Regulators of hexokinase 2 or c-myc and use in the manufacture of a medicament for treating leukemia

Abstract

The present application relates to the technical field of cancer treatment drugs, in particular to a hexokinase 2 (HK2) or c-Myc regulating agent and application in preparing leukemia treatment drugs. Research finds that c-Myc positively regulates the expression of HK2; inhibiting HK2 using shRNA can hinder the proliferation of cancer cells; oleamide inhibits the expression of c-Myc and HK2 and the combination of c-Myc and HK2. shRNA and oleamide are used as regulating agents in the treatment of related diseases with HK2 as a target; or shRNA and oleamide are used as c-Myc protein expression inhibitors, HK2 protein expression inhibitors, gene transcription inhibitors and c-Myc and HK2 combination blockers in the mechanism research of disease occurrence and development as research tools. The technical scheme overcomes the technical problem that the prior art lacks drugs with HK2 as a treatment target, and has an ideal application prospect and popularization value.

Description

Technical Field

[0001] This invention relates to the field of cancer treatment drug technology, specifically to regulatory agents of hexokinase 2 (HK2) or c-Myc and their application in the preparation of drugs for treating leukemia. Background Technology

[0002] As a key enzyme in aerobic glycolysis, hexokinase (HK) plays a crucial role in glucose metabolism in tumor cells. HK catalyzes the rate-limiting first step of glycolysis, the conversion of D-glucose to D-glucose-6-phosphate. There are four subtypes of HK in mammals: HK1, HK2, HK3, and HK4, with HK2 being the most active subtype in tumors. HK2 is selectively overexpressed in various tumors with high levels of glycolysis, including liver cancer, non-small cell lung cancer, breast cancer, prostate cancer, leukemia, and myeloma. HK2 is not expressed in most adult tissues, especially the liver and spleen, and is expressed in small amounts in bone marrow and peripheral blood, but it shows high expression in samples from cancer patients such as acute myeloid leukemia (AML). HK2 affects multiple intermediate metabolic pathways, such as glycogen synthesis, protein glycosylation, biosynthesis of essential nutrients (amino acids, nucleotides, and fatty acids), and metabolic energy balance. HK2 can also bind to the mitochondrial outer membrane and voltage-dependent ion channels, preferentially acquiring newly synthesized ATP and increasing the utilization rate of glucose to glucose-6-phosphate. Mitochondrial HK2 also maintains the integrity of the mitochondrial outer membrane by limiting the release of apoptosis factors from the inner mitochondrial membrane to the outer mitochondrial membrane, protecting cancer cells from harmful stimuli. HK2 is closely associated with the specificity of various tumors with active glycolytic metabolism, playing an important role in tumor cell glycolysis, proliferation, and drug resistance. Studies have shown that knocking out HK2 can inhibit the proliferation of liver cancer, KRas-mutant non-small cell lung cancer, and HER2-positive breast cancer cells without producing side effects in adult mice. However, current technologies for understanding the regulatory mechanisms of HK2 expression are not yet sufficiently in-depth, hindering the development of drugs targeting HK2. Summary of the Invention

[0003] The present invention aims to provide regulatory agents for HK2 or c-Myc to solve the technical problem of the lack of drugs with HK2 as a therapeutic target in the prior art.

[0004] To achieve the above objectives, the present invention adopts the following technical solution:

[0005] Regulatory agents for HK2 and / or c-Myc, characterized in that they comprise shRNA and azadirachtin.

[0006] Furthermore, the shRNA sequence includes at least one of the sequences shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12.

[0007] This technical solution also provides the application of HK2 and / or c-Myc regulatory agents in the preparation of drugs with HK2 as the therapeutic target.

[0008] Furthermore, the drug is a medication for treating leukemia.

