Chitosanase mutants producing chitotetraose and use thereof

Abstract

The present application belongs to the technical field of enzyme engineering, and particularly relates to a chitosanase mutant for producing chitotetraose. The chitosanase is derived from a 46 family glycoside hydrolase chitosanase (BsCsn46A) of Bacillus subtilis. The chitosanase BsCsn46A with an amino acid sequence shown in SEQ ID NO:1 is used as a starting enzyme. The substrate channel of the chitosanase is analyzed by computer-aided simulation, and the BsCsn46A is subjected to molecular docking with a substrate to determine amino acid sites that may have an influence on the polymerization degree of the chitosanase hydrolysis product. The amino acid sites are subjected to site-directed mutation to be mutated into an acidic amino acid E (glutamic acid) and a basic amino acid K (lysine) respectively. Two chitosanase mutants T50E and E203K are obtained. Compared with the original enzyme, the mutant enzyme hydrolyzes chitosan to generate chitotetraose (COS4) in addition to COS2 and COS3.

Description

Technical Field

[0001] This invention belongs to the field of enzyme engineering technology, and specifically relates to a chitosanase mutant that produces chitosan tetrasaccharides and its applications. Background Technology

[0002] Chitosan is the only naturally occurring alkaline polysaccharide. It has a linear structure formed by β-1,4-glycosidic bonds linking glucosamine, and is mainly formed from the deacetylation of chitin in shrimp and crab shells through alkaline treatment. Chitosan is extremely abundant in nature, second only to cellulose. Studies have found that chitosan possesses excellent biological activities such as antibacterial, antitumor, and immune-enhancing properties, thus showing broad application prospects in food, medicine, agriculture, and cosmetics. However, due to the limited absorption capacity of biological macromolecules by the human body, chitosan is difficult to utilize effectively. Some reports indicate that chitosan, after being degraded into chitosan oligosaccharides, exhibits more significant antibacterial effects and is more easily absorbed by the human body. Therefore, obtaining low-polymerization-degree chitosan oligosaccharides has become a research hotspot in recent years.

[0003] There are three main methods for producing chitosan oligosaccharides: chemical, physical, and enzymatic methods. Chemical and physical methods are common industrial techniques, but considering product purity, production costs, environmental pollution, and subsequent purification issues, enzymatic hydrolysis is usually used to degrade chitosan. Compared to the first two methods, enzymatic hydrolysis of chitosan has high specificity, mild reaction conditions, and is easy to prepare, making it a safer and more mature production method.

[0004] Chitosanase is a glycoside hydrolase specifically designed to degrade chitosan into chitosan oligosaccharides. It typically breaks the β-1,4-glycosidic bonds in the chitosan molecule via endo-cleavage. Since Shimosaka's first discovery of chitosanase in 1973, reported chitosanases have been classified into seven families based on their amino acid sequences: GH3, GH5, GH7, GH8, GH46, GH75, and GH80. Although several glycoside hydrolases can hydrolyze chitosan to produce chitosan oligosaccharides, the GH46 family of chitosanases has been the most extensively and thoroughly studied due to its significantly higher catalytic activity compared to other families. Most GH46 family chitosanases are produced by bacterial fermentation, and the products of their hydrolysis are primarily chitobiose and chitotriose. Studies have reported that chitosan oligosaccharides exhibit maximum antibacterial properties when the degree of polymerization is between 4 and 8. Current research reports on chitosanase mainly focus on improving the enzyme's catalytic activity and stability to adapt it for industrial applications, while research reports on the preparation of chitosan oligosaccharides with specific degrees of polymerization are relatively rare. To enhance the application value of chitosan oligosaccharides produced by chitosanase hydrolysis, this invention aims to obtain a chitosanase mutant capable of degrading chitosan to obtain chitosan oligosaccharides with a degree of polymerization of 4 or higher. Summary of the Invention

[0005] The purpose of this invention is to provide a chitosanase mutant that produces chitosan tetrasaccharides and its applications.

[0006] The Bacillus subtilis chitosanase involved in this invention is a wild-type chitosanase (BsCsn46A) previously cloned in the laboratory, with its amino acid sequence being SEQ ID NO: 1 and its gene sequence being SEQ ID NO: 2.

[0007] This invention screens sites that have potential impact on product formation through substrate channel simulation and molecular docking, and then mutates them. The 50th threonine in the amino acid sequence of chitosanase BsCsn46A is mutated to glutamic acid (T50E), and the 203rd glutamic acid is mutated to lysine (E203K). The results were then expressed in E. coli BL21 (DE3).

