A novel real-time quantitative PCR detection method for mutant getta virus

Abstract

This invention belongs to the field of virus detection technology, specifically relating to a real-time quantitative PCR detection method for a novel variant Geta virus. Based on the gene sequence of the GETA structural polyprotein, this invention designs and synthesizes specific primers, constructs the recombinant plasmid pcDNA3.1HA-GETA-E1, establishes a standard curve using this plasmid as a standard, and establishes a real-time quantitative PCR detection system for the novel variant Geta virus. This system enables the quantitative detection of GETA in the novel variant Geta virus, with no specific amplification of multiple viruses such as HSV; it can detect up to 10... 1 The recombinant plasmid, with a density of copies / μL, is 1000 times that of conventional PCR; the maximum coefficient of variation for intra-group repeats is 1.59%, and the maximum coefficient of variation for inter-group repeats is 3.30%. It possesses advantages such as high specificity and sensitivity, good reproducibility, and short processing time. It fills the technological gap in the detection of novel variant Geitavirus, provides a basis for diagnosing novel variant Geitavirus infection, plays an important role in protecting red pandas and giant pandas, and has excellent application prospects.

Description

Technical Field

[0001] This invention belongs to the field of virus detection technology, specifically relating to a real-time fluorescence quantitative PCR detection method for a novel variant of Geyta virus. Background Technology

[0002] Getah virus (GETV) is a zoonotic infectious virus transmitted through mosquito bites, which can infect humans and various animals and cause serious illness. Getah virus belongs to the family Capriviridae (…). Togaviridae ) Avira ( Alphavirus Gettavirus (GETV) has a non-segmented, linear, single-stranded positive-sense RNA genome approximately 11,700 nt in length, with two open reading frames (ORFs) encoding four non-structural proteins (nsP1-nsP4) and five structural proteins (E1-E3, C, and 6K). GETV was first isolated from Culex mosquitoes collected in Malaysia in 1955 and is now widely distributed in 13 countries in Southeast Asia and northern Australia. The GETV strain was isolated from Culex mosquitoes collected in Hainan Province, my country in 1964, and has since been isolated in 22 provinces in my country. GETV can infect various animals, including horses, pigs, and cattle, causing a variety of symptoms such as fever, rash, limb edema, diarrhea, abortion, and even death.

[0003] In 2018, a red panda died at the Chengdu Research Base of Giant Panda Breeding in Sichuan Province. Preliminary research used metagenomics to analyze the viral community in tissue samples from the deceased panda, constructing a DNA library and performing high-throughput sequencing. By processing the raw sequencing data and aligning the viral sequences, a gettavirus sequence was obtained, named GETV / SCrph328 / 2018 (NCBI GenBank number: MZ357111). The genome is nearly complete, with a total length of 11,641 nt. The two ORFs encode a 2466aa non-structural polyprotein and a 253aa structural polyprotein, respectively. This was the first time GETV had been discovered in a red panda. Phylogenetic analysis revealed that GETV / SCrph328 / 2018 closely clustered on the same branch as three Chinese GETV strains circulating in Sichuan pig populations, with gene similarity ranging from 99.77% to 99.84%. The results indicate that the range of GETV infection hosts has expanded, posing a threat to the red panda population in Sichuan and potentially posing an infection risk to other animals.

[0004] Currently, clinical detection techniques for Geta virus mainly include electron microscopy, virus isolation and identification, serological testing, and molecular biological detection. Research is still in its early stages, and a complete detection method has not yet been established. Real-time quantitative PCR is one of the internationally recognized methods for virus detection, possessing advantages such as speed, simplicity, high specificity, high sensitivity, good repeatability, and accurate quantification. Establishing a quantitative PCR detection method for novel variant Geta virus will facilitate extensive molecular biological detection of Geta virus, timely detection of infection in red pandas, and prevention of Geta virus transmission, playing a significant role in protecting the health of red pandas and the stability of their ecological communities. Summary of the Invention

[0005] In view of this, the purpose of this invention is to address the problems existing in the prior art by providing a novel real-time quantitative PCR detection method for mutant Geta virus (GETA). This detection method can achieve quantitative detection of Geta virus in the sample and has multiple technical advantages such as simplicity, speed, high sensitivity, and strong specificity.

