Strain for producing vanillin and feruloyl coa, construction method and application thereof

Abstract

This application belongs to the field of microbial fermentation, specifically relating to the construction method and application of a vanillin-producing *Escherichia coli* engineered strain. Firstly, it provides a vanillin-producing *E. coli* engineered strain, including overexpressed cinnamyl-CoA reductase (ccr), vanillyl alcohol oxidase (vaoA), coniferyl alcohol dehydrogenase (calA), enoyl-CoA hydratase (ech), and citrate synthase (gltA), or isoenzymes of these enzymes; and one or more genes in the genome knocked out from the oxidoreductase genes yjgB, yqhD, choline dehydrogenase gene betA, and ptsH, or genes with the same function as these genes; and a mutation at position 49 of cinnamyl-CoA reductase (ccr) where arginine is replaced by isoleucine, leucine, or valine, and at position 55 where lysine is replaced by serine, glycine, or alanine. This application also provides a method for constructing the vanillin-producing *E. coli* strain and a method for preparing vanillin using the strain. After optimizing the pathway and fermentation conditions, the obtained strain yielded 22.5 mM of vanillin.

Description

Technical Field

[0001] This application relates to the field of bioengineering, and in particular to a method for producing feruloyl-CoA, a bacterial strain using the method, and a method for constructing the strain. Background Technology

[0002] Feruloyl-CoA, belonging to the hydroxycinnamoyl ester class, is an important bioactive precursor in plant cells and a precursor for the production of many high-value compounds, such as vanillin, curcumin, and scopolamine. In 2000, Obel et al. extracted crude enzyme solution from wheat seedlings and demonstrated that this crude enzyme solution possessed coenzyme A ligase activity, caffeate methyltransferase activity, and caffeoyl-CoA methyltransferase activity, and could directly convert caffeic acid to feruloyl-CoA. With further research, the pathway for the biosynthesis of feruloyl-CoA was elucidated. Ferulic acid can also be directly converted to feruloyl-CoA under the catalysis of 4-coumarate-CoA ligase (4CL). In addition, p-coumaric acid is converted into p-coumaric acid coenzyme A under the catalysis of 4CL. The latter is then converted into feruloyl coenzyme A under the catalysis of p-coumaryl shikimate transferase (CST), p-coumaryl-5-O-shikimate hydroxylase (CS3'H) and caffeoyl coenzyme AO-methyltransferase (CCoAOMT). However, due to the low efficiency of phenolic hydroxyl methylation, ferulic acid has become the preferred substrate for the synthesis of feruloyl coenzyme A, and is also the main substrate for the downstream biosynthetic products vanillin and curcumin.

[0003] When ferulic acid is used as a substrate to synthesize high-value small molecules such as vanillin and curcumin via feruloyl-CoA, it does not require the central metabolic pathway of the host and does not affect the growth of the host bacteria. For example, ferulic acid is converted to feruloyl-CoA by feruloyl-CoA synthase (Fcs), which can then be further catalyzed to vanillin by enoyl-CoA hydratase (Ech). Various bacterial strains exist in nature capable of converting ferulic acid to vanillin. In 2011, Di Gioia et al. [discussed / repeated the following]. Pseudomonas fluorescens Vanillin dehydrogenase gene in strain vdh At the same time, multiple copies are introduced. fcs and ech Finally, 1.28 g / L vanillin was obtained after 8 hours. Fleige et al. used the same strategy, utilizing... Actinomycete AmycolatopsisAfter comprehensive optimization of the conditions, 22.3 g / L vanillin was obtained using the above strains. Although these strains can yield a relatively high amount of vanillin, they all form dense hyphae, leading to a viscous fermentation broth and making subsequent separation and extraction difficult. Using *E. coli* fermentation avoids the problems caused by hyphae. In 2008, researchers modified the *E. coli* genome to optimize the accumulation of intracellular coenzyme A, ultimately obtaining 5.14 g / L vanillin after culturing in 2YT medium for 24 hours. Another pathway for coenzyme A synthesis exists in nature that does not consume coenzyme A. In 2018, Ni et al. heterologously expressed... Bacillus coagulans Phenolic acid decarboxylase (Pad) from DSM1 and phenol monooxygenase (Ado) from Thermothelomyces thermophila produced 13.3 g / L vanillin in a 1 L reaction system over 18 hours, which is the highest yield of vanillin produced using recombinant E. coli to date. However, this pathway generates formaldehyde during the reaction, making the produced vanillin unsuitable for direct use in the food and pharmaceutical fields.

[0004] In addition, eugenol is also an important substrate for the synthesis of vanillin. Eugenol is the main component of clove oil and can be directly isolated from clove oil on an industrial scale, making it inexpensive. In *Pseudomonas aeruginosa*, eugenol is sequentially catalyzed to ferulic acid by eugenol hydroxylases (EhyA and EhyB), coniferyl alcohol dehydrogenase (CalA), and coniferyl aldehyde dehydrogenase (CalB). The resulting ferulic acid can then be further converted into vanillin. In 2003, Overhage J et al. identified the eugenol hydroxylase gene in the pathway... ehyAB Replaced with penicillium simplicissimum Vanillyl oxidase gene from CBS 170.90 vaoA Combining the ferulic acid-vanillin pathway mentioned above, two strains of *E. coli* were used to achieve the biotransformation from eugenol to vanillin through a two-step reaction. Although this method produced 0.3 g / L of vanillin, the conversion efficiency of the second step was too low, leaving a large amount of ferulic acid in the culture medium. Extending the reaction time not only prevented the remaining ferulic acid from being converted to vanillin, but also completely reduced the already generated vanillin to vanillyl alcohol.

[0005] Isoeugenol, an isomer of eugenol, can also be biotransformed into vanillin. Sun Zhihao et al. isolated *Bacillus fusiforme* from soil, which can be grown on plates using isoeugenol as the sole carbon source. When isoeugenol is placed in fermentation broth, free cells, or immobilized cells, it can be converted to 2-4 g / L vanillin within 1-4 days. In a water-organic phase biphase system, after 3 days of reaction, 32.5 g / L vanillin can be detected in the organic phase. Subsequently, Zhao Liqing et al. further optimized the conversion conditions, obtaining 46 g / L vanillin after 3 days of reaction. This method is similar to the method described above.Actinomycete Amycolatopsis The methods used by sp. strains to convert ferulic acid to vanillin are similar, both forming mycelia during fermentation, which complicates subsequent separation and purification. While the above methods can produce vanillin, they all have significant drawbacks. Therefore, there is an urgent need for a low-cost, simple, and efficient method to produce vanillin from eugenol. Summary of the Invention

[0006] To achieve the above objectives, this application provides a bacterial strain that produces feruloyl-CoA and vanillin using eugenol, a method for constructing the strain, and a method for synthesizing feruloyl-CoA and vanillin using the strain.

[0007] The following is the specific content of the invention: First, this application provides a strain for producing vanillin, the strain having: Overexpressed cinnamyl-CoA reductase CCR or isoenzyme, vanillyl alcohol oxidase VaoA or isoenzyme, coniferyl alcohol dehydrogenase CalA or isoenzyme, diethyl-CoA hydratase Ech or isoenzyme, and citrate synthase GltA or isoenzyme.

[0008] The genome of the strains described above is also missing one or more of the following genes: oxidoreductase gene yjgB, yqhD, choline dehydrogenase gene betA, and ptsH, or one or more of the following genes with the same function as the above genes; and cinnamyl-CoA reductase CCR, preferably Ll-CCRH1 derived from Leuciscus leucantha.

[0009] Furthermore, cinnamyl-CoA reductase has one or more of the following mutations: Arginine at position 49 is mutated to isoleucine, leucine, or valine; lysine at position 55 is mutated to serine, glycine, or alanine; proline at position 51 is changed to serine; glycine at position 26 is changed to glutamic acid; and alanine at position 48 is changed to aspartic acid.

[0010] This application also provides products containing the above-mentioned strain and the application of the strain in the production of vanillin.

[0011] Furthermore, this application provides a method for constructing a vanillin-producing strain, specifically as follows: first, knock out the oxidoreductase gene on the strain's genome. yjgB Genes and yqhD Genes and choline dehydrogenase genes betA Genes and ptsH Gene; then, a citrate synthase gene following the 119 promoter was inserted into the strain genome. gltA ; Then, construct a system containing... ccr, vaoA, calA and ech Gene plasmids were transformed into E. coli to obtain Δ-yjgB-yqhD-betA-ptsH -119- gltA strains.

[0012] The above-mentioned construction method also includes the directed evolution of cinnamyl-CoA reductase, the details of which are as follows: The ccr Mutant libraries were constructed by mutating the gene, and a mutant of cinnamyl-CoA reductase was obtained by screening. The 49th arginine was mutated to isoleucine, leucine or valine, the 55th lysine was mutated to serine, glycine or alanine, the 51st proline was changed to serine, the 26th glycine was changed to glutamic acid, and the 48th alanine was changed to aspartic acid.

[0013] The Escherichia coli used in the construction method is a K12 series strain, preferably Escherichia coli BW25113.

[0014] This application also provides a method for preparing vanillin using the above-mentioned strain, as follows: The constructed containing ccr, vaoA, calA and ech plasmid transformed to Δ- yjgB-yqhD-betA-ptsH -119- gltA From the strain, a single colony was picked and placed into a test tube containing 50 ug / ml kanamycin and 100 ug / ml ampicillin, and cultured at 37℃ and 220 rpm for 12 h to obtain the culture solution; Using the culture medium as the seed culture, 1% (v / v) was transferred to a 100ml LB shake flask containing 50ug / ml kanamycin and 100ug / ml ampicillin, and incubated at 37℃ with shaking at 220rpm. When OD... 600 When the concentration of the bacteria is 0.6-0.8, add 0.05 mM IPTG to induce vanillin production. After culturing at 30°C and 220 rpm for 12 h with shaking, collect the bacterial cells by centrifugation at 3000 g and 4°C and resuspend them. Adjust the concentration of the resuspended bacterial culture to OD. 600 =20, then add the bacterial culture to the shake flask, incubate at 30℃ and 220rpm with shaking, and add eugenol to the shake flask according to the consumption of the substrate coniferaldehyde (yellow).

[0015] The above preparation method also includes the following steps: First, construct the plasmid pYB1k-gap- ccr pYB1k-gap- ccr - calA pYB1k- ccr - calA pTrc99a- vao-calA-ech and pTrc99a- vao-ech ; The plasmids were then combined in pairs as shown in the table and transformed into the △-yjgB-yqhD-betA-ptsH-119-gltA strain. The vanillin yield was compared, and plasmid combinations were screened.

