Method for evaluating the immunogenicity of recombinant hepatitis b vaccine and constructed cell line

Abstract

The present application relates to the recombinant hepatitis B vaccine immunogenicity evaluation method and the cell strain constructed, one aspect, the method for constructing Huh-7-HBsAg cell strain stably expressing hepatitis B surface antigen (HBsAg) gene is provided, including constructing plasmid vector containing hepatitis B surface antigen HBsAg gene sequence, using HEK 293FT cell to carry out lentivirus package, using the gene overexpression lentivirus pHS-AVC-0612 of package completion to infect wild type Huh-7 cell strain, finally obtain Huh-7-HBsAg cell strain as HBsAg overexpression cell line stable strain.The present application first applies the cell strain constructed to the immunogenicity of the recombinant hepatitis B vaccine and evaluates, provides new method and cell model for the in vivo biological activity evaluation of the recombinant hepatitis B vaccine.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a cell line capable of stably expressing hepatitis B surface antigen (HBsAg), its construction, and its application in evaluating the immunogenicity of recombinant hepatitis B vaccines. Specifically, this invention involves constructing an overexpression lentiviral plasmid encoding the HBsAg gene, preparing, concentrating, and purifying the lentiviral solution using a second-generation lentiviral packaging system, infecting the Huh-7 cell line, and finally obtaining the first Huh-7-HBsAg cell line stably expressing the HBsAg gene through Puromycin resistance selection. Furthermore, this invention is the first to apply the constructed cell line to evaluate the immunogenicity of a recombinant hepatitis B vaccine, providing a new method for evaluating the in vivo biological activity of recombinant hepatitis B vaccines. It also provides a cell model and immunogenicity evaluation method for evaluating the biological activity of therapeutic vaccines, biosimilars, and HBV-engineered specific T-cell therapies. Background Technology

[0002] Hepatitis B (HBV) is an infectious disease primarily characterized by liver inflammation, caused by infection with the hepatitis B virus (HBV). Severe cases can progress to cirrhosis and liver cancer, and its incidence ranks among the top of major legally notifiable infectious diseases. Vaccination against HBV is the most effective means of preventing HBV infection. Since the first recombinant HBV vaccine, produced using genetic engineering technology and containing recombinant hepatitis B surface antigen (HBsAg) as its main bioactive component, was introduced in 1986, several recombinant HBV vaccines using *Saccharomyces cerevisiae*, *Hansenula polymorpha*, and CHO (Chinese hamster ovary) cells as expression cells have been approved for marketing. A search of the National Medical Products Administration website reveals 27 valid approval numbers for recombinant HBV vaccines. Since 2002, my country has included HBV vaccination in its national immunization program, administering a three-dose immunization schedule to all newborns. This has significantly reduced the number of HBV carriers and played a crucial role in controlling the prevalence of HBV.

[0003] Immunogenicity is a key indicator for evaluating the biological activity of a vaccine. The specific immunity induced after vaccination typically includes humoral immunity and cell-mediated immunity. The former is characterized by the production of specific antibodies against the antigen, while the latter is characterized by an immune response mediated by specific immune cells recognizing the target antigen. The current Chinese Pharmacopoeia evaluates the biological activity of recombinant hepatitis B vaccines by calculating the effect-response ratio (ED) after simultaneous immunization of animals with both the test vaccine and the reference vaccine. 50The ratio of serum antibody levels is used to indirectly obtain data on the relative potency of the vaccine. This method has certain limitations: serum antibody testing only reflects the effect of humoral immunity, and fails to effectively examine the effect on another important immune pathway—cell-mediated immunity; furthermore, as an indirect result, relative potency is significantly affected by the quality of the reference vaccine. Other relevant literature involving cell-mediated immunity induced by hepatitis B vaccines, such as Hu Zhongyu et al.'s "Comparison of Immune Response Characteristics Induced by Different Types of Recombinant Hepatitis B Vaccines," uses target cells that do not overexpress HBsAg to verify the effect of cell-mediated immunity, thus lacking specificity. Furthermore, the final method for measuring killing effect uses isotope labeling, requiring specialized radioactive experimental conditions, which is not conducive to widespread adoption. Therefore, it is necessary to establish a highly specific, easy-to-operate, and stable method to evaluate the immunogenicity of recombinant hepatitis B vaccines from the perspective of cell-mediated immunity. This would provide a scientific and effective evaluation tool for various hepatitis B vaccines under development and in production, as well as for the development of new hepatitis B vaccines in the future. It is also hoped that this new method can provide a cell model for evaluating the biological activity of other vaccines, including therapeutic vaccines, biosimilars, and engineered HBV-specific T-cell therapies.

[0004] Therefore, those skilled in the art expect to establish a method that can directly reflect the biological activity of a vaccine in vivo, especially a new method for evaluating the immunogenicity of recombinant hepatitis B vaccines. It is also expected that this new method can provide a cell model for evaluating the biological activity of novel drugs such as therapeutic vaccines, biosimilars, and HBV engineered specific T-cell therapies. Summary of the Invention

[0005] The purpose of this invention is to provide a method that can directly reflect the biological activity of a vaccine in vivo, particularly to establish a novel method for evaluating the immunogenicity of a recombinant hepatitis B vaccine. It is also hoped that this new method can provide a cell model for evaluating the biological activity of therapeutic vaccines, biosimilars, and engineered HBV-specific T-cell therapies. Based on the above objective, another objective of this invention is to provide a stable cell line transfected with the hepatitis B surface antigen gene for use in evaluating the immunogenicity of the recombinant hepatitis B vaccine. Furthermore, the objective of this invention is to provide a method for constructing the aforementioned stable cell line transfected with the hepatitis B surface antigen gene. This invention achieves at least one of the above objectives.

[0006] Therefore, the first aspect of the present invention provides a method for constructing a Huh-7-HBsAg cell line that stably expresses the hepatitis B surface antigen (HBsAg) gene, comprising the following steps:

[0007] (1) Provide the gene sequence of hepatitis B surface antigen (HBsAg) (e.g., as shown in SEQ ID No. 1);

[0008] (2) Provide a plasmid backbone vector that provides Puromycin resistance and carries the mNeongreen gene tag (e.g., ... Figure 1 (as shown);

[0009] (3) Construct a plasmid vector containing the hepatitis B surface antigen HBsAg gene sequence: pLV-hef1a-mNeongreen-P2A-Puro-WPRE-CMV-HBsAg;

[0010] (4) Lentiviral packaging was performed using HEK 293FT cells, the lentivirus was collected and concentrated to obtain a concentrated viral solution (the lentivirus can be called pHS-AVC-0612), and the viral titer of the concentrated viral solution was optionally determined.

[0011] (5) Resuscitate and culture Huh-7 cells;

[0012] (6) Perform lentiviral infection capacity tests on Huh-7 cells to determine the optimal lentiviral MOI value for Huh-7 cells (e.g., 1-20, 5-15, 10).