[0009] HK2 plays a crucial role in glycolysis, proliferation, and drug resistance in various tumor cells, such as liver cancer, non-small cell lung cancer, breast cancer, prostate cancer, leukemia, and myeloma. For ease of research, this study specifically selected human erythroleukemia cells (HEL cells) as the research object, using HK2 as the drug target to investigate various factors affecting HK2 expression and transcription. Through bioinformatics analysis, luciferase assays, ChIP, and point mutation experiments, it was found that c-Myc positively regulates HK2 expression; inhibiting HK2 expression with shRNA can inhibit cancer cell proliferation; and the small molecule compound azadirachtin inhibits c-Myc and HK2 expression, as well as the binding of c-Myc to the HK2 binding region, thus hindering cancer cell proliferation. Therefore, the function of HK2 and / or c-Myc can be regulated by using shRNA or azadirachtin. In particular, specific shRNAs can inhibit HK2 gene transcription and protein expression, and azadirachtin can also inhibit HK2 gene transcription and protein expression, while simultaneously downregulating c-Myc protein expression and blocking the binding between HK2 and c-Myc. Therefore, this technical solution provides shRNA and azadirachtin as regulatory agents for HK2 and / or c-Myc, allowing these two substances to be applied to the treatment of HK2-targeted diseases; or to the study of the mechanisms of HK2-related disease development, serving as a basic research tool. For example, shRNA and azadirachtin can be used to specifically inhibit HK2 expression, thereby observing changes in HK2-related signaling pathways and the responses of cancer cells or organisms. Furthermore, azadirachtin, as a small molecule compound, is easier to administer than shRNA, allowing for direct application and simplifying the complexities of research procedures, thus offering a significant advantage.

[0010] To select a suitable shRNA, the inventors conducted numerous screening experiments, ultimately discovering that one shRNA (HK2 shRNA1) exhibited the most ideal HK2 inhibitory effect. Azadirachtin (Rocaglamide, RocA), isolated from plants in the Meliaceae family, can be used for coughs, injuries, asthma, and inflammatory skin diseases. Azadirachtin is also an effective inhibitor of NF-κB activation in T cells and a potent selective inhibitor of heat shock factor 1 (HSF1) activation. However, there are currently no reports on the interaction between azadirachtin and HK2, making it a novel HK2 inhibitor.

[0011] This technical solution also provides a leukemia cell line that uses tetracycline to induce stable silencing of HK2, which is obtained by transfecting human erythroleukemia cells with the shRNA.

[0012] Furthermore, it is prepared by the following method: using a dual-plasmid lentiviral packaging system, co-transfecting packaging cells with a lentiviral inducible silencing vector expressing the shRNA to form recombinant lentiviral particles; infecting leukemia cells with the recombinant lentiviral particles, and screening to obtain leukemia cell lines that induce stable silencing of HK2; the dual-plasmid lentiviral packaging system includes plasmids pMD2.G and psPAX2.

[0013] The above-described technical approach enables the construction of stably silenced HK2 leukemia cell lines for studying HK2 function. Specifically, a dual-plasmid lentiviral packaging system (pMD2.G and psPAX2) is used to co-transfect packaging cells with a lentivirus inducible silencing vector expressing HK2 shRNA and Scramble shRNA, forming recombinant lentiviral particles. These particles are then used to infect leukemia cells, followed by selection to obtain stably silenced HK2 leukemia cell lines induced by an inducing agent. The stably silenced HK2 leukemia cell lines described in this approach reduce HK2 expression, arrest the cell cycle of leukemia cells, and decrease leukemia cell proliferation. The implementation of this approach contributes to the study of the role of HK2 in the development and progression of leukemia cells and the application of HK2 inhibitors in leukemia treatment, providing a reference for its application in the treatment of leukemia or other human cancers.

[0014] This technical solution also provides an application of azadirachtin in the preparation of c-Myc protein expression inhibitors.

[0015] This technical solution also provides the application of azadirachtin in the preparation of HK2 protein expression inhibitors and HK2 gene transcription inhibitors.

[0016] This technical solution also provides the application of azadirachtin in the preparation of a c-Myc protein-HK2 gene binding inhibitor.

[0017] Furthermore, azadirachtin is used to block the binding of c-Myc protein to the first intron of the HK2 gene.

[0018] This technical solution demonstrates through bioinformatics analysis, luciferase assays, ChIP, and point mutation experiments that c-Myc binds to the binding site within the first intron of HK2. Using c-Myc overexpression vectors, c-Myc siRNA, and lentivirus-mediated HK2-induced silencing of leukemia cell lines, combined with Western blot and luciferase assays, the cellular level was confirmed to show that c-Myc positively regulates HK2 expression, while HK2 cannot feedback regulate c-Myc expression. A small molecule compound, azadirachtin, inhibits the expression of c-Myc and HK2, as well as the binding of c-Myc to the HK2 binding region, thereby hindering the proliferation of leukemia cells.