[0016]

[0017] Ethanol, methanol, and dimethyl sulfoxide were also used as co-solvents for eugenol during the preparation process, with dimethyl sulfoxide being preferred.

[0018] The above preparation methods also include the preparation of acyl-CoA hydratase gene. ech One to five arginine residues were inserted after the start codon of the gene to explore the effect of different Ech protein expression levels on vanillin production, with three arginine residues being preferred.

[0019] This application also provides intermediate or precursor strains for producing the above-mentioned strains, specifically strains for producing feruloyl-CoA, wherein the strains have: Overexpressed cinnamyl-CoA reductase CCR or isoenzyme, vanillyl oxidase VaoA or isoenzyme, and coniferyl dehydrogenase CalA or isoenzyme; and cinnamyl-CoA reductase CCR, preferably Ll-CCRH1 derived from Leuciscus.

[0020] Finally, this application provides a method for preparing feruloyl-CoA, the specific steps of which include: in a host bacterium, the double bond of the eugenol side chain undergoes isomerization under the oxidation of vanillyl alcohol oxidase (VaoA) or isoenzyme, and a hydroxyl group is introduced at the end to generate coniferyl alcohol; coniferyl alcohol is further oxidized under the catalysis of coniferyl alcohol dehydrogenase (CalA) or isoenzyme, and the terminal hydroxyl group is converted into an aldehyde group; finally, coniferyl alcohol is oxidized by cinnamyl-CoA reductase or isoenzyme (L1-CCRH1) to introduce CoA at the aldehyde group position at the end of the side chain to obtain feruloyl-CoA.

[0021] Beneficial effects of the invention This application utilizes the oxidative activity of Ll-CCRH1 derived from *Leucaena leucocephala* to construct a synthetic pathway for the synthesis of vanillin using eugenol as a substrate, and performs directed evolution on the rate-limiting enzyme Ll-CCRH1 in the pathway to obtain mutant strains. In addition, the oxidoreductase gene on the genome of *E. coli* BW25113 was knocked out. yjgB and yqhD and choline dehydrogenase gene betA Further knockout ptsH Genes, and overexpression gltA Subsequently, chassis cells suitable for vanillin accumulation were obtained. After further optimizing the effects of different plasmid combinations on vanillin yield and fermentation conditions such as inducer concentration and solubilizer, a strain with a vanillin yield as high as 22.5 mM was obtained, while the eugenol conversion rate reached over 90%. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of this application, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this application. Figure 1 The synthetic pathway for vanillin synthesis using eugenol as a substrate: VaoA: vanillyl alcohol oxidase; CalA: coniferyl alcohol dehydrogenase; Ech: enoyl-CoA hydratase; CCR: cinnamyl-CoA reductase; CoA: coenzyme A. Figure 2 Experimental flowchart Figure 3 To express fcs-ech HPLC results of vanillin synthesis by strain BW25113 via biosynthetic pathway: Left: culture medium with ferulic acid added; Right: culture medium with ferulic acid and 2.5 mM coniferaldehyde added. Figure 4 HPLC determination of vanillin transformation in BW25113 strain expressing CalB protein: Left: BW25113 strain without CalB protein expression; Right: BW25113 strain expressing CalB protein. Figure 5 To express ccr-ech HPLC determination of vanillin synthesis by strain BW25113 via biosynthetic pathway Figure 6 HPLC detection of vanillin produced by different bacterial strains consuming eugenol Figure 7 Results of the first round of random mutant library screening Figure 8 Results of the second round of random mutant library screening Figure 9 Vanillin production in the II-16-26E mutant Figure 10 Wild-type Ll-CCRH1 and NADP + The combined 3D structure diagram shows that P51, G26, and A48 are three effective mutation sites obtained from random mutation library screening; R49 and K55 are the sites selected to construct site-directed saturation mutation libraries. Figure 11 Results of site-directed saturation mutant library screening Figure 12 HPLC detection results of products from Van-4 strain containing different promoters and plasmid combinations after 11 hours. Figure 13 HPLC detection results of vanillin production by Van-4 strain containing combination 2 via transformation method Figure 14HPLC detection results for vanillin production by Van-4 strains with different Ech protein expression levels Figure 15 HPLC detection results of vanillin production by strain Van-4 induced by different concentrations of IPTG Figure 16 Vanillin yield from eugenol dissolved in different organic solvents by Van-4 strain Figure 17 HPLC detection results of vanillin production by strain Van-4 under optimal conditions Detailed Implementation Unless otherwise specified, all experiments in the following experiments were conducted under standard conditions or conditions recommended by the manufacturer. Active pharmaceutical ingredients, excipients, reagents, and instruments used, unless otherwise specified, are all commercially available products. Unless otherwise stated, all percentages, ratios, proportions, or parts are by weight.

[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to one skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to this application.

[0024] The following methods for preparing the compositions or formulations of this application are merely examples of the methods proposed in this application, and should not be construed as limiting the preparation methods of this application to the methods listed above.

[0025] This application consists of the following parts. 1. Development of gene modification programs 2. Construction of a vanillin expression plasmid using eugenol as a substrate 3. Construction of chassis cells suitable for vanillin production 4. Directed evolution of rate-limiting enzymes in synthetic pathways 5. Optimization of vanillin synthesis conditions 6. Summary and Explanation The following are the details of each part of the experiment. 1. Determination of the genetic modification scheme for the synthesis of vanillin using eugenol as a substrate (1) Effect of intermediate product coniferaldehyde on the activity of feruloyl-CoA synthase Fcs Ferulic acid and coniferaldehyde are intermediates in the synthesis of vanillin from eugenol. Escherichia coli overexpressing ferulic yl-CoA synthase (Fcs) and enoyl-CoA hydratase (Ech) catalyzes the conversion of ferulic acid to vanillin. Using this strain as the experimental subject, when only ferulic acid was added, all of the ferulic acid was converted to vanillin; however, when 2.5 mM coniferaldehyde was added along with the substrate ferulic acid, only a small portion of the ferulic acid was converted to vanillin, indicating that coniferaldehyde can inhibit...fcs-ech The activity of the pathway is reduced, decreasing the intracellular content of ferulic acid-co-A, thereby reducing the production of vanillin. Therefore, the simultaneous presence of coniferaldehyde and [other enzymes] in a single cell is [unclear]. fcs-ech The pathway is unfavorable to vanillin production, such as Figure 3 .

[0026] (2) Consumption of vanillin by coniferaldehyde dehydrogenase (CalB) as the final product Strains overexpressing vanillyl oxidase (VaoA), coniferyl alcohol dehydrogenase (CalA), and coniferyl aldehyde dehydrogenase (CalB) can stepwise catalyze the conversion of eugenol to ferulic acid. However, CalB in these strains not only catalyzes the conversion of coniferyl aldehyde to ferulic acid but also converts the downstream product vanillin to vanillic acid. Therefore, using strains overexpressing CalB as the experimental subject, the consumption of the downstream product vanillin by exogenous vanillin was detected. Experiments showed that when *E. coli* did not contain CalB protein, a large amount of vanillin remained in the reaction system; when *E. coli* contained CalB protein, all vanillin was converted to vanillic acid, demonstrating that the presence of CalB consumes vanillin. Figure 4 .

[0027] In summary, the goal of converting eugenol to vanillin cannot be achieved in the host bacteria by expressing a combination of vanillyl alcohol oxidase (VaoA), coniferyl alcohol dehydrogenase (CalA), coniferyl aldehyde dehydrogenase (CalB), feruloyl-CoA synthase (Fcs), and enoyl-CoA hydratase (Ech).

[0028] (3) Coniferaldehyde has an effect on Escherichia coli containing Ll-CCRH1 (cinnamoyl-CoA reductase derived from leucosus) ccr-ech Effects on pathway activity Cinnamyl-CoA reductase (Ll-CCRH1) derived from *Leuciscus leucantha* catalyzes the interconversion between coniferaldehyde and feruloyl-CoA. Furthermore, the free energy required for the reverse oxidation reaction is less than that required for the forward reduction reaction, making Ll-CCRH1 predisposed to oxidize coniferaldehyde to feruloyl-CoA. Therefore, introducing Ll-CCRH1 from *Leuciscus leucantha* into the feruloyl-CoA synthesis pathway can address the issue of coniferaldehyde's influence on... fcs-ech The problem of enzyme activity inhibition can also avoid the consumption of the downstream product vanillin by CalB, and can also shorten the synthesis pathway and reduce the cellular burden.

[0029] As described above, coniferaldehyde inhibits fcs-ech After introducing Ll-CCRH1, the pathway no longer requires... fcs Genetics. However, it is currently impossible to determine whether coniferaldehyde will have an effect. echGenes. Therefore, Ll-CCRH1 and Ech proteins were overexpressed in *E. coli*. Using this strain as the experimental subject, 2.5 mM coniferaldehyde was added to the reaction system, and only vanillin was detected in the end, proving that... ccr-ech The pathway can completely convert 2.5 mM coniferaldehyde into vanillin, therefore coniferaldehyde has an effect on... ccr-ech The pathway has no inhibitory effect, such as Figure 5 .

[0030] (4) Improvements to the function of cells in producing coenzyme A Coenzyme A is essential for the synthesis of vanillin from feruloyl-CoA. Citrate synthase (GltA) catalyzes the production of coenzyme A from acetyl-CoA and is overexpressed in E. coli. gltA Genes facilitate the circulation of coenzyme A within cells.

[0031] ptsH The HPr protein encoded by the gene is a component of the phosphoenolpyruvate (PEP)-dependent phosphotransferase system (PTS). When *E. coli* grows in a glucose-based basal medium, the PTS system consumes intracellular phosphoenolpyruvate (PEP). PEP can activate intracellular acetyl-CoA to convert into acetyl phosphate and CoA. Therefore... ptsH Gene knockout can increase the amount of PEP in cells and promote the accumulation of coenzyme A.

[0032] Similarly, acetyl-CoA synthase (Acs) catalyzes the production of acetyl-CoA from acetic acid, which consumes CoA and is an irreversible reaction; therefore, knocking out... acs Genes promote the accumulation of coenzyme A within cells.