[0013] (7) Perform antibiotic Puromycin screening concentration tests on Huh-7 cells to determine the optimal drug screening concentration value (e.g., 1.0–3.0 μg / mL, 1.5–2.5 μg / mL, 2.0 μg / mL; drug treatment time for example, 2–5 days, 2–4 days, 72 hours).

[0014] (8) Wild-type Huh-7 cell lines were infected with packaged gene-overexpressing lentivirus pHS-AVC-0612, and then Puromycin was added for resistance screening. Drug screening was completed when all wild-type control cells died, and Huh-7-HBsAg cell lines were obtained, which were stable HBsAg overexpressing cell lines. Optionally, the obtained stable HBsAg overexpressing cell lines were passaged and expanded, and the cells were cryopreserved.

[0015] According to the method of the first aspect of the present invention, the upstream primer sequence used in step (3) for plasmid construction is shown in SEQ ID No. 2.

[0016] According to the method of the first aspect of the present invention, the downstream primer sequence used in step (3) for plasmid construction is shown in SEQ ID No. 3.

[0017] According to the method of the first aspect of the present invention, the sequencing primer sequence of the plasmid vector obtained in step (3) is G0154244-2-seqR:TCTGCCAATCAGGGAAGTAG.

[0018] According to the method of the first aspect of the present invention, in step (3) when constructing the plasmid, primers are first synthesized according to the gene sequence of HBsAg. After PCR amplification, gel electrophoresis is performed to detect whether the amplified band is correct. The correct band is then cut and recovered. After obtaining the recovered product, it is digested with the same restriction endonuclease as the backbone vector. The vector and the PCR product (target gene fragment) digestion product are subjected to agarose gel electrophoresis to recover the target band.

[0019] After obtaining the recovered product, ligation was performed using T4 ligase. 5 μl of the ligated product was transformed into 100 μl of competent cells, heat-shocked for 1 min in a 42°C metal bath, and rapidly pre-cooled on ice for 2 min. In a clean bench, 600 μl of antibiotic-free medium was added, and the cells were incubated at 37°C with shaking for 1 h. An appropriate amount of bacterial culture was spread onto plates containing the appropriate antibiotic and incubated upside down in a constant temperature incubator for 12-16 h. Positive clones were identified by colony PCR. 3-4 single colonies were selected and shaken overnight in 8 ml of LB broth with the appropriate antibiotic. Plasmid extraction was then performed using a plasmid extraction kit to complete the construction of the overexpressing lentivirus plasmid. Optionally, restriction endonucleases were used for restriction enzyme digestion and sequencing of the target gene to confirm that the constructed plasmid was completely identical to the target gene sequence. These plasmid construction procedures are all standard procedures in the field.

[0020] According to the method of the first aspect of the present invention, wherein in step (4) when performing lentivirus packaging, HEK 293FT cells are prepared using the following method: 5 × 10 6 HEK 293FT cells were passaged and seeded into 100 mm cell culture dishes and placed in an incubator at 37°C and 5% CO2 for 16-24 hours.

[0021] According to the method of the first aspect of the present invention, wherein in step (4) when performing lentivirus packaging, the lentivirus packaging system is transfected using the following method:

[0022] 1) Dilute the packaging plasmid mixture and lentivirus expression plasmid in the lentivirus packaging kit with ddH2O to a final concentration of 1.0 μg / μL plasmid solution;

[0023] 2) Take one 1.5 mL centrifuge tube (labeled tube A), and add 300 μL of Opti-MEM medium and 40 μL of LEpFect medium. TM After mixing the Transfection Reagent, let it stand at room temperature for 5 minutes.

[0024] 3) Take one 1.5 mL centrifuge tube (labeled as tube B), add 2.5 μL of lentivirus expression plasmid solution with a final concentration of 1.0 μg / μL and 7.5 μL of Package Plasmid Mix, and mix thoroughly.

[0025] 4) Add the solution from tube A to tube B, mix thoroughly, and let stand at room temperature for 15–30 minutes;

[0026] 5) Add the mixed solution in tube B dropwise to the culture dish inoculated with HEK 293FT cells. Gently shake the culture dish horizontally to mix. Place the culture dish at 37°C and 5% CO2 for 6 hours for transfection. Replace the culture medium with fresh complete culture medium preheated in a 37°C water bath. Continue transfection if necessary.

[0027] According to the method of the first aspect of the present invention, in step (4) when packaging the lentivirus, the lentivirus is collected and concentrated using the following method:

[0028] 1) 48 h after transfection, collect the supernatant containing lentivirus and add 15 mL of fresh complete culture medium to the culture dish; continue culturing for 24 h after transfection and collect the viral supernatant a second time.

[0029] 2) Mix the collected viral supernatants from both collections and filter through a 0.45 μm filter to obtain viral fluid. This viral fluid can be directly used to infect target cells. Typically, the viral fluid is concentrated using lentivirus concentrate using the following method and then stored at -80°C for later use:

[0030] 2a) Mix the virus supernatant and lentivirus concentrate at a ratio of 4:1 and incubate at 4°C for 2 hours;

[0031] 2b) Centrifuge the mixture at 4000g for 30 minutes at 4°C. A milky white precipitate will be visible at the bottom of the tube.

[0032] 2c) Carefully remove the supernatant, add an appropriate volume of PBS solution, and gently resuspend the precipitate by pipetting with a micropipette to obtain the virus concentrate;

[0033] 2d) Aliquot the virus concentrate and store it at -80℃.

[0034] According to the method of the first aspect of the present invention, in step (5), cell resuscitation and culture are performed as follows: frozen Huh-7 cells are rapidly thawed in a 37°C water bath, centrifuged at 900 rpm for 5 min, the supernatant is discarded, 5 ml of complete culture medium is added to resuspend the cells, and then the cells are transferred to a 6 cm culture dish and cultured in a 37°C, 5% CO2 incubator; when the cell confluence is approximately 90%, the cells are passaged. This resuscitation and culture method is also a conventional method in the art.

[0035] According to the method of the first aspect of the present invention, in step (6), the lentiviral infectivity of Huh-7 cells is tested using the following method: Huh-7 cells are collected after being digested with trypsin and centrifuged, the cells are resuspended and counted, and the cells are diluted to 2 x 10⁻⁶. 5 Cells were added at a density of 1 / ml to each well of a 24-well plate. 1 ml of complete culture medium was added to each well. After 24 h of cell adhesion and growth, the medium was replaced with fresh complete culture medium, and 1 μl of 8 mg / ml Polybrene, an infection-promoting reagent, was added. The MOI values ​​for each well were set to 0, 5, 10, 15, 20, 30, and 40, respectively. Green fluorescent control lentivirus was added. After 48 h of cell infection, the fluorescence expression of the cells was observed and photographed, and the optimal MOI value was selected.