[0019] Therefore, azadirachtin can be used as an inhibitor of c-Myc protein expression, an inhibitor of HK2 protein expression and HK2 gene transcription, and a blocker of c-Myc protein-HK2 binding. Its applications include: disease treatment targeting c-Myc and HK2; drug screening targeting c-Myc and HK2; and as a basic research tool, specifically inhibiting the binding of c-Myc protein to HK2 to observe physiological processes and reveal the mechanisms of disease occurrence and development. The binding of c-Myc to HK2 and the regulation of HK2 expression are related to various physiological processes, not limited to the occurrence and development of leukemia. The discovery of the effects of azadirachtin provides a novel research tool for related basic research. Attached Figure Description

[0020] Figure 1 The results of the c-Myc and HK2 binding site study in Example 1 are as follows (experimental data are expressed as mean ± standard deviation, n = 3). ** P < 0.01, * P < 0.05.

[0021] Figure 2 The results of the ChIP experiments in Examples 2, 3, and 8 were verified (experimental data are expressed as mean ± standard deviation, n = 3). ** P < 0.01, * P < 0.05.

[0022] Figure 3 The results of the experimental study on c-Myc regulation of HK2 expression and its effect on leukemia cell proliferation in Examples 3-7 are as follows (experimental data are expressed as mean ± standard deviation, n=3). ** P < 0.01, * P < 0.05.

[0023] Figure 4 The experimental results of the study on the effect of azadirachtin in Example 8 (experimental data are expressed as mean ± standard deviation, n = 3, ** P < 0.01, * P < 0.05. Detailed Implementation

[0024] The present invention will be further described in detail below with reference to embodiments, but the implementation of the present invention is not limited thereto. Unless otherwise specified, the technical means used in the following embodiments and experimental examples are conventional means well known to those skilled in the art, and the materials and reagents used can all be obtained commercially.

[0025] Example 1: Study on the binding sites of c-Myc and HK2

[0026] (1) Predicting HK2 sequence segments containing potential c-Myc binding sites

[0027] To elucidate the regulatory mechanism of HK2 expression in leukemia cells, the JASPER database was used to predict that the +518 to +1042 region of the first intron of human HK2 contains two c-Myc binding sites with the binding sequence CACGTG. NCBI BLAST analysis of the HK2 first intron region sequences from humans, chimpanzees, mice, rats, and Chinese hamsters revealed two c-Myc binding sites in all samples. Figure 1 (A and 1B). Figure 1 In the image, A represents the c-Myc binding site in the first intron of human HK2 predicted by the JASPER database, shown in the gray box; B represents the two c-Myc binding sites in the first intron region of HK2 in humans, chimpanzees, mice, rats, and Chinese hamsters as shown in the gray box, as analyzed by NCBI BLAST.

[0028] The sequence of the first intron of HK2, from +518 to +1042, is (SEQ ID NO.1):

[0029] GTAAGTCAGCGCGGGCGGGGCGGCAGGCTGGGCTCTGGCAAAGTGGTCTGGCCTCCATCAGTCTCTTCCTCGACCCTGCGGGGACCCGCTTCCTCCCTACTCCGGGCCTGGGAGCGGAAAAAGTTTGGGCAGCCGGGACACTCCTGGGCGCCAGGAGCCACGTCCGCTAAGCACAGCCGGCGAGTGCGCGCGGGC GGGGAGCCGAGGTCGCGCTCCGCCGGGCGCCCTCCCTCCCTGAGCTCCGGCACGCGCTCACGCTCTCTCCCCCAGTCCCTTTTTCCCTGTTACTGGAGGGGCGGGTCACCCCGCAGGTAGTCAGGGATTGCTGCGCCCACGTGGGAGGGAGCCCCCTTCTGCAGCGCGAGTTCCGGCGAGAGCACGTGGAGAGAAT CGTGGCTGCGGGAGGCTGCTCCGCTGCCGCGTGGGGCCGCCGGGGGCCGTCCGCGCTCGCGGACCGCGTGTAGGAGACGAGCGGTTCCCTTCTCCTTCCCCGCGGCCCTGCGGGGGTGGGCTCGAGGAGAAGCTG.