[0006] To achieve the objectives of this invention, the following technical solution is adopted:

[0007] This invention provides a novel real-time quantitative PCR detection method for mutant getta virus, the method comprising the following steps:

[0008] (1) Based on the structural polyprotein gene sequence of the novel variant geta virus with GenBank sequence number MZ357111, the sequence was compared with the GETA nucleic acid sequence from different host sources using Geneious Prime software. Based on the comparison results, specific primers GETA-q and GETA-E1 were designed for the specific sequence regions of the virus. The upstream primer of GETA-q was GETA-qPF and the downstream primer was GETA-qPR. The upstream primer of GETA-E1 was GETA-E1-PF and the downstream primer was GETA-E1-PR. Their nucleotide sequences are shown in Seq_1~Seq_4 respectively.

[0009] (2) cDNA was obtained by reverse transcription using RNA of the novel mutant Geta virus as a template. PCR amplification was performed using the primers GETA-E1-PF and GETA-E1-PR designed in step (1). The DNA fragment of the target gene E1 was recovered from the PCR product and ligated to the linearized plasmid vector pcDNA3.1HA after enzyme digestion by homologous recombination. The plasmid was transformed into DH5α competent Escherichia coli cells. Positive clones were picked and plasmids were extracted to obtain the recombinant plasmid pcDNA3.1HA-GETA-E1 standard.

[0010] (3) The recombinant plasmid pcDNA3.1HA-GETA-E1 was serially diluted 10-fold to prepare a recombinant plasmid standard solution. Using it as a template, SYBR Green I real-time quantitative PCR was performed using specific primers GETA-qPF and GETA-qPR. The logarithm of the copy number concentration of the recombinant plasmid standard was used as the abscissa and Ct value as the ordinate to obtain the linear regression equation.

[0011] (4) Extract total nucleic acid from the sample to be tested, obtain cDNA from the sample to be tested, and use it as a template to perform SYBR I real-time fluorescence quantitative PCR using specific primers GETA-qPF and GETA-qPR. Then, input the obtained Ct value into the standard curve constructed in step (3) to realize the quantitative detection of novel variant Geta virus in the sample to be tested.

[0012] Furthermore, the PCR amplification reaction system described in step (2) is as follows: template 5.0 μL, Prime STAR 25 μL, GETA-E1-PF 1 μL, GETA-E1-PR 1 μL, ddH2O to 50 μL.

[0013] The PCR amplification reaction program in step (2) is as follows: pre-denaturation at 98℃ for 3 min, denaturation at 98℃ for 20 s, annealing at 60℃ for 20 s, extension at 72℃ for 1 min for 35 cycles, extension at 72℃ for 10 min, and storage at 16℃ for 2 min.

[0014] The DNA fragment in step (2) is 1314 bp in size.

[0015] The concentration of the recombinant plasmid standard solution in step (3) is 1.69 × 10⁻⁶. 1 ~1.69×10 8 copies / μL.

[0016] The linear regression equation mentioned in step (3) is y = -3.1972x + 36.698.

[0017] The reaction system for real-time quantitative PCR described in step (3) is as follows: 1.0 μL template, 0.1 μL GETA-qPF (10 μM), 0.1 μL GETA-qPR (10 μM), 5.0 μL SYBR Green Mix, and 3.8 μL ddH2O.

[0018] The reaction program for real-time quantitative PCR described in step (3) is as follows: 40 cycles of 95℃ for 30s, 95℃ for 10s, and 60℃ for 30s, followed by 95℃ for 15s and 60℃ for 60s.

[0019] The present invention also provides a universal primer set for real-time quantitative PCR detection of a novel variant getta virus in red pandas. The primer set includes specific primers GETA-q and GETA-E1; the upstream primer of GETA-q is GETA-qPF and the downstream primer is GETA-qPR; the upstream primer of GETA-E1 is GETA-E1-PF and the downstream primer is GETA-E1-PR; their nucleotide sequences are shown in Seq_1~Seq_4 of the sequence listing, respectively.