[0036] According to the method of the first aspect of the present invention, in step (7), Huh-7 cells are screened for antibiotic Puromycin concentration using the following method: Huh-7 cells are collected after trypsin digestion and centrifugation, the cells are resuspended and counted, and the cells are diluted to 2 x 10⁻⁶. 5 Cells were cultured at a concentration of 0, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, and 4.0 μg / ml in 24-well plates. Cell growth was observed and photographed after 3–5 days of culture, and the optimal drug screening concentration was selected.

[0037] According to the method of the first aspect of the present invention, in step (8), the establishment of a stable HBsAg overexpression cell line is carried out by infecting wild-type Huh-7 cell line with packaged gene-overexpression lentivirus pHS-AVC-0612, wherein the infection method is 12-well plate seeding with 2 × 10⁶ cells. 5 On the second day after cell seeding, when the cell density reaches 30%-40%, calculate the required volume of virus solution per well based on the MOI obtained in the preliminary experiment and add the virus. On the third day, change the medium and continue culturing. On the fourth day, add Puromycin for resistance screening. Drug screening is completed when all control wild-type cells die, resulting in the Huh-7-HBsAg cell line, which is a stable HBsAg overexpression cell line. Optionally, use half the amount of resistance drug to passage and expand the stable HBsAg overexpression cell line obtained above, and then cryopreserve the cells.

[0038] According to the method of the first aspect of the present invention, the Huh-7-HBsAg cell line constructed therein, as expressed by qPCR and in terms of relative mRNA expression level, shows that the expression level of the target gene in the Huh-7-HBsAg cell line is increased by more than 10,000 times, for example, more than 20,000 times, for example, more than 30,000 times, or for example, more than 40,000 times compared with the control cell (wild-type) Huh-7-WT.

[0039] According to the method of the first aspect of the present invention, the binding activity of the Huh-7-HBsAg cell line constructed by the method with hepatitis B antibody was detected by enzyme-linked immunosorbent assay (ELISA), showing that the Huh-7 cell line was negative for hepatitis B antigen and the Huh-7-HBsAg cell line was positive for hepatitis B antigen.

[0040] Furthermore, a second aspect of the present invention provides a Huh-7-HBsAg cell line that stably expresses the hepatitis B surface antigen (HBsAg) gene.

[0041] According to the second aspect of the present invention, the Huh-7-HBsAg cell line, as detected by qPCR and expressed as relative mRNA expression level, shows that the expression level of the target gene in the Huh-7-HBsAg cell line is increased by more than 10,000 times, for example, more than 20,000 times, for example, more than 30,000 times, or for example, more than 40,000 times compared with the control cell (wild-type) Huh-7-WT.

[0042] According to the second aspect of the present invention, the Huh-7-HBsAg cell line, when tested for binding activity with hepatitis B antibodies using an enzyme-linked immunosorbent assay (ELISA), shows that the Huh-7 cell line is negative for hepatitis B antigen, while the Huh-7-HBsAg cell line is positive for hepatitis B antigen.

[0043] The Huh-7-HBsAg cell line according to the second aspect of the present invention is obtained by constructing using the method described in any one of the first aspects of the present invention.

[0044] Furthermore, a third aspect of the present invention provides a method for evaluating the immunogenicity of a recombinant hepatitis B vaccine, comprising performing a cell killing experiment and / or an apoptosis-inducing experiment using a Huh-7-HBsAg cell line constructed using any of the methods described in the first aspect of the present invention or a Huh-7-HBsAg cell line described in any of the methods described in the second aspect of the present invention, to determine the immunogenicity of the recombinant hepatitis B vaccine. Cell killing experiments and apoptosis-inducing experiments are commonly used methods for evaluating immune responses.

[0045] According to the method of the third aspect of the present invention, the recombinant hepatitis B vaccine is a recombinant hepatitis B vaccine obtained by expression in CHO cells or yeast cells (e.g., Saccharomyces cerevisiae or Hansenula polymorpha).

[0046] The technical effects of this invention include, but are not limited to: the stable cell line transfected with the hepatitis B surface antigen gene constructed in this invention can be used to evaluate the immunogenicity of recombinant hepatitis B vaccines. For the first time, by isolating mouse lymphocytes immunized with hepatitis B vaccine, the constructed stable transfected cell line was used to evaluate the immunogenicity of recombinant hepatitis B vaccines, providing a new method for detecting the in vivo biological activity of recombinant hepatitis B vaccines. Furthermore, in addition to evaluating the immunogenicity of recombinant hepatitis B vaccines, the Huh-7-HBsAg cell line can also serve as a cell model for studying the mechanism of action of new drugs for hepatitis B treatment, such as therapeutic vaccines, biosimilars, and engineered HBV-specific T-cell therapies. Further research on the effects of drugs or therapies on cell apoptosis and other aspects can be conducted to understand their deeper mechanisms of action. Attached Figure Description

[0047] Figure 1 : Plasmid vector.

[0048] Figure 2 : Results of recombinant plasmid digestion verification.

[0049] Figure 3 : Results of target gene sequencing and alignment.

[0050] Figure 4 : Fluorescent expression microscopy image during the packaging process of overexpressed lentivirus.

[0051] Figure 5 Fluorescence micrographs of cells infected with lentiviruses of different MOI values ​​48 hours later.

[0052] Figure 6 Fluorescence microscopy images of pre-screening cells for resistance at different final concentrations of Puromycin.

[0053] Figure 7 Fluorescence micrograph of cell lines after Puromycin resistance selection.

[0054] Figure 8 The graph shows the cell adhesion and proliferation (cell index) curves. Line 1 represents the Huh-7-HBsAg cell line, line 2 represents the Huh-7-HBsAg cell line plus control immune cells, line 3 represents the Huh-7-HBsAg cell line plus immune cells (splenic lymphocytes from mice immunized with recombinant hepatitis B vaccine (CHO cell expression), line 4 represents the Huh-7-HBsAg cell line plus immune cells (splenic lymphocytes from mice immunized with recombinant hepatitis B vaccine (yeast cell expression), and line 5 represents control immune cells.

[0055] Figure 9 Flow cytometry for detecting apoptosis profiles. Detailed Implementation

[0056] The present application can be further described through the following embodiments; however, the scope of the present application is not limited to the following embodiments. Those skilled in the art will understand that various changes and modifications can be made to the present application without departing from its spirit and scope. The present application provides a general and / or specific description of the materials and methods used in the experiments. Although many materials and operating methods used to achieve the purposes of this application are well known in the art, they are still described in as much detail as possible herein. The following embodiments further illustrate the present application, but are not intended to limit it. The preparation or operating steps described below are for illustrative purposes and are specifically described based on the comparability of the examples. Those skilled in the art can fully generalize from these examples to obtain the products or methods involved in this application based on existing knowledge. Some of the instruments, equipment, reagents, and reagents used in this invention are commonly used in the art and are readily available from commercial sources.