[0030] (2) Luciferase reporter gene assay to verify the binding of c-Myc to the HK2 binding sequence.

[0031] First, a wild-type luciferase vector, pGL3basic-HK2 intron1, was constructed within the +518 to +1042 region of the first intron of HK2. Different amounts of the c-Myc coding region expression vector pcDNA3.1(-)-c-Myc and the wild-type luciferase vector pGL3basic-HK2 intron1 were transfected into 293T cells. Forty-eight hours after transfection, the binding of c-Myc to the first intron of HK2 was detected by luciferase assay, and the expression level of c-Myc was analyzed by Western blotting.

[0032] The results showed that with the increase of c-Myc expression, the luciferase activity of the wild-type vector pGL3 basic-HK2 intron1 increased. Figure 1 (C and 1D). Figure 1In the figure, C represents the effect of different amounts of c-Myc and pGL3 basic-HK2intron1 on luciferase activity as determined by the luciferase assay; D represents the expression level of c-Myc after transfection with different amounts of c-Myc and pGL3 basic-HK2intron1 as determined by Western blot. Figure 1 In the figure, c-Myc represents the c-Myc coding region expression vector pcDNA3.1(-)-c-Myc; HK2 (HK2 intron1) represents the wild-type luciferase vector pGL3 basic-HK2 intron1 (integrated with the HK2 first intron +518 to +1042 segment).

[0033] (3) ChIP experiment to verify the binding of c-Myc to the first intron of HK2 in leukemia cells

[0034] Human erythroleukemia cells (HEL cells) were cross-linked with formaldehyde, and the reaction was terminated with glycine. Cell membranes were permeabilized with lysis buffer to release cellular components, and the nuclei were precipitated. Chromatin was fragmented into 150–900 bp fragments using micrococcal nuclease digestion. Target proteins in the protein-DNA complex were captured by immunoprecipitation using c-Myc antibody (Cell Signaling Tchnology, #9402) bound to immunomagnetic beads. Normal Rabbit IgG (Cell Signaling Tchnology, #2729) was used as a negative control antibody. The cross-linked chromatin-antibody-magnetic bead complex was decontaminated with 5M NaCl and Proteinase K at 65°C, and DNA was purified by column centrifugation. HK2 intron1 in DNA was quantified by real-time PCR, and HK2 intron1 in DNA was detected by PCR.

[0035] The primer sequences designed for the +825 to +911 region (within the +518 to +1042 region of the first intron of HK2) are as follows:

[0036] HK2 ChIP forward primer: GCAGGTAGTCAGGGATTGCT (SEQ ID NO.2);

[0037] HK2 ChIP reverse primer: ACGATTCTCTCCACGTGCTC (SEQ ID NO.3).

[0038] The primer sequence designed for the -1818 to -1674 region (outside the first intron of HK2, from +518 to +1042) is as follows:

[0039] HK2 ChIP Up forward primer: GGAACGTCAATGAGGAGGAA (SEQ ID NO.4);

[0040] HK2 ChIP Up reverse primer: TGCTTGGCATTCACACTAGC (SEQ ID NO.5).

[0041] The results show that c-Myc can bind to the +825 to +911 region within the first intron of HK2, but cannot bind to the -1818 to -1674 region outside the first intron of HK2. Figure 2 (C and 2D). In Figure 2 In the diagrams C and D, we see that ChIP experiments were used to detect the binding of c-Myc to the +825–+911 sequence in HK2, with the -1818–-1674 sequence in HK2 serving as a control. Therefore, c-Myc targets and binds to the +518–+1042 region downstream of the transcription start site in the HK2 promoter.

[0042] Example 2: Study on the effect of binding sites on the transcriptional regulation of c-Myc

[0043] This embodiment investigated whether c-Myc's transcriptional regulation of HK2 depends on two binding sites within the first intron of HK2. A point mutation experiment was used to mutate the first HK2 binding site, CACGTG, to... G AC A The second binding site of TG,HK2, CACGTG is mutated to G AC C TG( Figure 2 A) Mutant luciferase vectors pGL3basic-HK2intron1 M1 and pGL3 basic-HK2 intron1 M2 were constructed targeting two point mutation binding sites. The point mutant luciferase vectors and the c-Myc expression vector pcDNA3.1(-)-c-Myc were transiently transfected into 293T cells. The wild-type luciferase vector pGL3 basic-HK2intron1 served as a control. Luciferase assays were used to detect the effect of the HK2 binding sequence point mutation on c-Myc binding.