[0020] The present invention also provides a real-time quantitative PCR detection kit for a novel variant of getta virus in red pandas, the kit containing the universal primer set described above.

[0021] This invention designs and synthesizes specific primers based on the gene sequence of the GETA structural polyprotein, constructs the recombinant plasmid pcDNA3.1HA-GETA-E1, and establishes a standard curve as a standard. A real-time quantitative PCR detection system for the novel mutant geta virus is established, enabling the quantitative detection of GETA from the novel mutant geta virus. It exhibits non-specific amplification of multiple viruses, including HSV; and can detect up to 10... 1 The recombinant plasmid, with a density of copies / μL, is 1000 times higher than that of conventional PCR; the maximum coefficient of variation for intra-group repeats is 1.59%, and the maximum coefficient of variation for inter-group repeats is 3.30%. It boasts advantages such as high specificity and sensitivity, good reproducibility, and short processing time. Detection results can be directly read using computer software, eliminating the need for agarose gel electrophoresis and gel imaging, thus simplifying experimental procedures and saving detection time. This provides a novel detection method for the novel variant Geita virus, filling a technological gap in its detection and providing a basis for diagnosing infection with this virus. It plays a vital role in protecting red and giant pandas and has excellent application prospects. Attached Figure Description

[0022] Figure 1 This is a graph showing the optimized annealing temperature for GETA real-time PCR; in the graph, M is the DNA ladder marker, and numbers 1 to 7 represent 50℃, 52℃, 54℃, 56℃, 58℃, 60℃ and H2O, respectively.

[0023] Figure 2 This is a diagram showing the optimized primer concentrations for GETA real-time PCR; in the diagram, numbers 1 to 6 represent the final primer concentrations of 0.10 μM, 0.15 μM, 0.20 μM, 0.25 μM, 0.30 μM, and H2O, respectively.

[0024] Figure 3This is a standard curve for quantitative real-time PCR of a novel variant Geta virus (GETA); the logarithm of the copy number concentration of the recombinant plasmid standard is on the x-axis, and the Ct value is on the y-axis.

[0025] Figure 4 This is a specificity verification diagram of the novel variant Geta virus (GETA) using real-time quantitative PCR.

[0026] Figure 5 This is a graph showing the sensitivity of a novel variant of Geta virus (GETA) using routine PCR.

[0027] Figure 6 This is a sensitivity verification diagram for the novel variant Geta virus (GETA) using real-time quantitative PCR. Specific implementation methods

[0028] This invention provides a novel real-time quantitative PCR detection method for variant getta virus. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The method and application of this invention have been described through preferred embodiments, and those skilled in the art can obviously make modifications or appropriate alterations and combinations to the method and application described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0029] Unless otherwise specified, the methods used in the embodiments are conventional methods, and the reagents used are conventional commercially available reagents or reagents prepared according to conventional methods.

[0030] The nucleic acid sequence of the structural polyprotein gene of the novel variant geta virus (GenBank sequence number MZ357111) discovered in our previous research was compared with the structural polyprotein nucleic acid sequences of geta viruses from different host sources, such as mosquitoes (Armigeres subalbatus), Culex, horses (Equus caballus), and pigs (Sus scrofadomestica), downloaded from GenBank by NCBI, using Geneious Prime software (v2019.2.3) via MUSCLE. Based on the results of multiple sequence alignment, specific primers GETA-q were designed using a specific sequence region of the novel mutant Geta virus GETA. The upstream sequence is GETA-qPF (as shown in Seq_1 of the sequence listing, i.e., AATCAGACAACCACGGCGTT), and the downstream sequence is GETA-qPR (as shown in Seq_2 of the sequence listing, i.e., CTGGTTGTCCTGACCCATAG). The amplified product length is 172 bp. Simultaneously, based on the primer positions and the sequence of the pcDNA3.1HA vector plasmid (as shown in Seq_5 of the sequence listing), specific amplification primers were designed, including primer GETA-E1, to amplify the E1 gene fragment of the novel mutant Geta virus GETA. The upstream sequence is GETA-E1-PF (as shown in Seq_3 of the sequence listing, i.e., AATCAGACAACCACGGCGTT). CCAGATTACGCTTACGGTACC TACGAACACACCGCGACGATCC), the downstream sequence is GETA-E1-PR (as shown in Seq_4 in the sequence listing, i.e. TGCTGGATATCTGCAGAATTC CTAGCGGCGCATGGTCACACAC), where the underlined part is the pcDNA3.1HA vector sequence, synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0031] Example 2: Construction of novel mutant getta virus (GETA) recombinant plasmid pcDNA3.1HA-GETA-E1