[0057] Example 1: Construction of Huh-7-HBsAg cell line stably expressing hepatitis B surface antigen (HBsAg) gene

[0058] 1.1. Gene Sequence

[0059] The gene sequence of hepatitis B surface antigen (HBsAg) is shown in SEQ ID No. 1:

[0060] SEQ ID No. 1: ATGGAGAGCACAACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGG GTTTTTCTTGTTGACAAGAATCCTCACAATACCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCACCCACGTGTCCTGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAATTTGTCCTGGCTATCGCTGGATGTGTCTGCGGCGTTTTATCATATTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTACCAAGGTATGTTGCCCGTTTGTCCTCTACTTCCAGGAACATCAACTACCAGCACGGGACCATGCAAGACCTGCACGATTCCTGCTCAAGGAACCTCTATGTTTCCCTCTTGTTGCTGTACAAAACCTTCGGACGGAAACTGCACTTGTATTCCCATCCCATCATCCTGGGCTTTCGCAAGATTCCTATGGGAGTGGGCCTCAGTCCGTTTCTCCTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGCAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAACATCTTGAGTCCCTTTTTACCTCTATTACCAATTTTCTTTTGTCTTTGGGTATACATTTGA

[0061] 1.2. Plasmid backbone vector

[0062] The plasmid backbone vector is Puromycin-resistant, carrying the green fluorescent protein mNeongreen gene tag, and the plasmid vector is as shown in Figure 1 .

[0063] 1.3. Plasmid Construction

[0064] Primer information:

[0065] Forward primer sequence, SEQ ID No. 2: TTAGTGAACCGTCAGATCCAGTAGGGCCACCATGGAGAGCACAACATCAGGATTCC

[0066] Downstream primer sequence, SEQ ID No. 3: TAAAAAGTGGCTAAGATCTACAGCTGTCAAATGTATACCCAAAGACAAAAG

[0067] Primers were synthesized using conventional methods in the art. After PCR amplification, gel electrophoresis was performed to check the accuracy of the amplified bands. Correct bands were then excised and recovered. The recovered products were digested with the same restriction endonuclease as the backbone vector. The vector and PCR products (target gene fragments) were then subjected to agarose gel electrophoresis, and the target band was recovered.

[0068] After obtaining the recovered product, ligation was performed using T4 ligase. 5 μl of the ligated product was transformed into 100 μl of competent cells, heat-shocked for 1 min in a 42°C metal bath, and rapidly pre-cooled on ice for 2 min. In a clean bench, 600 μl of antibiotic-free medium was added, and the cells were incubated at 37°C with shaking for 1 h. An appropriate amount of the bacterial culture was spread onto plates containing the appropriate antibiotic and incubated upside down in a constant temperature incubator for 12-16 h. Positive clones were identified by colony PCR. Three to four single colonies were selected and shaken overnight in 8 ml of LB broth (appropriate antibiotic medium). Plasmid extraction was then performed using a plasmid extraction kit to complete the construction of the overexpressing lentiviral plasmid. Finally, restriction endonuclease digestion and sequencing of the target gene were performed for identification of the plasmid and its target gene.

[0069] Verification via plasmid digestion, such as Figure 2 The recombinant plasmid digestion results shown indicate that a vector containing the hepatitis B surface antigen (HBsAg) gene sequence, pLV-hef1a-mNeongreen-P2A-Puro-WPRE-CMV-HBsAg, was constructed.

[0070] Sequencing primer sequence G0154244-2-seqR: TCTGCCAATCAGGGAAGTAG

[0071] The sequencing results were compared, and the target gene sequencing comparison results are as follows: Figure 3 As shown, the constructed plasmid is completely identical to the target gene sequence.

[0072] 1.4. Lentiviral Packaging

[0073] 1.4.1.HEK 293FT cell preparation

[0074] 5×10 6HEK 293FT cells (a transformed cell line with the pCMV-SPORT6-TAg.Neo plasmid inserted into the 293F cell line, capable of rapid proliferation and easy transfection, commonly used for lentivirus production) were passaged and seeded into 100mm cell culture dishes, and incubated at 37°C with 5% CO2 for 16-24 hours. During passage, the cells need to be thoroughly digested into a single-cell suspension to achieve better packaging results.

[0075] 1.4.2. Lentiviral Packaging System Transfection

[0076] 1) Package the lentivirus kit (BioGeek) TM The package plasmid mix and lentiviral expression plasmid in the sample were diluted with ddH2O to a final concentration of 1.0 μg / μL.

[0077] 2) Take one 1.5 mL centrifuge tube (labeled tube A), and add 300 μL of Opti-MEM medium and 40 μL of LEpFect medium. TM After mixing the Transfection Reagent, let it stand at room temperature for 5 minutes.

[0078] 3) Take one 1.5 mL centrifuge tube (labeled as tube B), add 2.5 μL of lentivirus expression plasmid solution with a final concentration of 1.0 μg / μL and 7.5 μL of Package Plasmid Mix, and mix thoroughly.

[0079] 4) Add the solution from tube A to tube B, mix thoroughly, and let stand at room temperature for 15–30 minutes;

[0080] 5) Add the mixed solution from tube B dropwise and evenly to the culture dish inoculated with HEK 293FT cells. Gently shake the culture dish horizontally to mix. Incubate the culture dish at 37°C with 5% CO2 for 6 hours for transfection. Replace the culture medium with fresh complete culture medium preheated to 37°C. Continue incubation and transfection if necessary. Figure 4 As shown, a fluorescence expression microscope image is displayed during the packaging process of the overexpressed lentivirus.

[0081] 1.4.3. Lentiviral Collection and Concentration

[0082] 1) 48 h after transfection, collect the supernatant containing lentivirus and add 15 mL of fresh complete culture medium (DMEM + 10% FBS) to the culture dish; continue culturing for 24 h after transfection and collect the virus supernatant a second time.

[0083] 2) Mix the collected viral supernatants from both collections and filter through a 0.45 μm filter to obtain viral fluid. This viral fluid can be directly used to infect target cells. Typically, the viral fluid is concentrated using lentivirus concentrate using the following method and then stored at -80°C for later use:

[0084] 2a) Mix the virus supernatant and lentivirus concentrate at a ratio of 4:1 and incubate at 4°C for 2 hours;

[0085] 2b) Centrifuge the mixture at 4000g for 30 minutes at 4°C. A milky white precipitate will be visible at the bottom of the tube.

[0086] 2c) Carefully remove the supernatant, add an appropriate volume of PBS solution, and gently resuspend the precipitate by pipetting with a micropipette to obtain the virus concentrate;

[0087] 2d) Aliquot the virus concentrate and store it at -80℃.

