Application of soybean GmGPAT9b gene molecular marker in identifying hundred-grain weight

Abstract

The application relates to the technical field of genetic breeding, and discloses application of a soybean GmGPAT9b gene molecular marker in identifying hundred-grain weight. The InDel natural variation of the GmGPAT9b gene located between 32450453-32451950 bp of the 5th chromosome of soybean can affect the grain weight and grain type of the soybean, the variation site is used to develop a molecular marker, and the two haplotypes of the GmGPAT9b gene can be quickly distinguished, wherein the type with a band is GmGPAT9b Hap1 , the type without a band is GmGPAT9b Hap2 , and the GmGPAT9b Hap2 type soybean has higher grain weight, larger grain length and larger grain width. The application discloses a molecular marker for identifying the InDel natural variation type of the GmGPAT9b gene and application thereof, provides a theoretical basis for soybean molecular assisted breeding, and has an important role in cultivating high-yield and high-quality soybean varieties.

Description

Technical Field

[0001] This invention relates to the field of genetic breeding technology and discloses the application of a soybean GmGPAT9b gene molecular marker in identifying 100-seed weight. Technical Background

[0002] Soybeans are one of the world's major economic crops, providing essential nutrients such as oils and proteins. They are widely cultivated globally for food, industrial applications, and animal feed. Currently, China is the world's largest importer of soybeans, and this trend continues to rise. my country's annual soybean consumption is around 100 million tons, while its production has remained stable at around 12 million tons in recent years. Therefore, further improving the quality of soybean varieties and promoting genetic improvement of yield and oil content traits are the primary research tasks for the current development of the soybean industry.

[0003] 100-seed weight is one of the important quantitative genetic traits of soybean, and exploring its molecular regulatory mechanisms is crucial for improving soybean yield. Glyceryl triphosphate acyltransferase (GPAT) is a key enzyme in the first step of the triacylglycerol synthesis pathway, catalyzing the formation of triacylglycerol from fatty acids. During soybean seed formation, seed dry weight shows an increasing trend or an "S"-shaped curve, and oil content also exhibits an "S"-shaped curve, with dry matter accumulation positively correlated with oil content. Therefore, altering GPAT activity may affect the composition and accumulation of soybean oil, thereby influencing soybean seed weight. We found natural variations in the promoter region of the GmGPAT9b gene in soybean. Furthermore, we verified in natural populations and recombinant inbred lines that natural variations in GmGPAT9b affect soybean seed weight and seed shape. Therefore, research on the regulation of soybean 100-seed weight by natural variations in the soybean GmGPAT9b gene can provide a theoretical basis for soybean molecular-assisted breeding and is of great significance for cultivating high-yielding and high-quality new varieties. Summary of the Invention

[0004] This invention proposes an application of a molecular marker for the soybean GmGPAT9b gene in identifying 100-seed weight. Based on the natural variation of the InDel promoter of the soybean GmGPAT9b gene, this invention develops a related molecular marker to identify different haplotypes of the soybean GmGPAT9b gene, providing a theoretical basis for molecular-assisted breeding of the 100-seed weight trait in soybean. The molecular marker is located between 32450453 and 32451950 bp on soybean chromosome 5.

[0005] In one aspect of the invention, an application of the soybean GmGPAT9b gene molecular marker in the identification of 100-seed weight is proposed. According to an embodiment of the invention, the soybean GmGPAT9b gene molecular marker is located between 32450453 and 32451950 bp on soybean chromosome 5.

[0006] In addition, the application of the soybean GmGPAT9b gene molecular marker in identifying 100-seed weight according to the above embodiments of the present invention may also have the following additional technical features:

[0007] In some embodiments of the present invention, the soybean GmGPAT9b gene molecular marker can identify two different haplotypes of the GmGPAT9b gene, namely GmGPAT9b. Hap1 and GmGPAT9b Hap2 Among them, GmGPAT9b Hap1 The haplotype gene sequence is shown in Sequence Listing Seq_1, GmGPAT9b Hap2 The haplotype gene sequence is shown in Sequence Listing Seq_2, GmGPAT9b Hap2 Haplotype soybeans compared to GmGPAT9b Hap1 Haploid soybeans have higher grain weight, longer grain length, and wider grain width.