[0033] In summary, the intermediate product coniferaldehyde inhibits... fcs-ech The activity of cinnamyl-CoA reductase-enoyl-CoA hydratase and coniferaldehyde dehydrogenase CalB can convert the downstream product vanillin to vanillic acid. Therefore, combining these enzymes in one host cannot achieve efficient conversion of eugenol to feruloyl-CoA and vanillin. Therefore, cinnamyl-CoA reductase (Ll-CCRH1) from *Acacia leucosus* was introduced into the pathway. This enzyme's ability to catalyze the conversion of coniferaldehyde to feruloyl-CoA solves the problem in the original pathway and shortens the synthetic route. Subsequently, the oxidoreductase genes in *E. coli* BW25113 were sequentially knocked out. yjgB and yqhD and choline dehydrogenase gene betA This reduces the host cell's consumption of the intermediate product coniferaldehyde and the downstream product vanillin, increases the accumulation of coniferaldehyde within the cell, and prevents vanillin from being converted into vanillinol. Based on this, knockout... ptsH Simultaneous overexpression of citrate synthase gene gltA Genes, and then further knockoutacs Genes enhance the regeneration of coenzyme A within cells, ultimately resulting in chassis cells (vector cells in which designed genetic programs can function) that are suitable for vanillin accumulation in the new pathway.

[0034] Based on the above modification plan, the following experiments were conducted. 2. Example 1: Construction of vanillin expression plasmid using eugenol as substrate (1) pYB1k-gap- ccr and pTrc99a- vaoA - calA-ech Plasmid construction: First, using the pYB1k-gap plasmid as a template, PCR was performed using 5'cttcctcttcccaccaagtaaggtaccggtagatctggtac3' / 5'gcgggggcggcagcaggcatatggttcctcctagctattt3' primers (polymerase chain reaction procedure and system are shown in Tables 1 and 2) to obtain vector fragment 1, which was then synthesized. ccr Using the (cinnamyl-CoA reductase) gene fragment as a template, PCR (polymerase chain reaction) was performed using primers 5'aaatagctaggaggaaccatatgcctgctgccgcccccgc3' / 5'gtaccagatctaccggtaccttacttggtgggaagaggaag3' to obtain a fragment with homologous arms. ccr1 After recovering the PCR products using a DNA gel extraction kit (Beijing Zhuangmeng), vector 1 and vector 2 were assembled using a Gibson Assembly kit (Shanghai Lingsheng). ccr1 Fragments were obtained to obtain plasmid pYB1k-gap- ccr .

[0035] Then with pTrc99a- ech Using the plasmid as a template, PCR was performed with primers 5'cttgaagcttacaaacgctagggctgttttggcggatgagag3' / 5'aattcctgggtcttactcatggtctgtttcctgtgtgaaat3' to obtain vector fragment 2, which was then synthesized. calA (Pine bark dehydrogenase) and vaoA Using a gene (vanillyl oxidase gene) fragment as a template, PCR was performed using primers 5'atttcacacaggaaacagaccatgagtaagacccaggaatt3' / 5'catgtatatctccttttacagtttccaggtcacatg3' to obtain a fragment with homologous arms. vaoAPCR was performed using primers 5'gaaactgtaaaaggagatatacatgcagctgaccaacaaaaag3' / 5'tttgctcatgtatatctccttttacacgtaggtgctggcc3' to obtain fragments with homologous arms. calA After PCR product recovery, vector 2 and vector 3 were assembled using the Gibson Assembly kit. vaoA Fragments and calA Fragments were obtained to obtain plasmid pTrc99a- vaoA-calA-ech .

[0036] Table 1: PCR reaction system

[0037] Table 2: PCR Procedure

[0038] (2) Evaluation of the effect of Escherichia coli BW25113 containing the synthetic pathway in converting eugenol to vanillin Using a 411BR electroporator (BIO-RAD), 1 ng of plasmid pYB1k-gap- was transferred at 2.5 kV. ccr and pTrc99a- vaoA-calA-ech Electroporation was performed on Escherichia coli BW25113, and a single colony was picked and added to 3 mL of solution containing 50 μg / ml Kans. R (Kanamycin) and 100ug / ml Amp R Ampicillin was cultured in LB medium (tryptone: yeast extract: sodium chloride = 10 g: 5 g: 5 g / L) in test tubes at 37°C with shaking at 220 rpm for 12 h. This culture was then used as a seed culture and transferred at a ratio of 1% to another tube containing Kansasone propagation medium. R and Amp R In a 3 mL LB tube, incubate at 37°C until OD 600 When the absorbance of the solution at 600 nm was 0.6, 0.05 M m IPTG (isopropyl thiogalactoside) was added for induction, along with 2 m M eugenol. The mixture was incubated at 30°C and 200 rpm for 12 h on a constant temperature shaker (HZQ-F100, Suzhou Peiying Experimental Equipment Co., Ltd.). 500 μL of the supernatant was then collected, and an equal volume of anhydrous ethanol was added. After thorough mixing, high-performance liquid chromatography (HPLC) (LC-20AT, Shimadzu) was performed. A small amount of vanillin was detected in the reaction mixture, but the concentration of vanillin was as high as 1.92 mM. It is speculated that the generated vanillin was reduced to vanillin by reductase in *E. coli* BW25113. Therefore, we still need to knock out some of the oxidoreductases in *E. coli* BW25113.

[0039] 3. Construction of chassis cells suitable for vanillin production in Example 2 First, knock out the alcohol-aldehyde oxidoreductase gene in the strain. yjgB, yqhD and betA (Choline dehydrogenase) gene, and then knocked out ptsH Gene, and simultaneously insert citrate synthase gene ( gltA The specific steps are as follows: (1) △- yjgB (Van-1) strain construction Using the CRISPR-Cas9 method (a gene therapy technique that can treat a variety of diseases through DNA cutting technology) to knock out the gene sequence of strain BW25113 yjgB (Oxidoreductase) gene.

[0040] First, using BW25113 bacterial suspension as a template, 5'aggacccctttaccagctattacg3' / 5'ttaataatctccagtaaagcct3' (△- yjgB -up-for / rev) and 5'tcctgtgcaggctttactggagattattaacgttgtcacc3' / 5'tgtgtgggttaacaggcacgct3'(△- yjgB-down PCR was performed using primers (-for / rev) to obtain fragments with homologous arms. yjgB -up and yjgB -down, and then with yjgB -up and yjgB -down is the template, use 5'aggacccctttaccagctattacg3' / 5'tgtgtgggttaacaggcacgct3'(△- yjgB -up-for / △- yjgB PCR was performed using down-rev primers, and the target fragment was obtained after product recovery. The PCR system and procedure are shown in Tables 1 and 2.

[0041] Next, using pTarget-N20 plasmid (commercially available) as a template, 5'gaggtaaaagttgaatattggttttagagctagaaatagc3' / 5'caatattcaacttttacctcactagtattatacctaggac3' (N20- yjgBPCR was performed using primers (-for / rev). The PCR system and procedure are shown in Tables 1 and 2. After product recovery, the template was removed by DPNI restriction enzyme digestion, and then electroporated into E. coli BW25113 competent cells. The cells were then plated with a solution containing 50 μg / ml Str... R (Streptomycin) plates are incubated at 37°C. The next day, a single colony is picked from the plate and sequenced to confirm the N20 sequence. The plasmid with a correct sequence is the pTarget-N20 plasmid required for the experiment. yjgB .

[0042] Next, BW25113 E. coli electroporation competent cells were prepared. The pCas9 plasmid was electroporated into the BW25113 competent cells, and after incubation at 30°C for 50 min, the cells were plated on 50 μg / ml Kansas. R Plates were incubated at 30°C for 12 hours. The next day, single colonies were picked and transferred to 3 mL of solution containing 50 μg / ml Kansin. R In LB medium, the cells were cultured at 30°C and 220 rpm with shaking for 12 h, and then transferred at a ratio of 1% by volume to 100 mL of medium containing 50 μg / ml Kans. R In LB medium containing 1 mM L-arabinose, cultured at 30°C and 220 rpm until OD. 600 =Approximately 0.6, which yields electrocompetent cells. 100 ng of pTarget-N20- yjgB The plasmid and 400 ng of the target fragment prepared above were electroporated into the competent cells, and after recovery at 30°C for 1 h, they were plated on 25 ug / ml Kansai granules. R and 25ug / ml Str R Double-resistance plates were cultured in a 30℃ incubator for 12 hours to obtain samples containing the targeting fragment and pTarget-N20-. yjgB The strain containing the plasmid.

[0043] Pick single colonies into a solution containing 50 ug / ml Kan R In LB medium containing 0.4 mM IPTG, the cells were incubated at 30°C for 12 h to eliminate pTarget-N20-. yjgB Plasmid, then 5'aggacccctttaccagctattacg3' / 5'tgtgtgggttaacaggcacgct3'(△- yjgB -up-for / △- yjgB Colony PCR verification was performed using down-rev primers (system and procedure shown in Tables 1 and 2). The verified strains were plated on antibiotic-free LB agar plates and incubated at 42°C for 12 hours. Finally, single colonies were picked and spotted onto plates containing 50 μg / ml Kansat. R Contains 50ug / ml StrR (Streptomycin) and antibiotic-free LB agar plates; monoclonal antibodies that grow only on antibiotic-free LB agar plates are △-. yjgB strain (Van-1).

[0044] (2) △- yjgB-yqhD (Van-2) strain construction In the knockout strain △- yjgB Based on the above methods, knock out yqhD (Oxidoreductase) gene, resulting in a knockout strain △- yjgB-yqhD (Van-2). Target shooting footage and pTarget-N20- yqhD The construction method is as shown in Example 2 (1), and the primers used are listed in Table 3. Table 3

[0045] (3) △- yjgB-yqhD-betA (Van-3) strain construction In the knockout strain △- yjgB-yqhD Based on the above methods, knock out betA (Cholesterol dehydrogenase) gene, resulting in a knockout strain △- yjgB-yqhD-betA (Van-3). Target shooting footage and pTarget-N20- betA The construction method is as shown in Example 2 (1), and the primers used are listed in Table 4. Table 4

[0046] (4) △ -yjgB-yqhD-betA-pstH-119-gltA (Van-4) strain construction In △- yjgB-yqhD-betA Based on this, knock out ptsH Simultaneous insertion of the citrate synthase encoding gene after the 119 promoter ( gltA ), to obtain strain △- yjgB-yqhD-betA-pstH -119- gltA (Van-4). Target shooting footage and pTarget-N20- ptsH The construction method is as shown in Example 2 (1), and the primers used are listed in Table 5. Table 5

[0047] (5) Evaluation of the effect of eugenol to vanillin in chassis cells containing synthetic pathways The plasmid pYB1k-gap- ccr and pTrc99a- vaoA-calA-ech Electrical conversion to Δ- yjgB-yqhD-betA- pstH -119-gltA In (Van4), the yield of vanillin was 0.65 mM when cultured according to the method of Example 1 (2).