[0032] Viral nucleic acid was extracted from a heart tissue sample of a deceased red panda from the Sichuan Daxiangling Giant Panda Rewilding and Release Base in 2018 (the sample was stored at -80℃ for a long time). After grinding, the sample was resuspended in 1 mL of DPBS (Hyclone) and subjected to three freeze-thaw cycles. After centrifugation at 15000g, 4℃ for 10 min, 200 μL of the supernatant was collected. Viral nucleic acid was extracted using a viral nucleic acid extraction kit (TaKaRa). The extracted viral RNA was used as a template for reverse transcription to obtain GETA viral cDNA. The reverse transcription reaction used 11 μL of RNA and 1 μL of Random Primer. The mixture was pipetted and centrifuged briefly, then reacted at 65℃ for 5 min, followed immediately by 2 min on ice. The reagents listed in Table 1 were then added.

[0033] Table 1. Reverse transcription reagents

[0034]

[0035] Mix thoroughly by blowing and centrifugation, react at 25°C for 5 min, react at 42°C for 60 min, and terminate the reaction at 70°C for 5 min.

[0036] After reverse transcription, using cDNA from the novel mutant geta virus as a template, PCR amplification was performed using primers GETA-E1-PF and GETA-E1-PR to obtain a DNA fragment of the target gene E1, with a fragment size of 1314 bp. The PCR amplification reaction system is shown in Table 2, and the PCR reaction procedure is shown in Table 3.

[0037] Table 2. PCR amplification reaction system

[0038]

[0039] Table 3. PCR reaction procedure

[0040]

[0041] The pcDNA3.1HA vector plasmid was digested with KpnⅠ and EcoRI restriction endonucleases (TaKaRa) at two sites. The reaction was carried out on ice at 37°C for 2 hours. The pcDNA3.1HA plasmid digestion system is shown in Table 4.

[0042] Table 4. pcDNA3.1HA plasmid digestion system

[0043]

[0044] After PCR and enzyme digestion products were subjected to 1.2% agarose gel electrophoresis, specific bands matching the target fragment size (1314 bp) were extracted using a DNA gel recovery kit (TaKaRa). The linearized plasmid vector pcDNA3.1HA was ligated with homologous recombinase (Novizan) and transformed into DH5α E. coli competent cells (Novizan). Positive clones were selected for first-generation sequencing (Sangon Biotech). The sequencing results were compared with the obtained novel mutant geta virus E1 gene sequence using Geneious Prime software (v2019.2.3). Positive clones with identical alignment results were cultured overnight at 37°C. The plasmid was extracted using an endotoxin-free plasmid extraction kit (Kangwei Century) to obtain the recombinant plasmid pcDNA3.1HA-GETA-E1 (6749 bp) standard, the nucleotide sequence of which is shown in Seq_6 of the sequence listing. The obtained recombinant plasmid has an OD260 / OD280 ratio between 1.8 and 2.0, indicating high purity, and can be used for subsequent standard curve establishment experiments.