[0008] The amino acid sequence of the chitosanase mutant T50E is SEQ ID NO: 3, and the encoded nucleotide sequence is SEQ ID NO: 4; the amino acid sequence of the chitosanase mutant E203K is SEQ ID NO: 5, and the encoded nucleotide sequence is SEQ ID NO: 6.

[0009] A recombinant vector carrying the gene encoding the chitosanase mutant described above.

[0010] A recombinant bacterium comprising the aforementioned recombinant vector.

[0011] The present invention further provides the application of the above-mentioned chitosanase mutant in the degradation of chitosan, specifically, for the degradation of chitosan to generate chitobiose (COS2), chitotriose (COS3), and chitotetraose (COS4).

[0012] Compared with wild-type chitosanase, the chitosanase mutant provided by this invention generates chitobiose COS2 and chitotriose COS3, as well as chitotetraose COS4, during the enzymatic hydrolysis of chitosan. Attached Figure Description

[0013] Figure 1 This is a thin-layer chromatogram of the chitosan degradation products of wild-type chitosanase and its mutants in the embodiments of the present invention. Detailed Implementation

[0014] The present invention will now be described in detail with reference to the embodiments. These embodiments are only used to more clearly illustrate the technical solutions of the present invention and should not be construed as limiting the scope of protection of the present invention.

[0015] Example 1

[0016] In this invention, the gene sequence of BsCsn46A (SEQ ID NO: 2) was cloned into plasmid pET-28a to construct the recombinant plasmid pET-BsCsn46A, with the upstream primer CG. GGATCC GCGGGACTGAATAAAGATC, downstream primer CCC AAGCTT TTAAGGGATTACAAAATTACC; The spatial structure of chitosanase (BsCsn46A) was obtained by simulating it using Swiss-Model online software; the sites that may affect the degree of polymerization of enzyme hydrolysis products were found through substrate channel simulation and molecular docking. In this invention, the 50 and 203 sites were mutated to acidic amino acid E or basic amino acid K, respectively, to obtain chitosanase mutants T50E, T50K, and E203K.

[0017] Design site-directed mutagenesis primers, obtain the mutant chitosanase gene through PCR technology, clone the amplified target gene into the expression vector pET-28a, and construct the recombinant plasmid.

[0018] The primer sequences are as follows:

[0019] Primer name Primer uses Primers (5'-3') bscsnF BsCsn46A <![CDATA[CGGTAATTTTGTAATC CCT TAAAAGCTTGCGGCC]]> bscsnR BsCsn46A <![CDATA[GGCCGCAAGCTTTTA AGG GATTACAAAATTACCG]]> T50EF T50E <![CDATA[CAGGCTTTACAACGGCT GAA GGGGATGCATTGGAAG]]> T50ER T50E <![CDATA[CTTCCAATGCATCCCC TTC AGCCGTTGTAAAAGCCTG]]> T50KF T50K <![CDATA[CAGGCTTTACAACGGCT AAA GGGGATGCATTGGAAG]]> T50KR T50K <![CDATA[CTTCCAATGCATCCCC TTT AGCCGTTGTAAAAGCCTG]]> E203KF E203K <![CDATA[CATGACACCCGTGAC AAA TGGAGAGAATCAG]]> E203KR E203K <![CDATA[CTGATTCTCTCCA TTT GTCACGGGTGTCATG]]>

[0020] PCR system:

[0021] Reagent Name Volume (μL) template 1 PCR Buffer 5 dNTP 1 Upstream and downstream primers 1 PfuDNA polymerase 1.2 <![CDATA[ddH2O]]> 39.8 Total volume 50

[0022] The template is shown in SEQ ID NO: 2. PCR amplification conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 64℃ annealing for 1 min, 68℃ extension for 10 min, 15 cycles, incubation at 4℃.

[0023] The obtained recombinant plasmid was digested with DpnI restriction endonuclease. 10 μL of the digestion product was directly transformed into E. coli DH5α competent cells. The recombinant cells carrying the mutant plasmid were then sent to Shanghai Bioengineering Co., Ltd. for sequencing.

[0024] The correctly sequenced mutant plasmid was transformed into E. coli BL21(DE3) for induction culture. After centrifugation, the bacterial cells were collected, and after sonication to disrupt the cells, the mutant chitosanase was obtained by protein purification using a Ni-NTA affinity chromatography column.