[0048] Comparative Example △- yjgB-yqhD-betA-ptsH- 119 -gltA - acs (Van-6) strain construction In Example 2 (3) prepared △- yjgB-yqhD-betA-pstH -119- gltA On this basis, knock out acetyl-CoA synthase. acs Gene. Then, the plasmid pYB1k-gap- ccr and pTrc99a- vaoA-calA-ech Electrical conversion to Δ- yjgB-yqhD-betA-pstH - acs -119- gltA In the middle, we get △- yjgB-yqhD-betA-ptsH -119- gltA-acs The (Van-6) strain, cultured according to the method in Example 1 (2), yielded a vanillin production of 0.57 mM, and the production was not further increased. See Figure 6 The method for constructing the target fragment and pTarget-N20-acs is as shown in Example 2 (1), and the primers used are listed in Table 6. Table 6

[0049] 4. Directed evolution of rate-limiting enzymes in the synthetic pathway in Example 3 Directed evolution is an effective means of improving gene function. It mainly involves simulating the natural evolution process in the laboratory, using methods such as error-prone PCR, DNA shuffling, randomized guided recombination, and staggered extension techniques to induce mutagenesis and in vitro recombination of mutant genes, and designing high-throughput screening methods to select the desired high-efficiency mutant strains.

[0050] Since L1-CCRH1 is the rate-limiting enzyme, increasing its intracellular activity is beneficial for improving vanillin production. Therefore, using the vanillin biosensor already available in our laboratory, a high-throughput screening method for L1-CCRH1 was designed.

[0051] Vanillin biosensor: The VanR transcriptional regulatory protein encoded by the V3-4 gene fragment can specifically recognize the promoter PvanABK and inhibit the expression of the LacZ gene. When vanillin is present in the cell, VanR binds to vanillin, thus preventing the recognition of the PvanABK promoter, resulting in the expression of the downstream gene LacZ. LacZ can hydrolyze X-Gal (5-bromo-4-chloro-3-indole-β-D-galactoside) to produce a blue color, so the intensity of the blue color can be used to determine the level of vanillin production in the cell (the deeper the blue, the higher the production).

[0052] (1) Construction of host bacteria for screening Using the pAH156 and pAH69 plasmid systems, the V3-4 gene fragment, which responds to intracellular vanillin concentration, was inserted into the Δ- yjgB-yqhD-betA-pstH -119- gltA The helper plasmid pAH69 was electroporated into the Van-4 strain and plated on 100 μg / ml Ampicillin. R After incubating on a plate at 30°C for 12 hours, pick single colonies into 3 mL of solution containing 100 μg / ml Amp. R In LB tubes, cultured overnight at 37°C, and the next day inoculated at a 1% (volume) ratio with 100ug / ml Amp. R In LB medium, cultured until OD 600 When the concentration reaches 0.6, remove the cells and pre-cool them on ice for 30 minutes. Then, pour the bacterial culture into pre-cooled 100 mL centrifuge tubes and centrifuge at 3,000 rpm for 3 minutes at 4°C. After centrifugation, discard the supernatant and rinse three times with pre-cooled 10% glycerol, ensuring the entire process is performed near a burning alcohol lamp to avoid contamination. Finally, resuspend the cells in the residual 10% glycerol on the centrifuge tube wall and aliquot 100 μL into pre-cooled 1.5 mL centrifuge tubes to obtain electrocompetent cells. The pAH156-V3-4-LacZ plasmid (prepared according to plasmid construction, page 3115, left column, section (1)-(2) of Whole-Cell Biosensors Aid Exploration of Vanillin Transmembrane Transport, Journal of Agricultural and Food Chemistry) was electroporated into electrocompetent cells. After recovery at 37°C for 1 h, the cells were cultured at 42°C for 30 min to eliminate the helper plasmid pAH69. The cells were then plated onto a substrate containing 1 mM vanillin, 50 μg / mL X-Gal, and 25 μg / mL Gm R After incubating on gentamicin plates at 30°C for 20 hours, blue single clones were picked for colony PCR verification. The strain with the correct band was identified as VanR-LacZ (Van-5) strain. The PCR system and procedure are shown in Tables 1 and 2.

[0053] (2) Construction and screening of random mutant libraries Using pYB1k-gap-ccr as a template, primers 5'atatgcctgctgccgccc3' / 'ttacttggtgggaagaggaagatg3' were used to obtain the cinnamyl-CoA reductase gene containing the mutation site via error-prone PCR (eq-PCR). ccr Error-prone segments. After recovering the PCR products, use... ccr Error-prone fragments are large primers, with plasmid pYB1k-gap- ccr MEGAWHOP PCR was performed using the template, and the resulting PCR products were used... Dpn I restriction endonuclease was used to digest the sample at 37°C for 12 h to eliminate the template. The sample was then electroporated into *E. coli* MC1061 and plated onto a substrate containing 50 μg / mL Kansin. R Plates were incubated at 37°C for 12 hours. Five single clones were randomly selected, and plasmids were extracted and sequenced to ensure the mutation rate. Finally, colonies on the plate were scraped off, and plasmids were extracted using a plasmid miniprep kit (AXYGEN) for subsequent screening. The system and procedure used are shown in Tables 7-10. Table 7: eq-PCR system

[0054] Table 8: eq-PCR Procedure

[0055] Table 9: MEGAWHOP PCR System

[0056] Table 10: MEGAWHOP PCR Procedure

[0057] wild-type pYB1k-gap- ccr The plasmid and mutant library plasmid were respectively associated with pTrc99a- ech The plasmid was electroporated into the screening strain VanR-LacZ, and after recovery at 37°C for 1 h, it was evenly spread on a selection plate (LB agar plate) containing 25 μg / mL Kan. R 50 μg / mL Amp R 50 μg / mL X-Gal, 0.4 mM IPTG and 1 mM coniferaldehyde were added and incubated at 30℃ for 20 h. Using wild-type plates as a control, colonies with a deeper blue color were picked from the screening plates and transferred to new screening plates with sterilized toothpicks. Colonies with a deeper blue color than wild-type colonies were selected for further verification.

[0058] Select colonies with a deeper blue color than the wild type and inoculate them into 3 mL of solution containing 25 μg / mL Kan. R and 50 μg / mL Amp R The culture was incubated in LB tubes at 37°C for 12 hours. Using this culture as a seed culture, 1% (by volume) was transferred to 3 mL of a solution containing 25 μg / mL Kansas. R 50 μg / mL Amp R The solution was incubated in LB tubes containing 0.04 mM IPTG and 1 mM coniferaldehyde at 30 °C and 220 rpm for 11 h with shaking. 500 μL of the supernatant was then taken, and the same volume of anhydrous ethanol was added. After thorough mixing, the solution was analyzed by HPLC.

[0059] Select mutant strains that showed higher vanillin production than the wild-type strain in the test tube retest results, extract plasmids, electroporate the mixed plasmids into the MC1061 strain, and plate them onto a substrate containing 50 μg / mL Kansin. R On solid plates, the cells were incubated at 37°C for 12 hours. The next day, the single clones were inoculated into cells containing 50 μg / mL Kansin. R Or 100 μg / mL Amp R After incubation in liquid LB at 37°C with shaking at 220 rpm for 12 h, samples were selected from those containing only Kans. R Plasmids were extracted from strains grown in LB broth, sequenced, and mutation sites were determined.

[0060] The first round of random screening yielded a superior mutant, I-13, in which proline at position 51 was replaced with serine (P51S). A new mutant library was constructed based on this mutant. The second round of random screening yielded two superior mutants, II-7 and II-16. While retaining the mutation site at position 51, each of II-7 and II-16 introduced a new mutation site: in II-7, glycine at position 26 was replaced with glutamic acid (G26E), and in II-16, alanine at position 48 was replaced with aspartic acid (A48D). Figure 7 , 8 .

[0061] (3) Integration of random mutation sites Using the II-16 gene as a template, PCR was performed using primers 5'gcgccgaaggcttcatcgc3' and 5'ttacttggtgggaagaggaagatg3'. The PCR system and procedure are shown in Tables 1 and 2. After recovery, a partial CCR gene fragment containing mutation sites at positions 26, 48, and 51 was obtained. Then, using this fragment as a primer, MEGAWHOP PCR was performed with the II-16 template. The reaction system and procedure are shown in Tables 9 and 10. Finally, the mutant II-16-26E containing mutation sites at positions 26, 48, and 51 was obtained. The culture was performed according to the method in Example 3 (2), with a coniferaldehyde substrate concentration of 2 mM. After HPLC analysis of the samples, it was found that the strain containing mutation sites at positions 26, 48, and 51 had the highest vanillin yield, proving that the above three sites are indispensable mutation sites with a cumulative effect.

[0062] The wild-type three-dimensional structure of Ll-CCRH1 protein was obtained using alphafold2 simulation. Mutation sites at positions 26, 48, and 51 were marked on the figure, revealing that these three effective sites are all located in the cofactor NADP. + Based on the proximity of the cofactor binding pocket, it is hypothesized that the increased activity of L1-CCRH1 enzyme is related to the cofactor binding pocket, and the mutation site is associated with the cofactor NADP. + The phosphate group is closest, but the mutated amino acids, such as aspartic acid and glutamic acid, are negatively charged amino acids. NADP + The phosphate groups are negatively charged, and the two repel each other. Therefore, it is speculated that the mutated L1-CCRH1 inhibits NADP. + Decreased affinity for NAD + The affinity for NAD+ increases. This is because intracellular NAD+ increases during aerobic respiration. + Far more than NADP + The content of [something] is increased, therefore the activity of the mutant L1-CCRH1 enzyme is enhanced. See [something]. Figure 10 .

[0063] (4) Construction and screening of site-directed saturation mutant libraries Analysis of mutation sites obtained from random mutations suggests that the increased activity of the L1-CCRH1 enzyme is due to its resistance to NAD+. + Increased affinity for NAD+, during aerobic respiration, and increased intracellular cofactor NAD+ + The content of [a specific amino acid] is higher. To verify the above hypothesis, two new sites, positions 49 and 55, were selected in the cofactor collection pocket region. The rationale for selection is that amino acids at positions 49 and 55 are spatially closer to the cofactor NADP. +The phosphate group in the protein has electrostatic interactions with the phosphate group. Based on this hypothesis, it is assumed that modifying amino acids at positions 49 and 55 could potentially yield an L1-CCRH1 mutant with significantly enhanced activity. Therefore, based on the wild-type, site-specific saturation libraries were constructed using new sites R49 and K55. The wild-type pYB1k-gap- ccr Using a template, error-prone PCR was performed using primers 5'cactgtcagaggcaccgccnnsaatccagatgattctnnsaacgcacact3' / 5'ctcgagaattcctcctgttattacttggtgggaagaggaag3'. The PCR procedure and system are shown in Tables 1 and 2. A site-directed mutagenesis fragment with homologous arms was obtained. PCR was then performed using primers 5'taacaggaggaattctcgagatgcagctgaccaacaaaaag3' / 5'ggcggtgcctctgacagtgtagtctctctctagcaagag3' to obtain a vector fragment with homologous arms. The PCR procedure and system are shown in Tables 1 and 2. After recovering the PCR product, the vector fragment and... ccr Site-directed mutagenesis fragments were ligated, and the ligation product was electroporated into E. coli MC1061 and plated onto a substrate containing 50 μg / mL Kans. R Plate the bacteria and incubate at 37°C for 12 hours. Randomly select 5 single clones, extract plasmids, and sequence them to ensure the mutation rate. Finally, scrape off colonies from the plate and extract plasmids for subsequent screening.