[0045] Using the recombinant plasmid pcDNA3.1HA-GETA-E1 standard prepared in Example 2 as a template, the optimal annealing temperature was selected in the range of 50℃ to 60℃, and the optimal final primer concentration was selected in the range of 0.10μM to 0.30μM. Figure 1 This is a graph showing the optimized annealing temperature for GETA real-time PCR. In the graph, M is the DNA ladder marker, and numbers 1 to 7 represent 50℃, 52℃, 54℃, 56℃, 58℃, 60℃, and H2O, respectively. Figure 2 This is a graph showing the optimized primer concentrations for GETA real-time PCR; in the graph, numbers 1-6 represent final primer concentrations of 0.10 μM, 0.15 μM, 0.20 μM, 0.25 μM, 0.30 μM, and H2O, respectively. Figure 1 , 2 As can be seen, specific bands were amplified at annealing temperatures of 50℃, 52℃, 54℃, 56℃, 58℃, and 60℃. Considering the high specificity requirement of the primers, 60℃ was selected as the optimal annealing temperature. Among a series of reaction systems with final primer concentrations, the one with clear bands and the lowest amount used was selected as the optimal primer concentration. The determined SYBR Green I real-time PCR reaction system is shown in Table 5, and the real-time PCR reaction procedure is shown in Table 6.

[0046] Table 5. SYBR Green I Real-Time PCR Reaction System

[0047]

[0048] Table 6. Real-time quantitative PCR reaction procedures

[0049]

[0050] Note: Different instrument types require different melting curve acquisition programs. You can use the instrument's default melting curve acquisition program.

[0051] Based on the molecular weight of the recombinant plasmid standard pcDNA3.1HA-GETA-E1 (6749 bp) constructed in Example 1, its mass concentration was converted to copy number concentration using the formula: copies / μL = (6.02 × 10^6)^2. 23 )×(ng / μL×10 -9 (DNA length × 660). A series of recombinant plasmid standard solutions of varying concentrations were prepared by serially diluting the recombinant plasmid pcDNA3.1HA-GETA-E1 10-fold. Using these different concentrations of standard solutions as templates, SYBR Green I real-time quantitative PCR was performed using specific primers GETA-qPF and GETA-qPR. The real-time quantitative PCR system and reaction procedure were as described in Example 3. A linear regression equation was obtained by plotting the logarithm of the copy number concentration of the recombinant plasmid standard on the x-axis and the Ct value on the y-axis, thus establishing a standard curve. Figure 3 This is a standard curve for quantitative real-time PCR of a novel variant Geta virus (GETA); the logarithm of the copy number concentration of the recombinant plasmid standard is on the x-axis, and the Ct value is on the y-axis; for example... Figure 3 As shown, the concentration of the recombinant plasmid pcDNA3.1HA-GETA-E1 was 1.69 × 10⁻⁶. 1 ~1.69×10 8 At copies / μL, the Ct value showed a good linear relationship with the logarithm of the recombinant plasmid copy number concentration. The linear equation was y = -3.1972x + 36.698, and the correlation coefficient (R²) was [missing value]. 2 The value is 0.9983.

[0052] Herpes simplex virus (HSV), Sendai virus (SeV), vesicular stomatitis virus (VSV), porcine deltacoronavirus (PDCoV), and adenovirus nucleic acids were preserved in our laboratory. Viral nucleic acid was extracted from HSV, SeV, VSV, and PDCoV using a viral nucleic acid extraction kit (TaKaRa). RNA viral nucleic acid was converted to cDNA via reverse transcription PCR, with the reverse transcription reaction system and procedure identical to those in Example 2. Using recombinant plasmid pcDNA3.1HA-GETA-E1 standard solution, extracted viral DNA, and reverse-transcribed viral cDNA as templates, and nuclease-free water as a blank control, analysis was performed using the novel mutant geta virus SYBR Green I real-time PCR detection system established in Example 3. Figure 4 This is a specificity verification image for a novel variant of Geta virus (GETA) using real-time quantitative PCR; as shown. Figure 4 As shown, only qPCR samples using pcDNA3.1HA-GETA-E1 as a template exhibited typical amplification curves. The control virus and blank control showed no significant peaks, indicating that the novel SYBR Green I real-time quantitative PCR detection method for mutant geta virus established in this invention has specificity for detecting GETA.