[0088] The lentivirus preservation solution is a clear liquid. Using a 20-200 μL pipette, slowly aspirate 50 μL of the lentivirus preservation solution; there should be no obvious viscosity or lag in aspiration. The lentivirus concentrate used in step 2a) above is prepared as follows: Weigh 4.38 g of sodium chloride and 25 g of polyethylene glycol 8000, dissolve in ultrapure water to prepare 100 ml, autoclave at 121°C for 30 min to obtain the lentivirus concentrate, and store at 4°C for later use. Unless otherwise specified, the PBS solution described herein is prepared as follows: Weigh 8.850 g of sodium chloride, 0.226 g of sodium dihydrogen phosphate (NaH2PO4·2H2O), and 1.698 g of disodium hydrogen phosphate (Na2HPO4·12H2O), dissolve in an appropriate amount of water, adjust the pH to 7.2, and dilute with water to 1000 ml.

[0089] 1.4.4. Virus titer determination

[0090] 1) Cell seeding: After digesting and counting healthy HEK 293H cells, seed them at a rate of 1×10⁻⁶. 5 Cells were seeded into 12-well culture plates, with each virus seeded into 3 wells, and incubated at 37°C with 5% CO2 for 20 hours.

[0091] 2) Viral infection: Take 20 μL of the concentrated virus solution obtained in step 2c) of “1.4.3. Lentiviral collection and concentration”, dilute it 10 times, and take 100 / 50 / 25 μL respectively. Add it to a 12-well plate inoculated with HEK 293H cells, and add Polybrene, an infection-promoting reagent with a final concentration of 8 μg / mL. After mixing the culture medium, incubate at 37℃ and 5% CO2 for 48 h.

[0092] 3) Titer determination: Genomic DNA was extracted from HEK 293H cells infected with the above-mentioned lentivirus, and the DNA standard with a known copy number was diluted (10⁻⁶). 4 ~10 9 The titer of the lentivirus solution can be determined by performing qRT-PCR detection simultaneously with the genome (copies / μL).

[0093] In Sections 1.4.1 to 1.4.4 above, the viral titer of the viral concentrate obtained in step 2c) of “1.4.3. Lentiviral Collection and Concentration” was determined to be 3.48e+0.8TU / mL. In a test called Supplementary Test a, the procedure was the same as in Sections 1.4.1 to 1.4.4 above, except that 2.5g of dextran 20 and 2g of propylene glycol were added along with polyethylene glycol during the preparation of the lentivirus concentrate. In step 2a), the lentivirus concentrate with the added additives was used to concentrate the lentivirus, and then the titer of the viral concentrate obtained in the following step 2c) was measured. The viral titer was 14.26e+0.8TU / mL, which was unexpectedly significantly higher than the titer of the conventional concentrate. Unless otherwise stated, the lentivirus obtained in this Supplementary Test a will be used in subsequent tests below. In a test called Supplementary Test b, the procedure described in Sections 1.4.1 to 1.4.4 above is followed, except that 2.5 g of dextran 20 is added to the polyethylene glycol during the preparation of the lentivirus concentrate. In step 2a), the lentivirus concentrate with the added additive is used for lentivirus concentration. The titer of the resulting virus concentrate in step 2c) is then measured, and the viral titer is 4.14e+0.8 TU / mL. In a test called Supplementary Test c, the procedure described in Sections 1.4.1 to 1.4.4 above is followed, except that 2 g of propylene glycol is added to the polyethylene glycol during the preparation of the lentivirus concentrate. In step 2a), the lentivirus concentrate with the added additive is used for lentivirus concentration. The titer of the resulting virus concentrate in step 2c) is then measured, and the viral titer is 3.27e+0.8 TU / mL. Therefore, in any embodiment of the present invention, the lentivirus concentrate used for lentivirus concentration can be prepared using any of the above methods.

[0094] 1.5. Cell resuscitation culture

[0095] Frozen Huh-7 cells (human hepatocellular carcinoma cells, source: Cancer Institute, Chinese Academy of Medical Sciences) were rapidly thawed in a 37°C water bath, centrifuged at 900 rpm for 5 min, the supernatant was discarded, and the cells were resuspended in 5 ml of complete culture medium. The cells were then transferred to 6 cm culture dishes and cultured in a 37°C, 5% CO2 incubator. Once the cell confluence reached approximately 90%, the cells were passaged.

[0096] 1.6. Preliminary experiments with lentiviral cell infection

[0097] Different cell types have varying lentiviral infectivity, therefore, it is necessary to test the lentiviral infectivity of Huh-7 cells. The specific experimental steps are as follows:

[0098] Collect Huh-7 cells after trypsin digestion and centrifugation, resuspend and count the cells, and dilute the cells to 2 x 10⁻⁶. 5 Cells were cultured at a concentration of 1 / ml and added to each well of a 24-well plate. After 24 hours of cell adhesion and growth, the medium was replaced with fresh complete medium, and 1 μl of 8 mg / ml Polybrene (an infection promoter) was added. The MOI values ​​for each well were set to 0, 5, 10, 15, 20, 30, and 40. A green fluorescent control lentivirus was added. After 48 hours of cell infection, the fluorescence expression of the cells was observed and photographed, and the optimal MOI value was selected. Figure 5 The fluorescence micrographs of cells infected with lentiviruses at different MOI values ​​48 hours later show that the optimal MOI value for Huh-7 cells is 10.

[0099] 1.7. Preliminary Experiment for Cellular Resistance Screening

[0100] Different cell types exhibit varying sensitivities to antibiotics; therefore, antibiotic selection concentration testing is necessary for Huh-7 cells. The specific experimental steps are as follows:

[0101] Collect Huh-7 cells after trypsin digestion and centrifugation, resuspend and count the cells, and dilute the cells to 2 x 10⁻⁶. 5 Cells were cultured at a concentration of 0, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, and 4.0 μg / ml in 24-well plates. Cell growth was observed and photographed after 3–5 days, and the optimal drug screening concentration was selected. Figure 6 The fluorescence micrographs showing different final concentrations of Puromycin in the cells indicate that the optimal Puromycin screening concentration for Huh-7 cells is 2.0 μg / mL, and the treatment time is 72 h.

[0102] 1.8. Establishment of stable HBsAg overexpression cell lines

[0103] Wild-type Huh-7 cell lines were infected using packaged gene-overexpressing lentivirus pHS-AVC-0612. The infection method was 12-well plate seeding with 2 × 10⁶ cells per well. 5On the second day after cell plating, when the cell density reaches 30%-40%, calculate the required volume of virus solution per well based on the MOI obtained in the preliminary experiment and add the virus. On the third day, change the medium and continue culturing. On the fourth day of culture, add Puromycin for resistance screening. When all control wild-type cells die, the drug screening is completed, and Huh-7-HBsAg cell line is obtained, which is a stable HBsAg overexpression cell line.

