Application of oswrky14 gene in regulating synthesis of sakuranetin in rice

Abstract

The application discloses application of an OsWRKY14 gene in regulating synthesis of sakuranetin in rice. When the OsWRKY14 gene is overexpressed, the content of the sakuranetin is increased; when the OsWRKY14 gene is silenced, the content of the sakuranetin is decreased. The OsWRKY14 gene is a key transcription factor upstream of a sakuranetin synthesis gene OsNOMT, and realizes improvement of the rice resistance to bacterial leaf blight.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to the application of the OsWRKY14 gene in regulating the synthesis of xanthomonas oryzaepv. Oryzae, Xoo, especially in the development of resistance to bacterial blight (Xanthomonas oryzaepv. Oryzae, Xoo). Background Technology

[0002] Rice is one of the world's most important food crops. Breeding rice varieties with high yield, high quality, and stress resistance are crucial for ensuring high and stable rice yields and for storing superior genetic resources. Rice bacterial blight is caused by *Xanthomonas oryzae*, a pathogenic species of which is characterized by its sudden onset and rapid spread. When it occurs, it can cause yield reductions of 20% to 50%, posing a significant threat to rice production. The disease primarily affects the leaf sheaths and leaves, mostly during the booting and heading stages, delaying heading, reducing panicle size, and decreasing the number of grains. Infected plants secrete the pathogen, which spreads widely via dew, insects, irrigation water, and wind and rain. Bacterial blight severely damages rice yields; therefore, the most environmentally friendly and economical way to combat this disease is to breed and plant disease-resistant varieties.

[0003] Phytoprotective agents are secondary metabolites accumulated in plants after exposure to external stimuli or infection by pathogens. They play a crucial role in resisting biotic and abiotic stresses and are closely related to the stress resistance of rice. Research on rice phytoprotective agents has attracted widespread attention. Chlorophytin is the most important flavonoid phytoprotective agent in rice. Previous studies have shown that infection by *Magnaporthe oryzae*, ultraviolet irradiation, CuCl2, and hormones such as jasmonic acid can induce the accumulation of chlorophytin in rice leaves, and exogenous application of chlorophytin can enhance rice resistance to rice blast. Currently, the biosynthesis of chlorophytin is relatively well understood. Chlorophytin is a branch of the flavonoid synthesis pathway, and its synthases include the common chalcone synthase (CHS) and chalcone isomerase (CHI), as well as its unique key synthase 7-O-formyltransferase (NOMT). However, research on the transcriptional regulatory molecular mechanisms of chlorophytin synthesis is limited.

[0004] When rice is subjected to biotic stress, a large number of WRKY transcription factors are activated by MAPKs, playing a functional role in the plant's resistance to pathogens. After activation, WRKY transcription factors further activate the synthesis of plant secondary metabolites, thereby resisting external damage. For example, Botrytis cinerea infection can cause phosphorylated WRKY33 to directly bind to the promoter regions of the structural genes CYP71A13 and PAD3 in the phytoalexin pathway, transcribed and activating the expression of these genes, thus positively regulating the biosynthesis of camalexin in Arabidopsis thaliana and affecting resistance to Botrytis cinerea. WRKY33 can also positively regulate the synthesis of the plant secondary metabolite glucosinolates, thereby improving the resistance of Chinese kale to black spot disease caused by Alternaria brassicae.

[0005] This invention proposes that OsWRKY14 is a key transcription factor upstream of the sakurain synthesis gene OsNOMT, and experimental genetic materials demonstrate that OsWRKY14 positively regulates sakurain synthesis, affecting rice resistance to bacterial blight. This invention not only helps to enrich the metabolic regulatory network of sakurain in rice, but also provides a theoretical basis and technical support for increasing the sakurain content in rice and its resistance to bacterial blight. Summary of the Invention

[0006] The first objective of this invention is to address the shortcomings of existing technologies by providing an application of the OsWRKY14 gene in regulating the synthesis of safflower extract in rice.