[0053] The recombinant plasmid pcDNA3.1HA-GETA-E1 was serially diluted 10-fold to obtain 1.69 × 10⁻⁶ ppm. 1 ~1.69×10 8 Recombinant plasmid standard solutions of varying concentrations (copies / μL) were prepared and used as templates, with nuclease-free water as a blank control. Conventional PCR and real-time quantitative PCR were then performed. Figure 5 This is a graph showing the sensitivity of a novel variant of Geta virus (GETA) using routine PCR. Figure 6 This is a sensitivity verification diagram for real-time quantitative PCR of a novel variant of Geta virus (GETA); in the diagram, numbers 1 to 9 each represent 1.69 × 10⁻⁶. 8 copies / μL, 1.69×10 7 copies / μL, 1.69×10 6 copies / μL, 1.69×10 5 copies / μL, 1.69×10 4 copies / μL, 1.69×10 3 copies / μL, 1.69×10 2 copies / μL, 1.69×10 1 copies / μL, H2O. For example... Figure 5As shown, the detection limit of conventional PCR is 10. 4 copies / μL; such as Figure 6 As shown, the detection limit of real-time quantitative PCR is 10. 1 The copies / μL ratio indicates that the sensitivity of real-time quantitative PCR is 1000 times that of conventional PCR.

[0054] 1.69 × 10⁻⁶ was selected from Example 4. 8 ~1.69×10 4 Recombinant plasmid standard solutions at five dilution levels (copies / μL) were used as templates for intra- and inter-group real-time quantitative PCR reactions. The standard deviation (SD) and coefficient of variation (CV) of the Ct value were used as the judgment criteria. The experimental results are shown in Table 7.

[0055] Table 7. Repeatability test results of GETA's SYBR Green I real-time PCR detection method

[0056]

[0057] As shown in Table 7, the maximum coefficient of variation for intra-group repeatability of the novel mutant Geta virus (GETA) SYBR Green I real-time PCR detection system was 1.59%, and the maximum coefficient of variation for inter-group repeatability was 3.30%, indicating that the detection system established in this invention has good repeatability.

[0058] Viral nucleic acid was extracted from 12 red panda fecal samples provided by the Chengdu Research Base of Giant Panda Breeding in Sichuan Province. The viral nucleic acid was detected using the GETA assay based on the real-time quantitative PCR system established in this invention. The obtained Ct values ​​were compared with the standard curve established in this invention. When the viral nucleic acid concentration was lower than the detection limit of 1.69 × 10⁻⁶ determined in Example 4, the detection limit was lowered. 1 When the number of copies / μL is reached, the test result is considered negative. The analysis results are shown in Table 8.

[0059] Table 8. Results of GETA's SYBR Green I real-time PCR assay on 12 samples.

[0060]

[0061] Note: + indicates positive; - indicates negative.

[0062] As shown in Table 8, in 12 samples, the virus detection rate of the real-time fluorescence quantitative PCR established by this invention was 91.67%, while the virus detection rate of conventional PCR was only 16.67%. This indicates that the detection effect of this invention on GETA in red panda fecal samples is better, proving that the establishment of this invention fills the technical gap in the detection of this novel variant Geta virus and has a high detection rate. In summary, the novel variant Geta virus (GETA) detection method provided by this invention has the advantages of high specificity and sensitivity, good repeatability and short time consumption.

[0063] In this embodiment of the invention, specific primers were designed and synthesized based on the gene sequence of the structural polyprotein of Geta virus, and a standard curve was established using the recombinant plasmid pcDNA3.1HA-GETA-E1 as a standard. A real-time fluorescence quantitative PCR detection system for the novel variant Geta virus was successfully established, realizing the quantitative detection of GETA.

[0064] This invention specifically detects GETA, exhibiting no specific amplification against multiple viruses such as HSV; this invention also possesses high sensitivity, capable of detecting 10... 1 The recombinant plasmid, with copies / μL, is 1000 times more potent than that of conventional PCR; it exhibits good reproducibility, with a maximum coefficient of variation of 1.59% for intra-group replicates and 3.30% for inter-group replicates. This invention enables rapid detection of a novel variant Geta virus widely circulating in red pandas, providing a reliable technical means for further research on the novel variant Geta virus (GETA), offering a basis for diagnosing infection with the novel variant Geta virus, filling a technical gap in the detection of the novel variant Geta virus, and playing an important role in protecting red and giant pandas.