[0104] The cells can then be passaged and expanded using a 50% reduction in the amount of antibiotic resistance, and then cryopreserved.

[0105] Fluorescence microscopy images of cell lines after Puromycin resistance selection are shown below. Figure 7 As shown.

[0106] Fluorescence microscopy images showed that after infection of wild-type cells with the target virus and selection with Puromycin, all wild-type cells died, while the overexpressing cell lines were in good condition, indicating successful virus infection.

[0107] Example 2: Validation of stable HBsAg overexpression cell lines

[0108] The stable HBsAg overexpression cell line obtained in Example 1 can be detected by qPCR, and the binding activity of Huh-7-HBsAg cell line with hepatitis B antibody can be detected by enzyme-linked immunosorbent assay to verify the HBsAg gene expression.

[0109] 1. qPCR detection of HBsAg gene expression in target cells

[0110] Huh-7-HBsAg cells in good growth condition and wild-type Huh-7 cells (Huh-7-WT) were collected. Total RNA was extracted from the cells using the TRIZOL method and reverse transcribed into cDNA using a reverse transcription kit. The expression of the target gene HBsAg was then detected by qPCR using the cDNA as a template. Primer information is shown below:

[0111] HBsAg GCAAGACCTGCACGATTCCT CTGAGCCAGGAGAAACGGAC 160bp Target gene GAPDH TGACTTCAACAGCGACACCCA CACCCTGTTGCTGTAGCCAAA 121bp Internal reference gene

[0112] The qPCR results are as follows, expressed as the mean and standard deviation of relative mRNA expression levels:

[0113]

[0114] The results showed that the expression level of the target gene in the target cells Huh-7-HBsAg was increased by about 48,000 times compared with the control cells Huh-7-WT, and the overexpression effect was obvious and the difference was significant (p<0.05).

[0115] 2. Enzyme-linked immunosorbent assay (ELISA) to detect the binding activity of Huh-7-HBsAg cell line with hepatitis B antibody.

[0116] Reagent Kit Information: Hepatitis B Surface Antigen Reagent Kit (Wantai Biopharmaceutical, Batch No.: B20220729)

[0117] The Huh-7-HBsAg cells and Huh-7-WT cells obtained in Example 1 were seeded into 96-well plates (2×10⁶ cells) included in the kit, respectively. 4 Incubate overnight in cells (number of cells / well), wash twice with serum-free culture medium, and once with PBS. Fix with 4% paraformaldehyde at room temperature for 15 minutes, wash three times with wash buffer, incubate with 0.02% Triton X-100 for 5 minutes to permeate the cell membrane, and add 10% normal horse serum to block non-specific sites. Use the controls provided in the kit to set up 3 wells for a positive control and 2 wells for a negative control. Incubate at room temperature for 40 minutes, and wash 5 times with wash buffer. Add 50 μl of the enzyme-labeled secondary antibody provided in the kit, incubate at 37°C in the dark for 30 minutes, and wash 5 times with wash buffer. Add chromogenic solution A and chromogenic solution B respectively, incubate at room temperature for 10 minutes, and then add stop solution to terminate the reaction.

[0118] The results showed that the Huh-7-WT cells were negative for hepatitis B antigen; the constructed Huh-7-HBsAg cell line was positive for hepatitis B antigen, and it had specific binding activity with hepatitis B antibody.

[0119] Conclusion on the construction of stable cell line: Based on the two verification results in Example 2, the construction of a stable HBsAg overexpression cell line was successful. This cell line is stored in the Virus and Vaccine Laboratory of Beijing Institute for Drug Control.

[0120] Example 3: Application of the Huh-7-HBsAg cell line stably expressing the hepatitis B surface antigen (HBsAg) gene: Immunogenicity evaluation of recombinant hepatitis B vaccine using cell killing assays

[0121] Implementation principle:

[0122] Using the Huh-7-HBsAg cell line as the target cell line, mouse lymphocytes (isolated using a lymphocyte isolation kit) immunized with hepatitis B vaccine were added. The cell adhesion and growth were measured using an xCELLigence RTCA Instrument (displayed as cell index) to detect the proliferation curve, thereby reflecting the killing effect of immune cells on target cells and achieving the purpose of directly evaluating the in vivo biological activity of the vaccine.

[0123] Experimental procedure:

[0124] Collect Huh-7-HBsAg cell lines in good growth condition, digest with trypsin, centrifuge, resuspend the cells, count them, and dilute the cells to 5x10⁻⁶. 4Cells / ml available. Add 50 μl of complete culture medium to the wells of the E-Plate 16 culture plate provided with the instrument. Place the E-Plate 16 culture plate on the xCELLigence RTCA Instrument to check contact and detect baseline. Remove the E-Plate 16 culture plate and add 100 μl of well-mixed Huh-7-HBsAg cell suspension to the wells. Add an equal volume of culture medium to the mouse spleen lymphocyte control group. Detect cell adhesion and growth overnight (displayed as cell index by the instrument) and plot the cell proliferation curve.

[0125] The following day, spleens were isolated from mice 28 days after subcutaneous immunization with three different types of recombinant hepatitis B vaccines (CHO cell expression, Saccharomyces cerevisiae expression, and Hansenula polymorpha expression, all commercially available and meeting pharmacopoeia standards). Spleen cell suspensions were prepared, and lymphocytes were isolated using a mouse spleen lymphocyte separation kit to prepare lymphocyte suspensions as immune cells. Spleens from mice 28 days after subcutaneous injection of only aluminum adjuvant were also isolated using the same method, and lymphocyte suspensions were prepared as control immune cells. xCELLigence RTCA Instrument assays were paused, and the immune cell concentration was counted and adjusted to 3 x 102. 6 Cells / ml were prepared for use. 50 μl of immune cell and control immune cell suspensions were added to an E-Plate 16 culture plate. The E-Plate 16 culture plate was placed on an xCELLigence RTCA Instrument to further monitor cell adhesion and growth (displayed as cell index), and a cell proliferation curve was plotted. The effect of immune cells on the growth of Huh-7-HBsAg cells reflects the killing ability of immune cells against hepatitis B antigen-transfected cell lines.