[0008] In some embodiments of the present invention, the following steps are included:

[0009] S1. Extract genomic DNA from the soybean plants to be tested;

[0010] S2. Molecular markers were developed based on the InDel site 1461 bp upstream of the GmGPAT9b start codon, and the primer pair sequences are as follows:

[0011] Forward sequence: GTGATATCCTCTTATGACAACATCC

[0012] Reverse sequence: CGTTAATCTTCAAATGTTGATCACGTC

[0013] Using the above primer pair sequences as primers, the DNA extracted from S1 was amplified by PCR to obtain the amplification product;

[0014] S3. Perform agarose gel electrophoresis on the amplification products obtained in S2, and distinguish different haplotypes of the GmGPAT9b gene based on the band results; if the obtained band is 600bp, the soybean plant to be tested is determined to be GmGPAT9b. Hap1 If the soybean plant exhibits a low 100-seed weight and small seed length and width, and no stripes are observed, then the tested soybean plant is identified as GmGPAT9b. Hap2This type belongs to varieties with a high 100-grain weight and large grain length and width.

[0015] In some embodiments of the present invention, the banded nucleotide sequence is shown in Sequence Listing Seq_3.

[0016] The sequence list Seq_3 is shown below:

[0017]

[0018] In some embodiments of the present invention, the PCR amplification procedure in step S2 is as follows: 2.0 μL of 100 ng / μg template DNA, 1.0 μL each of 10 μmol / L upstream and downstream primers, 12.5 μL of 1.0 U KOD1 enzyme, and 8.5 μL of ddH2O; the reaction conditions are: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 54℃ annealing for 15 s, 68℃ extension for 5 s, for 31 cycles; and finally, 68℃ extension for 5 min, followed by storage at 4℃.

[0019] Compared with the prior art, the beneficial effects of the present invention are:

[0020] 1. Polymorphic molecular markers are based on sequence variations at the same locus in a species' genome. Specific primers are designed for PCR amplification, and gel electrophoresis is used for rapid genotyping. This invention utilizes molecular markers to rapidly and accurately identify different haplotypes of the GmGPAT9b gene.

[0021] 2. This invention uses PCR amplification of the soybean genomic DNA to be tested, and identifies the haplotype of the GmGPAT9b gene in the tested soybean plant. This is beneficial for rapidly screening varieties with higher grain weight and larger grain size, and is of great significance for breeding high-yield and high-quality new varieties. Attached Figure Description

[0022] Figure 1 This is a comparison diagram of natural variations in the GmGPAT9b promoter sequence in Embodiment 1 of the present invention;

[0023] Figure 2 This is a comparison chart of seed size among different haplotype soybean varieties of GmGPAT9b in Example 1 of the present invention, where Jiyu 108 and Jilin 30 are GmGPAT9b varieties. Hap1 Type, Zhexian No. 9 and Zaosheng 75 are GmGPAT9b Hap2 type;

[0024] Figure 3 In Example 1 of this invention, molecular markers were used to identify different haplotypes of GmGPAT9b, and a band was found to be GmGPAT9b. Hap1 The type is 600bp, and the non-strip type is GmGPAT9b. Hap2Type, specifically, 1, 4, 6, 7, 8, and 10 are GmGPAT9b Hap1 Types 2, 3, 5, and 9 are GmGPAT9b Hap2 Type 11 is a negative control, and type 12 is a positive control;

[0025] Figure 4 This is a comparative analysis chart of the 100-particle weight (a), particle length (b), and particle width (c) of the GmGPAT9b haplotype in 30 extreme materials in Example 1 of the present invention;

[0026] Figure 5 This is a comparative analysis of the 100-seed weight (a), seed length (b), and seed width (c) of different haplotypes of soybean GmGPAT9b in the recombinant self-pollination population of Example 2 of the present invention. Detailed Implementation

[0027] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0028] In the following embodiments, various processes and methods not described in detail are conventional methods known in the art. All primers used are indicated upon their first appearance, and subsequent use of the same primer will use the same indication as the initial indication.

[0029] Example 1

[0030] The molecular marker for the soybean GmGPAT9b gene is located on chromosome 5 of soybean, between 32450453 and 32451950 bp. Figure 1 As shown, sequencing of the soybean GmGPAT9b gene promoter revealed an InDel variant 1461 bp upstream of the start codon, which was then classified into two main haplotypes (GmGPAT9b...). Hap1 and GmGPAT9b Hap2 ), of which GmGPAT9b Hap1 The type is as shown in sequence list Seq_1, GmGPAT9b Hap2 The type is as shown in the sequence list Seq_2. Figure 2 As shown, by comparing the grain length and width of two haplotype soybean seeds, it was found that GmGPAT9b... Hap2 The length and width of the soybean seeds of type GmGPAT9b are both greater than those of GmGPAT9b. Hap1 type.