[0007] A gene, OsWRKY14, that regulates the biosynthesis of safflowerin in rice has the nucleotide sequence shown in SEQ ID NO: 1 and the protein sequence shown in SEQ ID NO: 2.

[0008] The present invention also provides plasmids containing the above-mentioned genes and plant expression vectors containing the above-mentioned genes, including the gene overexpression vector 35Spro::OsWRKY14-GFP.

[0009] The present invention also provides a host cell, which is an Escherichia coli cell or an Agrobacterium cell.

[0010] As a preferred approach, overexpression of OsWRKY14 increases the content of sakurain; conversely, silencing the OsWRKY14 gene decreases the content of sakurain.

[0011] The second objective of this invention is to provide the application of the OsWRKY14 gene in improving rice resistance to bacterial blight.

[0012] The third objective of this invention is to provide a transgenic rice obtained by overexpressing the OsWRKY14 gene in rice.

[0013] The research of this invention shows that the resistance gene derived from rice—transcription factor OsWRKY14—plays an important role in combating bacterial blight by regulating the synthesis of cherry blossom extract.

[0014] This invention constructs rice by cloning, transgenic technology and gene silencing of the OsWRKY14 gene, which has great application prospects in improving the content of safflower syringin in rice and its resistance to bacterial blight.

[0015] In summary, this invention is the first to construct rice OsWRKY14 gene-silenced plants and overexpression materials, and to study the regulation of chrysophanol and its function in bacterial blight resistance. Through bacterial blight inoculation experiments, it was found that OsWRKY14 positively regulates chrysophanol synthesis, affecting rice resistance to bacterial blight. Attached Figure Description

[0016] To make the objectives, technical solutions, and advantages of the present invention clearer, the specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0017] Figure 1 It is the base change site of the OsWRKY14 gene CRISPR / CAS9 material;

[0018] Among them, CR-Oswrky14#3 and CR-Oswrky14#5 are two different gene silencing lines of the OsWRKY14 gene using CRISPR / CAS9. CR-Oswrky14#3 has an insertion of a C base compared to the wild type, while CR-Oswrky14#5 has a deletion of a C base compared to the wild type.

[0019] Figure 2 The phenotypes of rice materials overexpressing and lacking OsWRKY14 are those of plants at 7 days old.

[0020] Among them, ZH11 is the wild-type control, CR-Oswrky14#3 and CR-Oswrky14#5 are two lines with silenced OsWRKY14 gene, and OsWRKY14-OE#4 and OsWRKY14-OE#8 are two lines with overexpression of OsWRKY14 gene.

[0021] Figure 3 This refers to the phenotype of rice seeds with OsWRKY14 gene overexpression and deletion.

[0022] Figure 4 The data included the resistance phenotypes, bacterial spot length statistics, and cherry blossom extract content of rice materials with OsWRKY14 gene overexpression and deletion to bacterial blight. Detailed Implementation

[0023] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0024] I. Cloning the full-length sequence of the rice OsWRKY14 gene:

[0025] Primers for whole-genome amplification were designed using the NCBI primer design tool, with the CDS sequence LOC_Os01g53040.1 of rice (Oryza sativa) from the rice database (https: / / shigen.nig.ac.jp / rice / oryzabase / tool / riceIdChecker / list) as a reference. CDNA from rice ZH11 grown in the culture room of the Zhejiang Academy of Agricultural Sciences was used as a template (cDNA extraction was performed using standard techniques, such as CN 104561025 A). Specific primers were designed, and the OsWRKY14 fragment was amplified using PrimerSTAR high-fidelity enzyme PCR. The primer sequences are as follows:

[0026] pRHVcGFP-OsWRKY14-BamHI-F:

[0027] TATCCAGATCCAGTGGGATCCATGGACGGCGAGTGGAGC, see SEQ ID NO: 3

[0028] pRHVcGFP-OsWRKY14-SacI-R:

[0029] AGTAAGCTTGGTACCGAGTCCTGTCATGGCCGTGCTCTCC, see SEQ ID NO: 4

[0030] PCR amplification reaction system: 25 μL of 2x PrimerSTAR buffer, 5 μL of dNTP Mixture, 1 μL of PrimerSTAR DNA polymerase, 16 μL of ddH2O, 1 μL of cDNA, and 1 μL each of forward and reverse primers, totaling 50 μL. The PCR reaction program was: 94℃ pre-denaturation for 90 seconds; 94℃ denaturation for 30 seconds, 57℃ annealing for 45 seconds, 72℃ extension for 1 minute and 30 seconds, for 35 cycles; and a final extension at 72℃ for 5 minutes. The obtained PCR products were identified by 1% agarose gel electrophoresis, and the amplified bands were then recovered and purified using an Axygen DNA gel electrophoresis kit. The recovered product was constructed into the pRHVcGFP vector, and the recombinant plasmid was sent to a sequencing facility for confirmation.

[0031] The nucleotide sequence of the obtained gene OsWRKY14 is shown in SEQ ID NO: 1.

[0032] II. Construction of OsWRKY14 gene overexpression vector

[0033] Construction of the OsWRKY14 overexpression vector: Using pRHVcGFP as the final vector, a 35Spro:OsWRKY14 vector with the CaMV35S recombinant overexpression promoter was constructed. The OsWRKY14 fragment amplified in the first step and the pRHVcGFP vector were digested with BamHI and SacI (37℃, 1 hour), followed by homologous recombinase digestion. II. Using the One Step Cloning Kit (Vazyme), the fragment was ligated into the enzyme-digested pRHVcGFP after an incubation period of 30 minutes at 37°C to obtain the recombinant plasmid 35Spro::OsWRKY14-GFP.

[0034] After the reaction, the 35Spro::OsWRKY14-GFP plasmid was transformed into competent DH5α cells of *E. coli*. Selection was performed using kanamycin-resistant LB agar, and colony PCR was used to identify recombinant plasmids carrying the target fragment (those with a 960 bp band were identified as 35Spro::OsWRKY14-GFP recombinant plasmids). Sequencing was then used for identification. Sequencing results were analyzed using DNAMAN software. Correctly identified transformants were named 35Spro::OsWRKY14-GFP.

[0035] III. Construction and Identification of Rice Materials with OsWRKY14 Gene Overexpression and Deletion

[0036] Agrobacterium GV3101 containing the recombinant plasmid 35Spro::OsWRKY14-GFP was overexpressed in Baige Gene to construct rice materials with deletion, resulting in heterozygous T0 generation plants. Hygromycin was used for resistance selection, yielding T1 materials with a single-gene insertion and a segregation ratio of 3:1 in the progeny. After harvesting individual T1 plants, the seeds from each plant were sown separately on hygromycin medium, and the segregation in the T2 generation was observed until stable homozygous transgenic lines were obtained, thus obtaining two OsWRKY14 gene overexpression lines, OsWRKY14-OE#4 and OsWRKY14-OE#8.

[0037] Gene knockout target sites were selected for constructing CRISPR / CAS9 materials using the OsWRKY14 gene.

[0038] sgRNA:GCAACACGCCGACCGACTCG (SEQ ID NO: 5) was used in the construction of CRISPR / CAS9 materials by Baige Gene to obtain gene knockout T1 generation materials. T1 materials were seeded, and DNA was extracted from individual plants. Sequences near the target site were used as identification primers.