[0126] Figure 8The cell index curves show the effects of different immune cells on the growth of Huh-7-HBsAg cells. In the figure, line 1 represents the Huh-7-HBsAg cell line; line 2 represents the Huh-7-HBsAg cell line plus control immune cells; line 3 represents the Huh-7-HBsAg cell line plus immune cells (splenic lymphocytes from mice immunized with recombinant hepatitis B vaccine (CHO cell expression)); line 4 represents the Huh-7-HBsAg cell line plus immune cells (splenic lymphocytes from mice immunized with recombinant hepatitis B vaccine (yeast cell expression)); and line 5 represents control immune cells. Cell index (Cell Index) A lower Index (CI) value indicates a lower number of adherent and proliferating cells. Results showed that isolated suspension of mouse spleen lymphocytes did not cause changes in the CI value; spleen lymphocytes from mice immunized with hepatitis B vaccines expressed in CHO cells and yeast exhibited strong cytotoxic effects against the Huh-7-HBsAg cell line; aluminum adjuvant immunization of mice resulted in short-term cytotoxicity of the Huh-7-HBsAg cell line, after which the cell line evaded immune responses. Aluminum adjuvant immunization of mice did not elicit a specific immune response against the hepatitis B virus; therefore, the Huh-7-HBsAg cell line experienced transient non-specific cytotoxicity and subsequently evaded immune responses. Figure 8 The yeast cells used in the experiment were *Saccharomyces cerevisiae* vaccine. When *Hansenula polymorpha* vaccine was used in the same experiment, it also showed similar results. Figure 8 Similar results.

[0127] The aforementioned cell killing experiment is the first to evaluate the in vivo biological activity of a vaccine by constructing a stable Huh-7-HBsAg cell line expressing hepatitis B surface antigen, thus providing a new method for a more comprehensive evaluation of vaccine immunogenicity.

[0128] Example 4: Application of the Huh-7-HBsAg cell line stably expressing the hepatitis B surface antigen (HBsAg) gene: Immunogenicity evaluation of recombinant hepatitis B vaccine using apoptosis-inducing assays.

[0129] Implementation principle:

[0130] Using the Huh-7-HBsAg cell line as the target cell line, mouse lymphocytes (obtained using a lymphocyte isolation kit) immunized with hepatitis B vaccine were added. The apoptosis level of the target cells was detected by flow cytometry, which served as an indicator for evaluating the in vivo biological activity of the vaccine.

[0131] Experimental procedure:

[0132] Collect Huh-7-HBsAg cells in good growth condition, digest with trypsin, centrifuge, resuspend and count the cells, and seed them in 6-well plates, so that each well contains 5 x 10⁶ cells. 6Cells were cultured overnight. Two types of immune cells (obtained after immunizing mice with CHO cell expression vaccine and yeast cell expression vaccine) and control immune cells, as described in Example 3, were added to kill the Huh-7-HBsAg cell line. Cells were cultured at 37°C for 2 days, washed twice with serum-free culture medium, and once with PBS to remove dead cells and non-adherent lymphocytes. Cells were digested with trypsin, washed twice with PBS, and then treated with pre-prepared 1×Annexin V Binding Solution to a final concentration of 1x10⁻⁶. 6 For a cell suspension of 100 μl / ml, add 100 μl of the cell suspension to a new tube, then add 5 μl of Annexin V, 633 binder, and 5 μl of PI solution. Incubate at room temperature in the dark for 15 min, then add 400 μl of 1×Annexin V Binding Solution and perform flow cytometry analysis within 1 hour.

[0133] like Figure 9 The flow cytometry analysis of apoptosis patterns is shown below. Forty-eight hours after in vitro cell killing, the apoptosis rate of Huh-7-HBsAg cells was as follows: The late apoptosis rate of Huh-7-HBsAg cells induced by control immune cells (injected only with aluminum adjuvant) was 7.5%; the late apoptosis rate of Huh-7-HBsAg cells induced by immune cells obtained from animals immunized with recombinant hepatitis B vaccine expressed in (Saccharomyces cerevisiae) cells was 19.2%; and the late apoptosis rate of Huh-7-HBsAg cells induced by immune cells obtained from animals immunized with recombinant hepatitis B vaccine expressed in CHO cells was 25.0%. In an additional experiment, using immune cells obtained from animals vaccinated with Hansenula polymorpha vaccine in the same manner, the late apoptosis rate of Huh-7-HBsAg cells was 21.4%. The apoptosis-inducing effect of spleen lymphocytes on Huh-7-HBsAg cell lines after immunization with hepatitis B vaccine expressed in CHO cells and hepatitis B vaccine expressed in yeast cells was significantly enhanced compared to the control immune cells.

[0134] The above experiments provide a novel method for evaluating vaccine immunogenicity from the perspective of inducing apoptosis. Furthermore, in addition to assessing the immunogenicity of recombinant hepatitis B vaccines, the Huh-7-HBsAg cell line can also serve as a cell model for studying the mechanisms of action of new drugs for hepatitis B treatment, such as therapeutic vaccines, biosimilars, and engineered HBV-specific T-cell therapies. Further research into the deeper mechanisms of action of these drugs or therapies, particularly regarding apoptosis, can be conducted.

Claims

1. A method for constructing a stable Huh-7-HBsAg cell line expressing the hepatitis B surface antigen gene, comprising the following steps: (1) Provide the gene sequence of hepatitis B surface antigen; (2) Provide a plasmid backbone vector that provides Puromycin resistance and carries the mNeongreen gene tag of green fluorescent protein; (3) Construct a plasmid vector containing the hepatitis B surface antigen HBsAg gene sequence: pLV-hef1a-mNeongreen-P2A-Puro-WPRE-CMV-HBsAg; (4) Lentiviral packaging was performed using HEK 293FT cells, lentivirus was collected and concentrated to obtain viral concentrate, and the viral titer of the viral concentrate was determined. (5) Resuscitate and culture Huh-7 cells; (6) The lentiviral infection capacity of Huh-7 cells was tested to determine the optimal lentiviral MOI value of Huh-7 cells as 5~15; (7) The optimal drug screening concentration of the antibiotic Puromycin was determined to be 1.5~2.5 μg / mL and the drug treatment time was 2~4 days. (8) Wild-type Huh-7 cell line was infected with packaged gene-overexpressing lentivirus pHS-AVC-0612, and then Puromycin was added for resistance screening. Drug screening was completed when all control wild-type cells died, and Huh-7-HBsAg cell line was obtained, which is a stable HBsAg overexpressing cell line. In step (4), during lentivirus packaging, the following method is used for lentivirus collection and concentration: i) 48 h after transfection, collect the supernatant containing lentivirus and add 15 mL of fresh complete culture medium to the culture dish; continue culturing for another 24 h after transfection, and collect the viral supernatant a second time. ii) Combine the collected viral supernatants from both collections, filter through a 0.45 μm filter to obtain viral fluid, concentrate the viral fluid using lentivirus concentrate according to the following concentration method, and store at -80°C for later use. (iia) Mix the virus supernatant and lentivirus concentrate at a ratio of 4:1 and incubate at 4°C for 2 hours. (iib) Centrifuge the mixture at 4000g for 30 minutes at 4℃. A milky white precipitate will be visible at the bottom of the tube. (iic) Carefully remove the supernatant, add an appropriate volume of PBS solution, and gently resuspend the precipitate using a micropipette to obtain the virus concentrate. (iid) The concentrated virus solution was aliquoted and stored at -80℃; The preparation method of the lentivirus concentrate in step iia) is as follows: Weigh 4.38g sodium chloride, 25g polyethylene glycol 8000, 2.5g dextran 20 and 2g propylene glycol, add ultrapure water to dissolve to make 100ml, autoclave at 121℃ for 30min to obtain the lentivirus concentrate, and store at 4℃ for later use.