[0031] Molecular markers were developed based on the InDel site 1461 bp upstream of the GmGPAT9b start codon, and the primer pair sequences are as follows:

[0032] Forward sequence: GTGATATCCTCTTATGACAACATCC

[0033] Reverse sequence: CGTTAATCTTCAAATGTTGATCACGTC

[0034] To achieve rapid detection and identification of the GmGPAT9b haplotype, in this embodiment, the aforementioned primer pair was used to perform PCR amplification on multiple sets of soybean genomic DNA samples. The PCR amplification program was as follows: 2.0 μL of 100 ng / μg template DNA, 1.0 μL each of 10 μM forward and reverse primers, 12.5 μL of 1.0 U KOD1N enzyme, and 8.5 μL of ddH2O; the reaction conditions were: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 54℃ annealing for 15 s, and 68℃ extension for 5 s, for 31 cycles; a final extension at 68℃ for 5 min, followed by storage at 4℃. The amplified products were obtained and subjected to agarose gel electrophoresis. Agarose gel preparation: Weigh 1g of agarose and add it to 100mL of 1×TAE electrophoresis buffer. Shake well and heat in a microwave oven until the agarose is completely dissolved. Add 4μL of nucleic acid dye, mix well, and pour the dissolved agarose into a gel casting plate. Insert a comb and cool to a solid state for later use. Electrophoresis procedure: Place the prepared agarose gel into the electrophoresis tank, add 1×TAE electrophoresis buffer until the liquid surface covers the gel by 2-3mm. Use a pipette to add 5μL of 2000 DNA Marker to the first well, followed by 5μL of amplification product to the subsequent wells. Turn on the electrophoresis apparatus and set the electrophoresis parameters: 120V, 120mA, electrophoresis time 30min. The results are as follows: Figure 3 As shown.

[0035] from Figure 3 It can be seen that amplification products 1, 4, 6, 7, 8, and 10 are banded, with a sequence size of 600 bp and the sequence name GmGPAT9b. Hap1 Type 2 soybean, the banded nucleotide sequence is shown in Sequence Listing Seq_3; sequences 2, 3, 5, and 9 show no bands, which is GmGPAT9b. Hap2 Type 11 soybeans and Type 12 soybeans are used as controls.

[0036] In this embodiment, 30 extreme materials were selected from natural germplasm based on the 100-seed weight of soybeans. Their 100-seed weight, seed length, and seed width were measured, and DNA was extracted from these soybean germplasm samples. Different haplotypes of the GmGPAT9b gene were identified using the invented molecular markers (Table 1). The results showed that the varieties with high 100-seed weight were all GmGPAT9b. Hap2The type, low 100-grain weight variety is GmGPAT9b Hap1 Type. Student's t-test was performed on the grain weight, length, and width of two haplotype soybeans. The results showed that GmGPAT9b... Hap1 The average weight of 100 soybeans of this type is 8.62g, GmGPAT9b Hap2 The average 100-seed weight of soybeans of both types was 26.75 g, showing a highly significant difference (p<0.001). Figure 4 a) GmGPAT9b Hap1 The average grain length of this type of soybean is 5.89 mm, GmGPAT9b Hap2 The average grain length of soybean of type 1 was 7.84 mm, showing a highly significant difference between the two (p<0.001). Figure 4 b); GmGPAT9b Hap1 The average grain width of this type of soybean is 4.32 mm, GmGPAT9b Hap2 The average grain width of soybean of type 1 was 6.35 mm, showing a highly significant difference between the two (p<0.001). Figure 4 c).

[0037] Table 1. Comparison of GmGPAT9b haplotype, 100-particle weight, and particle length and width in 30 extreme materials.