[0064] The screening procedure for the site-controlled saturated mutant library was the same as that for the random mutant library. During screening, the concentration of the substrate coniferaldehyde was increased to 2 mM to select better mutants. Superior mutant strains 4955-1, 4955-12, and 4955-13 were screened from the site-controlled saturated mutant library. In these strains, the 49th arginine residue of the cinnamyl-CoA reductase CCRH1 derived from *Albizia julibrissin* was mutated to isoleucine (I), leucine (L), or valine (V), and the 55th lysine residue was mutated to serine (S), glycine (G), or alanine (A). Figure 11 .

[0065] 5. Experimental Example 4: Optimization of conditions for the synthesis of vanillin (using whole-cell catalysis technology to increase the yield of vanillin) Whole-cell catalysis refers to the process of using a complete biological organism (i.e., whole cell, tissue, or even individual) as a catalyst for chemical transformation. This reaction process is also known as biotransformation.

[0066] In this application, the expression levels of various proteins in the synthetic pathway were optimized by changing plasmid pairings and adjusting Ech protein expression levels. Furthermore, the whole-cell catalytic conditions were optimized by altering the inducer concentration and solubilizer, ultimately yielding the optimal strain and culture conditions suitable for vanillin production.

[0067] (1) Δ- under different plasmid ratios yjgB-yqhD-betA-pstH -119- gltA (Van-4) conversion of eugenol to obtain different vanillin yields First, construct pYB1k-gap- ccr-calA pYB1k- ccr-calA pTrc99a- vao - ech plasmid: Using pYB1k-gap plasmid as a template, PCR was performed with primers 5'tggccagcacctacgtgtaaggtaccggtagatctggtact3' / 5'cgggggcggcagcaggcatatggttcctcctagctatttg3' to obtain vector fragment 3, which was then synthesized. ccr, calA Using the gene fragment as a template, PCR was performed using primers 5'caaatagctaggaggaaccatatgcctgctgccgcccccg3' / 5'ctcgagaattcctcctgttattacttggtgggaagaggaag3' and 5'taacaggaggaattctcgagatgcagctgaccaacaaaaag3' / 5'gtaccagatctaccggtaccttacacgtaggtgctggccag3' to obtain fragments with homologous arms. ccr 2 and calA 2. Then, in fragments ccr 2 and calA Using 2 as a template, PCR was performed with primers 5'caaatagctaggaggaaccatatgcctgctgccgcccccg3' / 5'gtaccagatctaccggtaccttacacgtaggtgctggccag3' to obtain fragments with homologous arms. ccr-calA Assembly carrier 3 and ccr-calA Fragments were obtained to obtain plasmid pYB1k-gap- ccr-calA .

[0068] plasmid pTrc99a- vaoA-ech and pYB1k- ccr-calA The construction method is the same as the above methods. The PCR system and procedure are shown in Tables 1 and 2, and the primers used are shown in Table 11.

[0069] Table 11: Construction of plasmid pTrc99a- vaoA-ech and pYB1k- ccr-calA Primers used

[0070] Then, Van-4 strains with different plasmid ratios were used to transform eugenol: First, plasmids containing mutant 4955-1 were combined in different ways as shown in Table 12. Then, each plasmid combination was electroporated into Van-4. The next day, single colonies were picked and placed in 3 mL of solution containing 25 μg / mL Kan R and 50 μg / mL Amp R In LB tubes, the culture was incubated at 37°C with shaking at 220 rpm for 12 h. Using this culture as a seed culture, 1% (v / v) was transferred to another tube containing 25 μg / mL Kansin. R and 50 μg / mL Amp R In a 3 mL LB tube, incubate at 37°C with shaking at 220 rpm until OD 600 When the concentration of the bacterial culture reached 0.6, 0.05 mM IPTG and 2 mM eugenol were added. The culture was incubated at 30°C and 220 rpm for 4 hours with shaking. Then, 2 mM eugenol was added again, and the culture was continued for another 7 hours. 500 μL of the bacterial culture was then taken, and an equal volume of anhydrous ethanol was added. After thorough mixing, HPLC analysis was performed. The yields of vanillin were 1.65 mM, 3.33 mM, 0.67 mM, and 0.12 mM, respectively. Combination 2 showed the highest yield. Figure 12 .

[0071] Table 12

[0072] Next, plasmid combination 2 containing the superior mutant 4955-1 was electroporated to Δ- yjgB - yqhD-betA-pstH -119- gltA From strain (Van-4), a single colony was picked and added to 3 mL of solution containing 25 μg / mL Kan. R and 50 μg / mL Amp R The culture was incubated in LB tubes at 37°C with shaking at 220 rpm for 12 h. Using this culture as a seed culture, 1% (v / v) was transferred to 100 mL of a solution containing 25 μg / mL Kans. R and 50 μg / mL Amp R In LB shake flasks, incubate at 37°C until OD 600When the bacterial concentration reaches 0.6-0.8, add 0.05 mM IPTG, incubate at 30℃ for 12 hours, then collect the bacterial cells by centrifugation at 3000g for 10 minutes at 4℃. Resuspend the cells in an appropriate amount of transformation buffer solution, and adjust the bacterial concentration of the resuspended culture to OD200. 600 =20, take 10 mL of bacterial culture into a shake flask, add 2.6 mM eugenol, and incubate at 30℃ and 220 rpm with shaking. Based on the consumption of the substrate coniferaldehyde (yellow), add 2.6 mM eugenol approximately every 30 minutes. After 12 hours, take a sample for HPLC analysis. The vanillin yield reached 14.9 mM, see... Figure 13 .

[0073] (2) Compare the effects of different Ech protein expression levels on vanillin production. In the enoyl-CoA hydratase gene ech Adding 1-5 arginine sequences after the ATG (start codon) of the gene sequence (adjusting the proportion of rare codons at the N-terminus of the Ech protein) can regulate the expression level of the Ech protein.

[0074] First, with pTrc99a- vaoA - ech Using plasmids as templates, PCR was performed using forward primers of 5'aaggagatatacatgagaagcaaatatgaaggccgct3', 5'aaggagatatacatgagaaggagcaaatatgaaggccgct3', 5'aaggagatatacatgagaaggagaagcaaatatgaaggccgct3', 5'aaggagatatacatgagaaggagaagcaaatatgaaggccgct3', and 5'aaggagatatacatgagaaggagaagaaggagcaaatatgaaggccgct3' and reverse primers of 5'ctagcgtttgtaagcttcaaggccagg3'. The PCR system and procedure are shown in Tables 1 and 2. ech -1、 ech -2、 ech -3、 ech -4 and ech -5 fragment. PCR was performed using 5'cttgaagcttacaaacgctagggctgttttg3' / 5'tctcatgtatatctccttttacagtttcc3' primers to obtain vector fragment 4. The PCR system and procedure are shown in Tables 1 and 2. Vector fragment 4 and... were assembled respectively. ech -1-5 fragments were used to obtain plasmid pTrc99a- vaoA-ech -1-5.

[0075] pTrc99a- vao-ech -1、pTrc99a- vao-ech -2、pTrc99a- vao-ech -3、pTrc99a- vao- ech- 4 and pTrc99a- vao-ech -5 plasmids were respectively associated with pYB1k-gap- ccr-calA (4955-1) The plasmid was electroporated into Van-4. Single clones were selected and fermented according to the method in Example 4 (3), containing plasmid pTrc99a- vao-ech -3 and pYB1k-gap- ccr-calA The vanillin production of strain (4955-1) Van-4 reached 19.9 mM, see Figure 14 .

[0076] (3) Optimize the concentration of the inducing agent and the type of cosolvent. Optimize inducer (IPTG) concentration Pick those containing pTrc99a- vao-ech -3 and pYB1k-gap- ccr-calA A single colony of Van-4 strain (4955-1) was obtained, and 3 mL of the solution contained Kan R and Amp R The culture was incubated in LB tubes at 37°C for 12 hours. Using this culture as a seed culture, 1% (by volume) was transferred to 100 mL of a solution containing Kansas. R and Amp R In LB shake flasks, incubate at 37°C until OD 600 When the bacterial concentration was between 0.6 and 0.8, 0.005 mM, 0.025 mM, 0.05 mM, 0.075 mM, and 0.1 mM IPTG were added respectively. The cells were incubated at 30°C for 12 hours, then centrifuged at 3000 g for 10 minutes to collect the cells. The cells were resuspended in an appropriate amount of transformation buffer (100 mM Tris-HCl containing 5% glycerol, pH 7.8). The bacterial concentration was adjusted to OD200 after resuspending. 600 =20, take 10 mL of bacterial culture into a shake flask, add 2.6 mM eugenol, and incubate at 30 °C with shaking. Based on the consumption of the substrate coniferaldehyde (yellow), add 2.6 mM eugenol approximately every 30 minutes. After 12 hours, take a sample for HPLC analysis. When the IPTG concentration is 0.025 mM, the yield of vanillin is 20.9 mM. See Figure 15 .

[0077] Screening of cosolvents The solubility of eugenol is affected by the solubility of the co-solvent. By changing the type of co-solvent and trying ethanol, methanol, and dimethyl sulfoxide (DMSO), and cultivating the product with an inducing agent (IPTG) concentration of 0.025 mM, the results showed that the yield of vanillin reached 22.57 mM when using DMSO, indicating that DMSO was the optimal co-solvent. (See below) Figure 16 , 17 .

[0078] 6. Summary and Explanation (1) Cinnamyl-CoA reductase (Ll-CCRH1) from Michelia alba can oxidize coniferaldehyde to feruloyl-CoA. Overexpression of vanillyl alcohol oxidase (VaoA), coniferol dehydrogenase (CalA), Ll-CCRH1 and enoyl-CoA hydratase (Ech) in Escherichia coli can convert eugenol into feruloyl-CoA and vanillin.