2. The method according to claim 1, wherein in step (4), when performing lentiviral packaging, HEK293FT cells are prepared using the following method: 5 × 10 6 HEK 293FT cells were passaged and seeded into 100 mm cell culture dishes and incubated at 37°C with 5% CO2 for 16-24 hours.

3. The method according to claim 1, wherein in step (4), when performing lentivirus packaging, the lentivirus packaging system is transfected using the following method: a) Dilute the packaging plasmid mixture and lentivirus expression plasmid in the lentivirus packaging kit with ddH2O to a final concentration of 1.0 μg / μL plasmid solution. b) Take a 1.5 mL centrifuge tube and label it tube A. Add 300 μL of Opti-MEM medium and 40 μL of LEpFect medium to the tube. TM After mixing the Transfection Reagent, let it stand at room temperature for 5 minutes. c) Take a 1.5 mL centrifuge tube and label it tube B. Add 2.5 μL of the plasmid solution obtained in step a) and 7.5 μL of Package Plasmid Mix, and mix thoroughly. d) Add the solution from tube A to tube B, mix thoroughly, and let stand at room temperature for 15-30 minutes. e) Add the mixed solution in tube B dropwise and evenly to the culture dish inoculated with HEK 293FT cells. Gently shake the culture dish horizontally to mix. Place the culture dish at 37°C and 5% CO2 for 6 hours for transfection. Replace the culture medium with fresh complete culture medium preheated in a 37°C water bath.

4. The method of claim 1, wherein in step (6), the optimal lentivirus MOI value for Huh-7 cells is determined to be 10.

5. The method according to claim 1, wherein in step (7), Huh-7 cells are subjected to a Puromycin screening concentration test to determine the optimal drug screening concentration value of 2.0 μg / mL; and the drug treatment time is 72 hours.

6. The method according to claim 1, wherein in step (3) when constructing the plasmid, the upstream primer sequence is shown in SEQ ID No. 2 and the downstream primer sequence is shown in SEQ ID No.

3.

7. The method according to claim 1, wherein the sequencing primer sequence of the plasmid vector obtained in step (3) is G0154244-2-seqR:TCTGCCAATCAGGGAAGTAG.

8. According to the method of claim 1, in step (3) when constructing the plasmid, primers are first synthesized according to the HBsAg gene sequence. After PCR amplification, gel electrophoresis is performed to check whether the amplified band is correct, and the correct band is cut and recovered. After obtaining the recovered product, it is digested with the same restriction endonuclease as the backbone vector. The vector and PCR product digestion products are subjected to agarose gel electrophoresis to recover the target band. After obtaining the recovered product, T4 ligase is used for ligation. 5 μl of the ligated product is transferred to... Prepare 100 μl of competent cells, heat shock for 1 min in a 42°C metal bath, and rapidly pre-cool on ice for 2 min. In a clean bench, add 600 μl of antibiotic-free medium and incubate at 37°C with shaking for 1 h. Spread an appropriate amount of bacterial culture onto a plate containing the corresponding antibiotic and incubate upside down in a constant temperature incubator for 12-16 h. After colony PCR, identify positive clones, select 3-4 single colonies, and incubate overnight with the corresponding antibiotic medium. Then, extract plasmids according to the plasmid extraction kit to complete the construction of the overexpression lentivirus plasmid.

9. The method according to claim 8, wherein the plasmid is digested with restriction endonucleases for identification and the target gene is sequenced and compared for identification, to determine that the constructed plasmid is completely consistent with the target gene sequence.

10. The method according to claim 1, wherein in step (5), cell resuscitation culture is performed as follows: frozen Huh-7 cells are rapidly thawed in a 37°C water bath, centrifuged at 900 rpm for 5 min, the supernatant is discarded, 5 ml of complete culture medium is added to resuspend the cells, and then the cells are placed in a 6 cm culture dish and cultured in a 37°C, 5% CO2 incubator; when the cell confluence is 90%, the cells are passaged.

11. The method of claim 1, wherein in step (6), the Huh-7 cells are tested for lentiviral infectivity using the following method: Huh-7 cells are collected after trypsin digestion and centrifugation, the cells are resuspended and counted, and the cells are diluted to 2 x 10⁻⁶ cells / mL. 5 Cells were added at a density of 1 / ml to each well of a 24-well plate. 1 ml of complete culture medium was added to each well. After 24 h of cell adhesion and growth, the medium was replaced with fresh complete culture medium, and 1 μl of 8 mg / ml Polybrene, an infection-promoting reagent, was added. The MOI values ​​for each well were set to 0, 5, 10, 15, 20, 30, and 40, respectively. Green fluorescent control lentivirus was added. After 48 h of cell infection, the fluorescence expression of the cells was observed and photographed, and the optimal MOI value was selected.

12. The method of claim 1, wherein in step (7), Huh-7 cells are screened for antibiotic Puromycin concentration using the following method: Huh-7 cells are collected after trypsin digestion and centrifugation, the cells are resuspended and counted, and the cells are diluted to 2 x 10⁻⁶ cells / mL. 5 Add cells / ml to a 24-well plate, add 1ml of complete culture medium to each well, and add Puromycin to each well to the following final concentrations: 0, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, and 4.0 μg / ml. Observe cell growth and take pictures after 3-5 days of cell culture, and select the optimal drug screening concentration value.

13. The method according to claim 1, wherein in step (8), the establishment of a stable HBsAg overexpression cell line is performed by infecting wild-type Huh-7 cell lines with packaged gene-overexpression lentivirus pHS-AVC-0612, wherein the infection method is 12-well plate seeding with 2 × 10⁶ cells per well. 5 On the second day after cell seeding, when the cell density reaches 30%-40%, calculate the required volume of virus solution per well based on the MOI obtained in the preliminary experiment and add the virus. On the third day, change the medium and continue culturing. On the fourth day, add Puromycin for resistance screening. Drug screening is completed when all control wild-type cells die, resulting in the Huh-7-HBsAg cell line, which is a stable HBsAg overexpression cell line.

14. According to the method of claim 1, the Huh-7-HBsAg cell line constructed therefrom, as expressed by qPCR and in terms of relative mRNA expression level, shows that the expression level of the target gene in the Huh-7-HBsAg cell line is more than 10,000 times higher than that in the control cell Huh-7-WT.

15. According to the method of claim 1, the binding activity of the Huh-7-HBsAg cell line constructed by the method with hepatitis B antibody was detected by enzyme-linked immunosorbent assay (ELISA), showing that the Huh-7 cell line was negative for hepatitis B antigen and the Huh-7-HBsAg cell line was positive for hepatitis B antigen.

Images