[0038]

[0039]

[0040] The Seq_1 sequence is shown below:

[0041]

[0042] The Seq_2 sequence is shown below:

[0043]

[0044]

[0045] The Seq_3 sequence is shown below:

[0046]

[0047] Example 2

[0048] Construct CK(GmGPAT9b) Hap1 Type) × Ludou No. 1 (GmGPAT9b) Hap2 A biparental population (type 1) comprising 145 families was identified. The invented molecular markers were used to identify haplotypes in different families, including GmGPAT9b. Hap1 There are 71 types of soybeans, including GmGPAT9b. Hap2There are 74 soybean types. A comparison of the 100-seed weight, seed length, and seed width of different haplotype families of GmGPAT9b showed that GmGPAT9b... Hap1 The average weight of 100 soybeans of this type is 34.82g, GmGPAT9b Hap2 The average 100-seed weight of soybean of type 1 was 37.97 g, showing a highly significant difference between the two (p<0.001). Figure 5 a) GmGPAT9b Hap1 The average grain length of this type of soybean is 8.22 mm, GmGPAT9b Hap2 The average grain length of soybean of type 1 was 8.82 mm, showing a highly significant difference between the two (p<0.001). Figure 5 b); GmGPAT9b Hap1 The average grain width of this type of soybean is 7.26 mm, GmGPAT9b Hap2 The average grain width of soybean of type 1 was 7.61 mm, showing a highly significant difference between the two (p<0.001). Figure 5 c).

[0049] In this invention, sequencing of the GmGPAT9b gene revealed for the first time an InDel natural variant in the 1461bp region upstream of the start codon, which was then classified into two main haplotypes (GmGPAT9b...). Hap1 GmGPAT9b Hap2 Comparison of GmGPAT9b gene haplotypes, seed length, and seed width in extreme 100-seed weight materials revealed that GmGPAT9b... Hap2 The 100-seed weight, seed length, and seed width of this type of soybean are all greater than those of GmGPAT9b. Hap1 The results were subsequently verified in recombinant inbred lines. This molecular marker plays an important role in studying the function of the GmGPAT9b gene and can provide a theoretical basis for molecular-assisted breeding of the 100-seed weight trait in soybean, which is beneficial for breeding high-yielding and high-quality new soybean varieties.

[0050] The above description is merely an example and illustration of the structure of the present invention. Those skilled in the art can make various modifications or additions to the specific embodiments described, or use similar methods to replace them, as long as they do not deviate from the structure of the present invention or exceed the scope defined in the claims, all of which should fall within the protection scope of the present invention.

Claims

1. The application of a reagent for detecting the molecular marker of the soybean GmGPAT9b gene in the identification of 100-seed weight, characterized in that: The soybean GmGPAT9b gene molecular marker can identify two different haplotypes of the GmGPAT9b gene, namely GmGPAT9b. Hap1 and GmGPAT9b Hap2 Among them, GmGPAT9b Hap1 The haplotype gene sequence is shown in SEQ ID NO.1, GmGPAT9b Hap2 The haplotype gene sequence is shown in SEQ ID NO.2, GmGPAT9b Hap2 Haplotype soybeans compared to GmGPAT9b Hap1 Haploid soybeans have higher grain weight, longer grain length, and wider grain width; The application specifically includes the following steps: S1. Extract genomic DNA from the soybean plants to be tested; S2. Molecular markers were developed based on the InDel site 1461 bp upstream of the GmGPAT9b start codon, and the primer pair sequences are as follows: Forward sequence: GTGATATCCTCTTATGACAACATCC Reverse sequence: CGTTAATCTTCAAATGTTGATCACGTC Using the above primer pair sequences as primers, the DNA extracted from S1 was amplified by PCR to obtain the amplification product; S3. Perform agarose gel electrophoresis on the amplification products obtained in S2, and distinguish different haplotypes of the GmGPAT9b gene based on the band results; if the obtained band is 600 bp, the soybean plant to be tested is determined to be GmGPAT9b. Hap1 If the soybean plant exhibits a low 100-seed weight and small seed length and width, and no stripes are observed, then the tested soybean plant is identified as GmGPAT9b. Hap2 This type belongs to varieties with a high 100-grain weight and large grain length and width.

2. The application of the reagent for detecting the molecular marker of the soybean GmGPAT9b gene according to claim 1 in the identification of 100-seed weight, characterized in that: The banded nucleotide sequence is shown in SEQ ID NO.

3.

3. The application of the reagent for detecting the molecular marker of the soybean GmGPAT9b gene according to claim 1 in the identification of 100-seed weight, characterized in that, In step S2, the PCR amplification program is as follows: 2.0 μL of 100 ng / μg template DNA, 1.0 μL each of 10 μmol / L upstream and downstream primers, 12.5 μL of 1.0 U KOD1 enzyme, and 8.5 μL of ddH2O; the reaction conditions are: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 54℃ annealing for 15 s, 68℃ extension for 5 s, for 31 cycles; and finally, 68℃ extension for 5 min, followed by storage at 4℃.

Images