[0044] The results showed that, compared with the wild-type luciferase vector pGL3 basic-HK2 intron1, the luciferase activity of the mutant vectors pGL3 basic-HK2 intron1 M1 and pGL3 basic-HK2 intron1 M2 was significantly decreased. Figure 2 B). Figure 2In section B, c-Myc represents the c-Myc coding region expression vector pcDNA3.1(-)-c-Myc; HK2 represents the wild-type luciferase vector pGL3 basic-HK2 intron1 (integrated with the +518 to +1042 region of the first intron of HK2); pcDNA3.1 represents the pcDNA3.1(-) vector; pGL3 basic represents the luciferase vector pGL3 basic; HK2 M1 represents pGL3 basic-HK2intron1 M1 (integrated with the +518 to +1042 region of the first intron of HK2, where the first binding site is mutated to GACATG); HK2 M2 represents pGL3 basic-HK2 intron1 M2 (integrated with the +518 to +1042 region of the first intron of HK2, where the second binding site is mutated to GACCTG). Without the addition of azadirachtin, c-Myc binds to HK2 intron1 and exhibits strong fluorescence intensity. The fluorescence intensity of pcDNA3.1, which does not contain the c-Myc coding region, decreased significantly after co-transformation with HK2 intron1.

[0045] The primer sequences used to construct the mutant vectors HK2 M1 and HK2 M2 targeting the two HK2 binding sites are as follows:

[0046] HK2 M1 forward primer: TCAGGGATTGCTGCGCCGACCTGGGAGGGAGCCCCCTTCT (SEQ ID NO.6);

[0047] HK2 M1 reverse primer: AGAAGGGGGCTCCCTCCCAGGTCGGCGCAGCAATCCCTGA (SEQ ID NO.7);

[0048] HK2 M2 forward primer: GCGAGTTCCGGCGAGAGGACCTGGAGAGAATCGTGGCTGC (SEQ ID NO.8);

[0049] HK2 M2 reverse primer: GCAGCCACGATTCTCTCCAGGTCCTCTCGCCGGAACTCGC (SEQ ID NO.9).

[0050] Example 3: Screening and identification of shRNAs of HK2 in leukemia cells that effectively silence leukemia cells

[0051] (1) HK2 shRNA sequence

[0052] The HK2 shRNA sequence designed in this invention is as follows:

[0053] CCAAAGACATCTCAGACATTGTTCAAGAGACAATGTCTGAGATGTCTTTGGTTTTTT (SEQ ID NO. 10);

[0054] CGAGCCATCCTGCAACACTTATTCAAGAGATAAGTGTTGCAGGATGGCTCGTTTTTT (SEQ ID NO. 11);

[0055] GCGCATCAAGGAGAACAAAGGTTCAAGAGACCTTTGTTTCTCCTTGATGCGCTTTTTT(SEQ IDNO.12);

[0056] The above sequences were synthesized by Shandong Weizhen Biotechnology Co., Ltd., and were named HK2 shRNA1, HK2 shRNA2 and HK2 shRNA3, respectively.

[0057] The lentiviral silencing vector, pLent-U6-shRNA-CMV-copGFP-P2A-Puro, was provided by Shandong Weizhen Biotechnology Co., Ltd., and the HK2 shRNA lentiviral expression vector was constructed.

[0058] (2) Scram shRNA sequence

[0059] The Scram shRNA sequence designed in this invention is as follows:

[0060] GCACCCAGTCCGCCCTGAGCAAATTCAAGAGATTTGCTCAGGGCGGACTGGGTGCTTTTT (SEQ ID NO. 13);

[0061] GGCGACACCCTGGTGAACCGCATTTCAAGAGAATGCGGTTCACCAGGGTGTCGCCTTTTT (SEQ ID NO. 14);

[0062] GGCGTGCAGTGCTTCAGCCGCTATTCAAGAGATAGCGGCTGAAGCACTGCACGCCTTTTT(SEQ IDNO.15);

[0063] GCCCACCCGCGTGACCACCCTGATTCAAGAGATCAGGGTGGTCACGAGGGTGGGCTTTTT (SEQ ID NO. 16).

