprising a step (C) of inducing the differentiation of said cells, tissues or organs, wherein step (C) is a step of inducing iPS cells to differentiate into cardiomyocytes by a protein-free myocardial differentiation induction PFCD method.
8. The method for culturing cells, tissues, or organs according to claim 6 or 7, which increases the purity of myocardium.
9. A spherical body formed by the culture method according to any one of claims 6 to 8.
Citation Information
Patent Citations
Method for producing cell-culturing container and cell culturing container
JP2008061609A
Surface protective film, and method of manufacturing semiconductor device using the same
JP2013169685A
Adhesive cell culturing substrate, and cell culture vessel and cell culture method using the same
JP2017077241A
Transmission circuit for transmitting signals
US11451147B2
Solid titanium catalyst component, catalyst for olefin polymerization, and process for producing olefin polymer
WO2006054613A1