[0079] (2) Further knockout of the oxidoreductase gene in host Escherichia coli BW25113 yjgB and yqhD and choline dehydrogenase gene betA Subsequently, 0.57 mM vanillin was detected in the supernatant of the fermentation broth. Based on this, further knockout... ptsH Genes, simultaneously inserted into 119 promoters controlled by gltA The gene acquires the host Van-4. Van-4 hosts containing the vanillin synthesis pathway can produce 0.65 mM vanillin.

[0080] (3) After directed evolution of Ll-CCRH1, mutant 4955-1 was obtained. The mutant plasmid pYB1k-gap- ccr With pTrc99a- vaoA-calA-ech When the vanillin was electroporated and cultured in Van-4, the yield was 1.65 mM.

[0081] (4) When overexpressing VaoA and Ech proteins using the pTrc99a plasmid backbone, and overexpressing Ll-CCRH1 and CalA proteins using the pYB1k plasmid backbone after the gap promoter, the highest vanillin yield was observed. Finally, under the induction of 0.025 mM IPTG, the Van-4 strain was able to convert eugenol to 22.5 mM vanillin by adding DMSO dissolved in eugenol, with a conversion efficiency of over 90%.

[0082] The above embodiments of this application are merely illustrative examples to clearly illustrate the present application, and are not intended to limit the implementation of the present application. Those skilled in the art can make other variations or modifications based on the above description. It is neither necessary nor possible to exhaustively describe all possible implementations here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this application should be included within the scope of protection of the claims of this application. SEQUENCE LISTING <110> Institute of Microbiology, Chinese Academy of Sciences <120> A strain for producing vanillin and feruloyl-CoA, its construction method, and its applications. <130> 2022.02.07 <160> 9 <170> PatentIn version 3.3 <210> 1 <211> 831 <212> DNA <213> ech <400> 1 atgagcaaat atgaaggccg ctggtcaacc atcaaggtcg agatcgagca aggtatcgca 60 tgggtcatcc tcaatcggcc ggaaaaacgc aacgcgatga gcccgacctt gaaccgcgaa 120 atgatcgatg tgctggaaac cctcgagcag gatcccgatg cgggcgttct ggtgctgact 180 ggtgcgggcg aggcgtggac cgctggcatg gacctcaagg agtacttccg cgaggtagat 240 gccggaccgg aaattcttca ggaaaaaatc cgtcgcgaag cctcccagtg gcagtggaag 300 atgttgcgca tgtacgccaa gccgaccatc gccatggtca acggctggtg cttcggtggt 360 ggtttcagcc cgctggtggc ctgtgatctg gcgatctgcg ctgatgaagc gaccttcggc 420 cttcggaaa tcaactgggg tattccgccc ggcaacctgg tgagcaaggc catggcggac 480 accgtgggcc accgccagtc gctttactac atcatgaccg gcaaaacctt caacggtcag 540 aaggccgctg aaatgggcct cgtcaatgaa agcgtgccgc tggcgcaact gcgtcaggtg 600 accatcgatc tggccaacaa tctgctggaa aaaaatccgg tggtactgcg cgccgccaag 660 cacggcttca aacgctgccg cgaactgacc tgggagcaga acgaagacta cctgtacgcc 720 aaactcgacc agtcacgtct gctggacaag gaaggcgggc gcgagcaggg catgaagcag 780 ttcctcgatg acaagagcat caagcctggc cttgaagctt acaaacgcta g 831 <210> 2 <211> 1683 <212> DNA <213> VaoA <400> 2 atgagtaaga cccaggaatt tcgcccgctg accctgccgc cgaaactgag tctgagtgat 60 tttaatgagt ttattcagga tatcatccgc attgtgggca gtgaaaatgt tgaagttatt 120 agcagcaaag atcagattgt ggatggcagc tatatgaaac cgacccatac ccatgatccg 180 catcatgtta tggatcagga ttattttctg gccagcgcca ttgttgcacc gcgcaatgtt 240 gcagatgtgc agagtattgt tggcctggca aataagttta gttttccgct gtggccgatt 300 agtattggtc gtaatagcgg ttatggtggt gccgccccgc gtgtgagcgg tagcgtggtg 360 ttagatatgg gtaaaaatat gaatcgtgtg ctggaagtga atgtggaagg cgcatattgt 420 gttgttgaac cgggcgttac ctatcatgat ctgcataatt atctggaagc caataatctg 480 cgcgataaac tgtggctgga tgttccggat ctgggtggcg gtagcgtgct gggtaatgcc 540 gtggaacgtg gtgttggcta taccccgtat ggtgaccatt ggatgatgca tagtggtatg 600 gaagtggttc tggcaaatgg cgaactgctg cgtaccggta tgggtgcact gccggaccct 660 aaacgcccgg aaaccatggg cctgaaaccg gaagatcagc cgtggagcaa aattgcccat 720 ctgtttccgt atggctttgg cccgtatatt gatggcctgt ttagccagag tatatgggc 780 attgtgacca aaattggcat ttggctgatg ccgaatccgg gtggttatca gagttatctg 840 attaccctgc cgaaagatgg tgacctgaaa caggcagttg atattattcg tccgctgcgt 900 ctgggcatgg cactgcagaa tgtgccgacc attcgccata ttctgctgga tgcagccgtg ctgggcgata aacgcagtta tagtagtaa accgaaccgc tgagtgatga agaactggat aaaattgcca aacagctgaa tctgggtcgt tggaattttt atggcgcact gtatggtccg gaaccgattc gccgcgtgct gtgggaacc attackgctttagtgc cattccgggt gtgaaatttt attttccgga agataccccg gaaaatagtg ttctgcgtgt tcgtgataaa accatgcagg gtattccgac ctatgatgaa ctgaaatgga ttgattggct gccgaatggc gcacatctgt ttttcagtcc gattgccaaa gtgagtggcg aagatgccat gatgcagtat 1320 gccgttacca aaaaacgttg ccaggaagca ggtctggatt ttattggtac attcactgtg ggtatgcgcg aaatgcatca tattgtgtgt attgtgttta acaagaagga tctgattcag aaacgtaaag ttcagtggct gatgcgtacc ctgattgatg attgcgccgc caatggttgg ggtgaatatc gtacccatct ggcctttatg gatcagatta tggaaaccta taactggaat aatagcagct ttctgcgttt taatgaagtg ctgaaaaatg ccgttgatcc gaatggtatt attgcaccgg gtaaaagcgg tgtttggccg agccagtata gtcatgtgac ctggaaactg 1680 taa 1683 <210> 3 <211> 768 <212> DNA <213> CalA <400> 3 atgcagctga ccaacaaaaa gatcgtggtg accggcgtga gcagcggtat tggtgcagaa 60 accgcgcgtg tgctgcgtag ccacggtgca accgtgattg gtgtggatcg caacatgccg 120 agcctgactc tggatgcatt tgtgcaggcc gatctgagcc atccggaagg tattgataaaa 180 gcgattagcc agctgccgga aaaaattgat ggcctgtgca atattgccgg cgtgccgggt 240 actgcagatc cgcagctggt ggcaaatgtg aattatctgg gcctgaaata cctgaccgaa 300 gccgtgctga gccgtattca gccgggtggt tcaattgtga atgtgagcag cgtgctggggc 360 gcggagtggc cggcacgtct gcagctgcac aagggagctgg gttcagtggt gggttttagc 420 gaaggccagg cctggctgaa acagaatccg gttgcgccgg aattttgcta ccagtacttt 480 aaagaggccc tgattgtgtg gagccaggtg caagcacagg aatggtttat gcgtaccagc 540 gtgcgcatga attgcattgc gccgggtccg gtttttaccc cgattctgaa tgaatttgtg 600 accatgctgg gccaggaacg tacccaagca gatgcacatc gtattaagcg cccggcctac 660 gcagatgaag tggcagcagt tattgccttt atgtgcgcgg aagaaagccg ttggattaac 720 ggcattaata tcccggtgga tggcggcctg gccagcacct acgtgtaa 768 <210> 4 <211> 301 <212> DNA <213> Gap <400> 4 ttgctcattt aatcgtgctc acattacgtg actgattcta acaaaacatt aacaccaact 60 ggcaaaattt tgtcctaaac ttgatctcga cgaaatggct gcacctaatc acatttttat 120 cgtaattgcc ctttaaaatt cggggcgccg accccacatgtg gtctcaagcc caaaggaaga 180 gtgaggcgag tcagtcacag gattgatttg tcgcaatgat tgacacgatt ccgcttgacg 240 ctgcgtaagg tttttgtaat tttacaggca accttttat cactaacaaa tagctaggag 300 g 301 <210> 5 <211> 1284 <212> DNA <213> GltA <400> 5 atggctgata caaaagcaaa actcaccctc aacggggata cagctgttga actggatgtg 60 ctgaaaggca cgctgggtca agatgttatt gatatccgta ctctcggttc aaaaggtgtg 120 ttcacctttg acccaggctt cacttcaacc gcatcctgcg aatctaaaat tacttttatt 180 gatggtgatg aaggtatttt gctgcaccgc ggtttcccga tcgatcagct ggcgaccgat 240 tctaactacc tggaagtttg ttacatcctg ctgaatggtg aaaaaccgac tcaggaacag 300 tatgacgaat ttaaaactac ggtgacccgt cataccatga tccacgagca gattacccgt 360 ctgttccatg ctttccgtcg cgactcgcat ccaatggcag tcatgtgtgg tattaccggc 420 gcgctggcgg cgttctatca cgactcgctg gatgttaaca atcctcgtca ccgtgaaatt 480 gccgcgttcc gcctgctgtc gaaaatgccg accatggccg cgatgtgtta caagtattcc 540 attggtcagc catttgttta cccgcgcaac gatctctcct acgccggtaa cttcctgaat 600 atgatgttct ccacgccgtg cgaaccgtat gaagttaatc cgattctgga acgtgctatg 660 gaccgtattc tgatcctgca cgctgaccat gaacagaacg cctctacctc caccgtgcgt 720 accgctggct cttcgggtgc gaacccgttt gcctgtatcg cagcaggtat tgcttcactg 780 tggggacctg cgcacggcgg tgctaacgaa gcggcgctga aaatgctgga agaaatcagc 840 tccgttaaac acattccgga atttgttcgt cgtgcgaaag acaaaaatga ttctttccgc 900 ctgatgggct tcggtcaccg cgtgtacaaa aattacgacc cgcgcgccac cgtaatgcgt 960 gaaacctgcc atgaagtgct gaaagagctg ggcacgaagg atgacctgct ggaagtggct 1020 atggagctgg aaaacatcgc gctgaacgac ccgtacttta tcgagaagaa actgtacccg 1080 aacgtcgatt tctactctgg tatcatcctg aaagcgatgg gtattccgtc ttccatgttc 1140 accgtcattt tcgcaatggc acgtaccgtt ggctggatcg cccactggag cgaaatgcac 1200 agtgacggta tgaagattgc ccgtccgcgt cagctgtata caggatatga aaaacgcgac 1260 tttaaaagcg atatcaagcg ttaa 1284 <210> 6 <211> 159 <212> DNA <213> 119 <400> 6 cacagctaac accacgtcgt ccctatctgc tgcccgtggt tgctggataa cttgacagct 60 agctcagtcc taggtataat gctagcaggg agaccacaac ggtttccctc tacaaataat 120 tttgtttaac tttcgcgcgc gtaacaggag gaattaacc 159 <210> 7 <211> 1005 <212> DNA <213> Ll-CCRH1(wild type) <400> 7 atgcctgctg ccgcccccgc cgccgctaac accacctcat caggttccgg ccaaaccgtc 60 tgcgtcacag gcgccggtgg cttcatcgcc tcttggattg tcaagctctt gctagagaga 120 gactacactg tcagaggcac cgccagaaat ccagatgatt ctaagaacgc acacttaaaa 180 gagttggaag gagcagagga gaggctaact cttcataagg tggatcttct tgatctggaa 240 tctgtgaaag ctgctatcaa tggctgtgat ggcgtcattc acacggcttc tccagtcaca 300 gacaaccccg aagagatggt ggagccggcg gtgaatggag caaagaatgt gatcatcgca 360 gctgcagaag cgaaagtgag aagagtagtg ttcacgtcat ccattggagc cgtctacatg 420 gaccccagca ggaacattga tgaggtggtt gacgagtctt gctggagcaa tttggaatat 480 tgcaagacca caaagaactg gtattgctat gggaaggcag tggcagagca agcagcatgg 540 gatgaggcaa aagcaagagg ggtggatttg gttgtggtga atccagtttt ggtgttggga 600 ccattgcttc aaaccaccat gaatgcaagc acaattcaca tcctcaagta tctcactggc 660 tctgccaaga cctatgcaaa tgccactcag gcctatgttc atgttaagga tgttgcatta 720 gcccatgttc ttgtttacga gactccttct gcctccggtc