[0039] GP16978-12561-F: TCAGCACAAAAACCCCTCCA, see SEQ ID NO: 6

[0040] GP16978-12561-R:GAGCAGATGAAGGGCGGG, see SEQ ID NO: 7

[0041] The PCR amplification reaction system consisted of: 25 μL of 2x PrimerSTAR buffer, 5 μL of dNTP Mixture, 1 μL of PrimerSTAR DNA polymerase, 16 μL of ddH2O, 1 μL of cDNA, and 1 μL each of forward and reverse primers, totaling 50 μL. The PCR reaction program was as follows: 94°C pre-denaturation for 90 seconds; 94°C denaturation for 30 seconds, 57°C annealing for 45 seconds, 72°C extension for 1 minute and 30 seconds, for 35 cycles; and a final extension at 72°C for 5 minutes. The obtained PCR products were identified by 1% agarose gel electrophoresis, and the amplified bands were then sent to Youkang Company for sequencing. Figure 1 To date, the resulting homozygous material CR-Oswrky14#3, which has an insertion of one base C compared to the wild type, and the homozygous material CR-Oswrky14#5, which has a deletion of one base C compared to the wild type, were obtained.

[0042] Notes: Seeds that meet the following criteria are considered overexpressing: a 3:1 ratio of long to non-long lateral roots on a hygromycin (50 mg / L) medium and a more than twofold increase in gene expression. CRISPR / CAS9 material identification primers amplified fragments without double peaks during sequencing indicate homozygous material.

[0043] IV. Rice Cultivation and Phenotypic Observation

[0044] To germinate the rice seeds, soak them in a disposable plastic petri dish containing water and place it in a 37°C constant temperature incubator, changing the water twice a day, morning and evening. After three days of cultivation, once the seeds show white sprouts, transplant them.

[0045] Place the germinated seeds on a homemade float, then place the float in a black plastic bucket filled with hydroponic nutrient solution. Place the bucket in a plant growth chamber with the following conditions: 12 hours of light per day at 30°C; 12 hours of darkness per day at 25°C. During normal growth, change the nutrient solution every two days.

[0046] Preparation of stock solution for hydroponic nutrient solution:

[0047] Solution I: MgSO4·7H2O (0.547M), (NH4)2SO4 (0.365M); This solution provides magnesium and ammonium salts for rice growth.

[0048] Solution II: KH2PO4 (0.182M), this phosphate solution provides phosphorus for rice growth;

[0049] Solution III: KNO3 (0.183M), this solution provides potassium salts for rice growth;

[0050] Solution IV: Ca(NO3)2·4H2O(0.366M), MnCl2.4H2O(0.005M), H3BO3(0.03M),

[0051] (NH4)6Mo7O 24 ·4H2 (0.001M), ZnSO4·7H2O (0.004M), CuSO4·5H2O (0.002M), this solution provides the trace elements needed for rice growth;

[0052] Solution V: NaFe(3)-EDTA·3H2O (0.1M), when preparing, wrap it in aluminum foil to protect it from light, stir it overnight at 40℃, or place it in an incubator at 37℃ overnight; this solution provides the iron salts required for rice growth;

[0053] MES solution: Prepare a 1M concentration and adjust the pH of the MES solution to approximately 5.5 using KOH. This solution is used to adjust the pH of the hydroponic nutrient solution for rice to be slightly acidic.

[0054] To prepare 4L of hydroponic nutrient solution: add 4ml of each of solutions I, II, and III, 400μl of solution IV, 0.5ml of solution V, and 8ml of MES solution.

[0055] Seven days later, the plant phenotypes of wild-type ZH11 and OsWRKY14 gene overexpression and deletion rice materials were observed, and based on... Figure 2 To date, rice materials with OsWRKY14 gene overexpression and deletion show no significant changes compared to wild-type ZH11.

[0056] After one month of hydroponic cultivation, the rice is transplanted to a field for further growth. Once mature, the rice is harvested. Figure 3 To date, the two lines with silenced OsWRKY14 gene, CR-Oswrky14#3 and CR-Oswrky14#5, showed increased seed length compared to the wild type, while the two lines with overexpressed OsWRKY14 gene, OsWRKY14-OE#4 and OsWRKY14-OE#8, showed shortened seed length compared to the wild type. This indicates that OsWRKY14 has a slight effect on seed length, which may be a balance between plant growth and resistance.