[0065] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A real-time quantitative PCR detection method for a novel variant of getta virus for non-diagnostic purposes, characterized in that, The method includes the following steps: (1) Based on the structural polyprotein gene sequence of the novel variant geta virus with GenBank sequence number MZ357111, the sequence was compared with the GETA nucleic acid sequence from different host sources using Geneious Prime software. Based on the comparison results, specific primers GETA-q and GETA-E1 were designed for the specific sequence regions of the virus. The upstream primer of GETA-q was GETA-qPF and the downstream primer was GETA-qPR. The upstream primer of GETA-E1 was GETA-E1-PF and the downstream primer was GETA-E1-PR. Their nucleotide sequences are shown in SEQ ID NO:1~SEQ ID NO:4, respectively. (2) Using the RNA of the novel mutant Geta virus from step (1) as a template, reverse transcription was performed to obtain cDNA. PCR amplification was performed using the primers GETA-E1-PF and GETA-E1-PR designed in step (1). The PCR product was recovered to obtain the DNA fragment of the target gene E1. The fragment was ligated to the linearized plasmid vector pcDNA3.1HA after enzyme digestion by homologous recombination and transformed into DH5α Escherichia coli competent cells. Positive clones were picked and plasmids were extracted to obtain the recombinant plasmid pcDNA3.1HA-GETA-E1 standard. (3) The recombinant plasmid pcDNA3.1HA-GETA-E1 was serially diluted 10-fold to prepare a recombinant plasmid standard solution. Using it as a template, SYBR Green I real-time fluorescence quantitative PCR was performed using specific primers GETA-qPF and GETA-qPR. The logarithm of the copy number concentration of the recombinant plasmid standard was used as the abscissa and Ct value as the ordinate. The linear regression equation was obtained as y=-3.1972x+36.698, and the correlation coefficient was 0.9983. (4) Extract total nucleic acid from the sample to be tested, obtain cDNA from the sample to be tested, and use it as a template. Use specific primers GETA-qPF and GETA-qPR to perform SYBR I real-time fluorescence quantitative PCR, and input the obtained Ct value into the linear regression equation of step (3) to realize the quantitative detection of novel variant Geta virus in the sample to be tested.

2. The detection method according to claim 1, characterized in that, The PCR amplification reaction program in step (2) is as follows: pre-denaturation at 98℃ for 3 min, denaturation at 98℃ for 20 s, annealing at 60℃ for 20 s, extension at 72℃ for 1 min for 35 cycles, extension at 72℃ for 10 min, and storage at 16℃ for 2 min.

3. The detection method according to claim 1, characterized in that, The DNA fragment in step (2) is 1314 bp in size.

4. The detection method according to claim 1, characterized in that, The concentration of the recombinant plasmid standard solution in step (3) is 1.69 × 10⁻⁶. 1 ~1.69×10 8 copies / μL.

5. The detection method according to claim 1, characterized in that, The reaction system for real-time quantitative PCR described in step (3) is as follows: 1.0 μL template, 0.1 μL GETA-qPF, 0.1 μL GETA-qPR, 5.0 μL SYBR Green Mix, and 3.8 μL ddH2O.

6. The detection method according to claim 1, characterized in that, The reaction program for real-time quantitative PCR described in step (3) is as follows: 40 cycles of 95℃ for 30s, 95℃ for 10s, and 60℃ for 30s, followed by 95℃ for 15s and 60℃ for 60s.

7. A universal primer set for real-time quantitative PCR detection of a novel variant of getta virus in red pandas, characterized in that, The primer set includes specific primers GETA-q and GETA-E1; the upstream primer of GETA-q is GETA-qPF, and the downstream primer is GETA-qPR; the upstream primer of GETA-E1 is GETA-E1-PF, and the downstream primer is GETA-E1-PR; their nucleotide sequences are shown in SEQ ID NO:1 to SEQ ID NO:4 in the sequence listing, respectively.

8. A real-time quantitative PCR detection kit for a novel variant of getta virus in red pandas, characterized in that, The kit contains the universal primer set as described in claim 7.

Images