gttatctatg ttccgagagt 780 tctctccacc gtggagaact ggtcgagatc ctcgccaaat atttcccaga atacccaatt 840 cctaccaaat gttcggacga gaagaatcca agagcaaaac cctacacatt ctctaacaag 900 aggctgaagg atttaggatt agagtttaca ccagtccatc agtgtctata cgacaccgtt 960 aagagcctgc aggacaaagg ccatcttcct cttcccacca agtaa 1005 <210> 8 <211> 2395 <212> DNA <213> pYB1k-gap <400> 8 aatgtgcctg tcaaatggac cctatgctac tccgtcaagc cgtcaattgt ctgattcgtt 60 accaattatg acaacttggt accttgctca catctcactt taatcgtgct cacattacgt 120 gactgattct aacaaaacat taacaccaac tggcaaaatt ttgtcctaaa cttgatctcg 180 acgaaatggc tgcacctaaa tcgtgatgaa aatcacattt ttatcgtaat tgccctttaa 240 aattcggggc gccgacccca tgtggtctca agcccaaagg aagagtgagg cgagtcagtc 300 gcgtaatgct taggcacagg attgatttgt cgcaatgatt gacacgattc cgcttgacgc 360 tgcgtaaggt ttttgtaatg tgaaacgccg tagcgccgat ggtagtgtgg ggtctcccca 420 tgcgagagta gggaactgcc aggcatcaaa taaaacgaaa ggctcagtcg aaagactggg 480 cctttcgtcg accatgcagc gctgtgcgtc agcagaatat gtgatacagg atatattccg 540 cttcctcgct cactgactcg ctacgctcgg tcgttcgact gcggcgagcg gaaatggctt 600 acgaacgggg cggagatttc ctggaagatg ccaggaagat acttaacagg gaagtgagag 660 ggccgcggca aagccgtttt tccataggct ccgcccccct gacaagcatc acgaaatctg 720 acgctcaaat cagtggtggc gaaacccgac aggactataa agataccagg cgtttccccc 780 tggcggctcc ctcgtgcgct ctcctgttcc tgcctttcgg tttaccggtg tcattccgct 840 gttatggccg cgtttgtctc attccacgcc tgacactcag ttccgggtag gcagttcgct 900 ccaagctgga ctgtatgcac gaaccccccg ttcagtccga ccgctgcgcc ttatccggta 960 actatcgtct tgagtccaac ccggaaagac atgcaaaagc accactggca gcagccactg 1020 gtaattgatt tagaggagtt agtcttgaag tcatgcgccg gttaaggcta aactgaaagg 1080 acaagttttg gtgactgcgc tcctccaagc cagttacctc ggttcaaaga gttggtagct 1140 cagagaacct tcgaaaaact gccctgcaag gcggtttttt cgttttcaga gcaagagatt 1200 acgcgcagac caaaacgatc tcaagaagat catcttatta atcagataaa atatttctag 1260 atttcagtgc aatttatctc ttcaaatgta gcacactcta gatttcagtg caatttatct 1320 cttcgcggcc gccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg 1380 agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagccatatt 1440 caacgggaaa cgtcttgctc taggccgcga ttaaattcca acatggatgc tgatttatat 1500 gggtataaat gggctcgcga taatgtcggg caatcaggtg cgacaatcta tcgattgtat 1560 gggaagcccg atgcgccaga gttgtttctg aaacatggca aaggtagcgt tgccaatgat 1620 gttacagatg agatggtcag actaaactgg ctgacggaat ttatgcctct tccgaccatc 1680 aagcatttta tccgtactcc tgatgatgca tggttactca ccactgcgat ccccgggaaa 1740 acagcattcc aggtattaga agaatatcct gattcaggtg aaaatattgt tgatgcgctg 1800 gcagtgttcc tgcgccggtt gcattcgatt cctgtttgta attgtccttt taacagcgac 1860 cgcgtatttc gtctcgctca ggcgcaatca cgaatgaata acggtttggt tgatgcgagt 1920 gattttgatg acgagcgtaa tggctggcct gttgaacaag tctggaaaga aatgcataaa 1980 cttttgccat tctcaccgga ttcagtcgtc actcatggtg atttctcact tgataacctt 2040 atttttgacg aggggaaatt aataggttgt attgatgttg gacgagtcgg aatcgcagac 2100 cgataccagg atcttgccat cctatggaac tgcctcggtg agttttctcc ttcattacag 2160 aaacggcttt ttcaaaaata tggtattgat aatcctgata tgaataaatt gcagtttcat 2220 ttgatgctcg atgagttttt ctaagaatta attcatgagc ggatacatat ttgaatgtat 2280 ttagaaaaat aaacaaatag gggttccgcg cacatttccc cgaaaagtgc cacttgcgga 2340 gacccggtcg tcagcttgtc gtcggttcag ggcagggtcg ttaaatagcg catgc 2395 <210> 9 <211> 4947 <212> DNA <213> pTrc99a-I <400> 9 gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc 60 ggaagctgtg gtagtggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc 120 gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc 180 tgaaatgagc tgttgacaat taatcatccg gctcgtataa tgtgtggaat tgtgagcgga 240 taacaatttc acacaggaaa cagaccatga gcaaatatga aggccgctgg tcaaccatca 300 aggtcgagat cgagcaaggt atcgcatggg tcatcctcaa tcggccggaa aaacgcaacg 360 cgatgagccc gaccttgaac cgcgaaatga tcgatgtgct ggaaaccctc gagcaggatc 420 ccgatgcggg cgttctggtg ctgactggtg cgggcgaggc gtggaccgct ggcatggacc 480 tcaaggagta cttccgcgag gtagatgccg gaccggaaat tcttcaggaa aaaatccgtc 540 gcgaagcctc ccagtggcag tggaagatgt tgcgcatgta cgccaagccg accatcgcca 600 tggtcaacgg ctggtgcttc ggtggtggtt tcagcccgct ggtggcctgt gatctggcga 660 tctgcgctga tgaagcgacc ttcggcctttt cggaatcaa ctggggtatt ccgcccggca acctggtgag caaggccatg gcggacaccg tgggccaccg ccagtcgctt tactacatca 780 840. tgaccggcaa aaccttcaac ggtcagaagg ccgctgaaat gggcctcgtc aatgaaagcg tgccgctggc gcaactgcgt caggtgacca tcgatctggc cacaatctg ctggaaaaaa atccggtggt actgcgcgcc gccaagcacg gcttcaaacg ctgccgcgaa ctgacctggg 960 agcagacga agactacctg tacgccaaac tcgaccagtc acgtctgctg agcagac gcggggcgcga gcagggcatg aagcagttcc tcgatgacaa gagcatcaag cctggccttg aagcttacaa acgctagggc tgttttggcg gatgagaga gattttcagc ctgatacaga ttaatcaga acgcagaagc ggtctgataa aacagaattt gcctggcggc agtagcgcgg tggtcccacc tgaccccatg ccgaactcag aagtgaaacg ccgtagcgcc gatggtagtg tggggtctcc ccatgcgaga gtagggaact gccaggcatc aaataaaacg aaaggctcag tcgaaagact gggcctttcg ttttatctgt tgtttgtcgg tgaacgctct cctgagtagg 1380 acaaatccgc cgggagcgga tttgaacgtt gcgaagcaac ggcccggagg gtggcgggca 1440 ggacgcccgc cataaactgc caggcatcaa attaagcaga aggccatcct gacggatggc 1500 ctttttgcgt ttctacaaac tctttttgtt tatttttcta aatacattca aatatgtatc 1560 cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaagg aagagtatga 1620 gtattcaaca tttccgtgtc gcccttattc ccttttttgc ggcattttgc cttcctgttt 1680 ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga agatcagttg ggtgcacgag 1740 tgggttacat cgaactggat ctcaacagcg gtaagatcct tgagagtttt cgccccgaag 1800 aacgttttcc aatgatgagc acttttaaag ttctgctatg tggcgcggta ttatcccgtg 1860 ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat gacttggttg 1920 agtactcacc agtcacagaa aagcatctta cggatggcat gacagtaaga gaattatgca 1980 gtgctgccat aaccatgagt gataacactg cggccaactt acttctgaca acgatcggag 2040 gaccgaagga gctaaccgct tttttgcaca acatggggga tcatgtaact cgccttgatc 2100 gttgggaacc ggagctgaat gaagccatac caaacgacga gcgtgacacc acgatgccta 2160 cagcaatggc aacaacgttg cgcaaactat taactggcga actacttact ctagcttccc 2220 ggcaacaatt aatagactgg atggaggcgg ataaagttgc aggaccactt ctgcgctcgg 2280 cccttccggc tggctggttt attgctgata aatctggagc cggtgagcgt gggtctcgcg 2340 gtatcattgc agcactgggg ccagatggta agccctcccg tatcgtagtt atctacacga 2400 cggggagtca ggcaactatg gatgaacgaa atagacagat cgctgagata ggtgcctcac 2460 tgattaagca ttggtaactg tcagaccaag tttactcata tatactttag attgatttaa 2520 aacttcattt ttaatttaaa aggatctagg tgaagatcct ttttgataat ctcatgacca 2580 aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa aagatcaaag 2640 gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac 2700 cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa 2760 ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg tagttaggcc 2820 accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc ctgttaccag 2880 tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac 2940 cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc agcttggagc 3000 gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc 3060 ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca 3120 cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc 3180 tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg 3240 ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct cacatgttct 3300 ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata 3360 ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa gcggaagagc 3420 gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc atatggtgca 3480 ctctcagtac aatctgctct gatgccgcat agttaagcca gtatacactc cgctatcgct 3540 acgtgactgg gtcatggctg cgccccgaca cccgccaaca cccgctgacg cgccctgacg 3600 ggcttgtctg ctcccggcat ccgcttacag acaagctgtg accgtctccg ggagctgcat 3660 gtgtcagagg ttttcaccgt catcaccgaa acgcgcgagg cagcagatca attcgcgcgc 3720 gaaggcgaag cggcatgcat ttacgttgac accatcgaat ggtgcaaaac ctttcgcggt 3780 atggcatgat agcgcccgga agagagtcaa ttcagggtgg tgaatgtgaa accagtaacg 3840 ttatacgatg tcgcagagta tgccggtgtc tcttatcaga ccgtttcccg cgtggtgaac 3900 caggccagcc acgtttctgc gaaaacgcgg gaaaaagtgg aagcggcgat ggcggagctg 3960 aattacattc ccaaccgcgt ggcacaacaa ctggcgggca aacagtcgtt gctgattggc 4020 gttgccacct ccagtctggc cctgcacgcg ccgtcgcaaa ttgtcgcggc gattaaatct 4080 cgcgccgatc aactgggtgc cagcgtggtg gtgtcgatgg tagaacgaag cggcgtcgaa 4140 gcctgtaaag cggcggtgca caatcttctc gcgcaacgcg tcagtgggct gatcattaac 4200 tatccgctgg atgaccagga tgccattgct gtggaagctg cctgcactaa tgttccggcg 4260 ttatttcttg atgtctctga ccagacaccc atcaacagta ttattttctc ccatgaagac 4320 ggtacgcgac tgggcgtgga gcatctggtc gcattgggtc accagcaaat cgcgctgtta 4380 gcgggcccat taagttctgt ctcggcgcgt ctgcgtctgg ctggctggca taaatatctc 4440 actcgcaatc aaattcagcc gatagcggaa cgggaaggcg actggagtgc catgtccggt 4500 tttcaacaaa ccatgcaaat gctgaatgag ggcatcgttc ccactgcgat gctggttgcc 4560 aacgatcaga tggcgctggg cgcaatgcgc gccattaccg agtccgggct gcgcgttggt 4620 gcggatatct cggtagtggg atacgacgat accgaagaca gctcatgtta tatcccgccg 4680 tcaaccacca tcaaacagga ttttcgcctg ctggggcaaa ccagcgtgga ccgcttgctg 4740 caactctctc agggccaggc ggtgaagggc aatcagctgt tgcccgtctc actggtgaaa 4800 agaaaaacca ccctggcgcc caatacgcaa accgcctctc cccgcgcgtt ggccgattca 4860 ttaatgcagc tggcacgaca ggtttcccga ctggaaagcg ggcagtgagc gcaacgcaat 4920 taatgtgagt tagcgcgaat tgatctg 4947