[0057] V. Research on Bacterial Leaf Blight Disease in Rice

[0058] Activation of bacterial blight pathogen PXO124 was performed by activating the pathogen in petri dishes containing NB solid medium and then incubating it upside down in a 28°C constant temperature incubator. The preparation process of NB medium is as follows:

[0059] Tryptone 5g / L, yeast extract 1g / L, beef extract 3g / L, sucrose 10g / L

[0060] Dissolve the above experimental reagents in water, adjust the pH of the solution to 7.0–7.2 after bringing the volume to a final volume, and autoclave at 121°C for 20 minutes. Add 15 g / L of agar powder to the solid culture medium.

[0061] The culture of bacterial blight pathogen, after the activated bacterial blight pathogen has grown into single colonies on NB medium, is carried out as follows:

[0062] Pick a single clone into a 50ml centrifuge tube containing NB liquid culture medium and incubate at 28℃ and 220rpm for about 30 hours; centrifuge at 5000rpm for 5min and discard the supernatant; resuspend the precipitate in 5ml of sterile water, centrifuge at 5000rpm for 5min and discard the supernatant; repeat the previous step; resuspend the precipitate in 3ml of sterile water, and adjust the OD of the bacterial culture to 600 to 1.0 using sterile water as a reference.

[0063] To inoculate rice seedlings with bacterial blight, the fifth leaf of the seedling is inoculated using the leaf-cutting method: dip scissors in the prepared bacterial blight solution and cut off about 2 cm of the leaf tip at the fifth leaf tip. The pathogen will then enter the plant leaf through the wound. Sterile water is used as a control.

[0064] After inoculation, the rice seedlings were grown under the following conditions: 12 hours at 30℃ and 40% light; 12 hours at 25℃ and in darkness. To create a warm and humid environment conducive to disease development, the incubator and leaf surface were sprayed daily. The area of ​​the fungal patches was photographed and measured and statistically analyzed using ImageJ software.

[0065] according to Figure 4 As known from A and 4B, the two lines CR-Oswrky14#3 and CR-Oswrky14#5 with silenced OsWRKY14 gene showed more severe disease after inoculation with bacterial blight compared to the wild type, while the two lines OsWRKY14-OE#4 and OsWRKY14-OE#8 with overexpressed OsWRKY14 gene showed milder symptoms after inoculation with bacterial blight compared to the wild type.

[0066] VI. Extraction and Analysis of Cherry Blossom Extract

[0067] Weigh 0.1 g of rice powder that has been uniformly ground in liquid nitrogen, add 1.6 mL of extraction buffer (ethanol:water:acetonitrile:acetic acid = 79:13.99:7:0.01), sonicate at 100 Hz for 30 min, and rotate overnight at 4℃. Centrifuge at 12000 rpm for 15 min, and collect 1 mL of the supernatant. Centrifuge the supernatant again, and use the purified extract after filtration membrane analysis to determine the content of cherry blossom extract by GC-MS.

[0068] according to Figure 4 According to C, after inoculation with white leaf blight, the cherry blossom glycoside content of the two lines CR-Oswrky14#3 and CR-Oswrky14#5 with OsWRKY14 gene silencing was lower than that of the wild type, while the cherry blossom glycoside content of the two lines OsWRKY14-OE#4 and OsWRKY14-OE#8 with OsWRKY14 gene overexpression was significantly higher than that of the wild type.

Claims

1. Application of the OsWRKY14 gene in regulating the synthesis of safflowerin in rice, wherein the nucleotide sequence of the OsWRKY14 gene is shown in SEQ ID NO.1 and the amino acid sequence is shown in SEQ ID NO.2; overexpression OsWRKY14 At that time, the content of cherry blossom extract increased; OsWRKY14 Gene silencing leads to a decrease in the content of cherry blossom extract.

Images