[0025] The specific steps for protein purification are as follows: Take 1 mL of activated bacterial culture and transfer it into an Erlenmeyer flask containing 50 mL of LB liquid medium. Add 25 μL of 50 mg / L kanamycin to the medium and incubate in a constant temperature shaking incubator at 37 °C and 160 r / min for 3 hours. After 3 hours, an inducer (IPTG) at a final concentration of 1 μmol / L was added to the bacterial culture to induce bacterial protein production. The culture was then incubated overnight in a constant temperature shaking incubator at 16 °C and 160 r / min. The expanded bacterial culture was then transferred to a 50 mL centrifuge tube and centrifuged at 8000 rpm for 5 min in a refrigerated centrifuge. The supernatant was discarded, and the bacterial cells precipitated at the bottom of the centrifuge tube were collected. 5 mL of M0 (0.02 M Tris-HCl, pH 8.0, 0.5 M NaCl, 10% glycerol) was added, and the bacteria that were originally aliquoted into two tubes were combined into one tube. The tube was then centrifuged at 8000 rpm for 5 min, the supernatant was discarded again, and 5 mL of M0 was added to resuspend the bacteria. The crude enzyme solution obtained by sonicating cells was loaded onto a Ni-NTA affinity chromatography column and eluted with 0.02 M imidazole elution buffer (0.02 M Tris-HCl, pH 8.0, 0.5 M NaCl, 0.02 M imidazole and 10% glycerol). Then, it was eluted again with 0.08 M imidazole elution buffer (0.02 M Tris-HCl, pH 8.0, 0.5 M NaCl, 0.08 M imidazole and 10% glycerol). The eluent containing chitosanase activity was collected, and the imidazole was removed by dialysis. The obtained mutant enzyme was stored at -20°C.

[0026] Example 2

[0027] Chitosanase mutants T50E, T50K, and E203K are used to hydrolyze chitosan.

[0028] Weigh 1 g of chitosan powder, dissolve the chitosan powder in a 0.5% (v / v) hydrochloric acid solution, and adjust the pH of the chitosan solution to 5.5 with NaOH to obtain a 1% colloidal chitosan solution.

[0029] Add 450 μL of 1% colloidal chitosan solution, 50 μL of purified enzyme solution, 500 μL of pH buffer, and 18 μL of 100 mM Mn to a 1 mL reaction system. 2+ After reacting in a shaker at 28 ℃ for 24 h, the mixture was removed and the reaction was terminated by boiling in a water bath for 10 min.

[0030] The purified enzyme solutions were wild-type chitosanase BsCsn46A, chitosanase mutants T50E, T50K, and E203K, respectively.

[0031] Product Analysis: Spotting was performed approximately 1 cm from the bottom of the thin-layer plate. Glucosamine (DP1), chitobiose (DP2), chitotriose (DP3), chitotetraose (DP4), and chitopentose (DP5) were used as mixed standards. The spotted thin-layer plate was placed in a chromatography tank with the developing solvent added, ensuring the bottom of the plate was immersed in the solvent. After the developing solvent completely wetted the top of the thin-layer plate, it was removed and dried with a hairdryer until no ammonia odor remained. A colorimetric reagent was then sprayed evenly onto the plate, which was then placed in a pre-prepared 120℃ oven for 10 minutes to allow colored spots to appear. The experimental results were analyzed by comparing the positions with the standard samples. Thin-layer chromatography results showed that the hydrolysis products of wild-type chitosanase BsCsn46A and chitosanase mutant T50K were chitobiose and chitotriose; while the hydrolysis products of chitosanase mutants T50E and E203K were chitobiose, chitotriose and chitotetraose.

[0032] from Figure 1 It is evident that the two mutants T50E and E203K provided by this invention, compared with the original enzyme, exhibit the generation of a new chitosan oligosaccharide COS4 in their hydrolysis products, demonstrating potential for industrial application.

Claims

1. A chitosanase mutant, characterized in that, The chitosanase mutant is formed by mutating threonine at position 50 of the amino acid sequence of Bacillus subtilis chitosanase BsCsn46A to glutamic acid, as shown in SEQ ID NO:3; or by mutating glutamic acid at position 203 to lysine, as shown in SEQ ID NO:5; the amino acid sequence of Bacillus subtilis chitosanase BsCsn46A is shown in SEQ ID NO:

1.

2. The gene encoding the chitosanase mutant of claim 1, characterized in that, The gene sequence encoding the chitosanase mutant as shown in SEQ ID NO:3 is shown in SEQ ID NO:4; the gene sequence encoding the chitosanase mutant as shown in SEQ ID NO:5 is shown in SEQ ID NO:

6.

3. A recombinant expression vector, characterized in that, The recombinant expression vector comprises one of the genes described in claim 2.

4. A recombinant bacterium, characterized in that, The recombinant bacteria comprises the recombinant expression vector according to claim 3.

5. The application of the chitosanase mutant as described in claim 1 in the degradation of chitosan into chitobiose, chitotriose and chitotetraose.

Images