Claims

1. A strain that produces vanillin, said strain having: Overexpression of cinnamyl-CoA reductase CCR mutant, vanillyl oxidase VaoA, coniferyl dehydrogenase CalA, enoyl-CoA hydratase Ech and citrate synthase GlatA. The mutations in the cinnamyl-CoA reductase mutant are as follows: The proline at position 51 is replaced with serine; or The proline at position 51 is replaced with serine and the glycine at position 26 is replaced with glutamic acid; or The proline at position 51 is replaced with serine and the alanine at position 48 is replaced with aspartic acid; or Proline at position 51 is replaced with serine, glycine at position 26 is replaced with glutamic acid, and alanine at position 48 is replaced with aspartic acid. The strain is Escherichia coli; The cinnamyl-CoA reductase CCR is Ll-CCRH1 derived from Leuciscus.

2. The strain according to claim 1, characterized in that, The strain's genome is missing the oxidoreductase genes yjgB and yqhD, the choline dehydrogenase gene betA, and the ptsH gene.

3. The use of the strain of claim 1 or 2 and a product containing the strain in the production of vanillin.

4. A method for constructing the strain as described in claim 2, characterized in that, include: First, knock out the oxidoreductase gene on the strain's genome. yjgB Genes and yqhD Genes and choline dehydrogenase genes betA Genes and ptsH Gene; Then, citrate synthase was inserted into the strain genome. gltA Gene; Reconstruct containing ccr, vaoA, calA and ech Gene plasmids are transformed into host bacteria to obtain Δ- yjgB - yqhD - betA - ptsH -119- gltA strain; The cinnamoyl-CoA reductase CCR gene is then mutated, changing proline at position 51 to serine, glycine at position 26 to glutamic acid, and alanine at position 48 to aspartic acid.

5. The method for constructing the strain according to claim 4, wherein, The strain in question is an Escherichia coli K12 series strain.

6. The method for constructing the strain according to claim 5, wherein, The strain was Escherichia coli BW25113.

7. A method for preparing vanillin using the strain according to claim 1 or 2, characterized in that, The constructed containing ccr Mutant sequence ,vaoA,calA and ech The plasmid was transformed into the Δ- yjgB - yqhD - betA - ptsH -119- gltA From the strains, single colonies were picked and placed into test tubes containing kanamycin and ampicillin in LB medium and incubated at 37°C to obtain the culture medium; Using the culture medium as the seed culture, 1% by volume was transferred to an LB shake flask containing kanamycin and ampicillin, and incubated at 37°C. When OD... 600 When the concentration of the bacterial culture medium is 0.6-0.8, IPTG is added to induce vanillin expression. The culture is carried out at 30°C, and the bacterial cells are collected by centrifugation and resuspended. The resuspended bacterial culture is transferred to a shake flask and cultured with shaking at 30°C. Eugenol is added to the shake flask according to the consumption of the substrate coniferaldehyde.

8. A method for preparing vanillin using the strain according to claim 1 or 2, characterized in that, The constructed containing ccr Mutant sequence ,vaoA,calA and ech The plasmid was transformed into the Δ- yjgB - yqhD - betA -119- gltA From the strain, single colonies were picked and placed in test tubes containing 50 μg / ml kanamycin and 100 μg / ml ampicillin, and cultured at 37°C and 220 rpm for 12 h with shaking to obtain a culture medium. This culture medium was then used as a seed culture and transferred at a volume ratio of 1% to 100 ml LB medium containing 50 μg / ml kanamycin and 100 μg / ml ampicillin in shake flasks, and cultured at 37°C and 220 rpm with shaking. When the OD... 600 When the concentration of the bacterial culture reaches 0.6-0.8, 0.05 mM IPTG is added to induce vanillin production. The culture is then incubated at 30°C with shaking at 220 rpm for 12 hours. After this time, the bacterial cells are collected by centrifugation at 3000 g and 4°C and resuspended. The concentration of the resuspended bacterial culture is adjusted to OD0.

05. 600 =20, then take the bacterial culture into a shake flask, incubate at 30℃ and 220rpm with shaking, and add eugenol into the shake flask according to the consumption of the substrate coniferaldehyde.

9. The preparation method according to claim 7 or 8, further comprising: Constructing plasmid pYB1k-gap- ccr pYB1k-gap- CCR - calA pYB1k- ccr - calA pTrc99a- vaoA - calA - ech and pTrc99a- vaoA - ech ; The plasmids are then combined in pairs as shown in the table and transformed into the Δ- yjgB - yqhD - betA - ptsH -119- gltA Among the strains, the production of vanillin was compared to screen plasmid combinations. 。 10. The preparation method according to claim 7 or 8, further comprising: In the enoyl-CoA hydratase gene ech One to five arginine residues are inserted after the start codon of the gene.

11. The preparation method according to claim 10, wherein, Three arginine residues were inserted.

12. The preparation method according to claim 7 or 8, characterized in that, Ethanol, methanol and / or dimethyl sulfoxide were also used as cosolvents for eugenol.

13. The preparation method according to claim 12, wherein the co-solvent is dimethyl sulfoxide.

14. A strain that produces feruloyl-CoA, characterized in that the strain... have: Overexpression of cinnamyl-CoA reductase CCR mutant, vanillyl alcohol oxidase VaoA, and coniferyl alcohol dehydrogenase CalA; The mutations in the cinnamyl-CoA reductase mutant are as follows: The proline at position 51 is replaced with serine; or The proline at position 51 is replaced with serine and the glycine at position 26 is replaced with glutamic acid; or The proline at position 51 is replaced with serine and the alanine at position 48 is replaced with aspartic acid; or Proline at position 51 is replaced with serine, glycine at position 26 is replaced with glutamic acid, and alanine at position 48 is replaced with aspartic acid. The strain is Escherichia coli; The cinnamyl-CoA reductase CCR is Ll-CCRH1 derived from Leuciscus.

15. A method for preparing feruloyl-CoA, comprising: In the strain described in claim 14, the double bond of the eugenol side chain undergoes isomerization under the oxidation of vanillyl alcohol oxidase, and a hydroxyl group is introduced at the end to generate coniferyl alcohol. Coniferyl alcohol is further oxidized under the catalysis of coniferyl alcohol dehydrogenase, and the terminal hydroxyl group is converted into an aldehyde group. Finally, coniferyl alcohol is oxidized by cinnamyl-CoA reductase mutant, and CoA is introduced at the aldehyde group position at the end of the side chain to obtain feruloyl-CoA.

Images