[0064] The above sequence was synthesized by Shandong Weizhen Biotechnology Co., Ltd., named Scra shRNA, and constructed in the lentiviral vector pLent-U6-shRNA-CMV-copGFP-P2A-Puro.

[0065] (3) Drug screening to stabilize infected cells

[0066] After routine lentiviral packaging and cell infection, 1 μg / mL puromycin was added for selection for 2–3 weeks to obtain stable silent HK2 leukemia cells HEL, which were named HK2 shRNA HEL.

[0067] (4) Identification of the effect of HK2 shRNA in silencing HK2

[0068] (4.1) Real-time PCR was used to identify the effect of HK2 shRNA silencing on HK2.

[0069] Total RNA was extracted from HK2 shRNA HEL cells using the Trizol method, and cDNA was obtained by reverse transcription. The relative expression level of the HK2 gene in HK2 shRNA HEL cells was detected by real-time PCR, with β-actin gene used as an internal reference gene.

[0070] The primers used are as follows:

[0071] Primer pair used to amplify HK2:

[0072] Upstream primer: GATTTCACCAAGCGTGGACT (SEQ ID NO.17);

[0073] Downstream primer: ACAGGTGCTCTCAAGCCCTA (SEQ ID NO.18);

[0074] Primer pair used to amplify β-actin:

[0075] Upstream primer: GTGACGTTGACATCCGTAAAGA (SEQ ID NO.19);

[0076] Downstream primer: GCGGACTCATCGTACTCC (SEQ ID NO.20);

[0077] Primer pair used to amplify HK1:

[0078] Upstream primer: TCCTCGTCAAGACAGTGTGC (SEQ ID NO.21);

[0079] Downstream primer: ACATTCAGACGGTCCAGTCC (SEQ ID NO.22).

[0080] Real-time PCR results showed that, compared with Scra shRNA, HK2 shRNA1 and HK2 shRNA3 significantly inhibited HK2 mRNA levels, with HK2 shRNA1 showing the best inhibitory effect on HK2 mRNA levels. Figure 3 A). Figure 3 Figure A specifically demonstrates the silencing effect of HK2 shRNA1, HK2 shRNA2, and HK2 shRNA3 in leukemia cells using Real-time PCR analysis. The statistical bars in the figure, from left to right, represent Scra shRNA, HK2 shRNA1, HK2 shRNA2, and HK2 shRNA3.

[0081] (4.2) Western blot analysis of the interference effect of HK2 shRNA on HK2 protein

[0082] Total HEL protein of HK2 shRNA was extracted using RIPA method, and its protein concentration was determined by BCA method. Denaturation was performed, followed by SDS-PAGE electrophoresis and immunoblotting. Western blot results showed that compared with Scra shRNA, HK2 shRNA1 and HK2 shRNA3 significantly inhibited the protein level of HK2, with HK2 shRNA1 showing the best inhibitory effect. Figure 3 B). Figure 3 A specifically demonstrates the silencing effects of HK2 shRNA1, HK2 shRNA2, and HK2 shRNA3 in leukemia cells using Western blot analysis (Scra shRNA as a control and β-actin as an internal reference).

[0083] Example 4: Establishment of a stable silencing HK2 leukemia cell line

[0084] The HK2 shRNA1 sequence designed in this invention was selected as the HK2 shRNA sequence for the inducible expression system to construct an induced stable silence HK2 leukemia cell line.

[0085] The Scram shRNA sequence of the inducible expression system designed in this invention is as follows:

[0086] AAGGCAGAAGTATGCAAAGCATTAGTGAAGCCACAGATGTAATGCTTTGCATACTTCTGCCTG (SEQ ID NO. 23).

[0087] The lentiviral inducible silencing vector, pLent-TRE3G-ZsGreen-mir30-hPGK-rtTA-SV40-Puro, was provided by Shandong Weizhen Biotechnology Co., Ltd., and the lentiviral inducible expression vectors for HK2 shRNA and Scram shRNA were constructed.

[0088] Lentiviral packaging and cell infection were performed using standard techniques. The HK2 shRNA lentiviral inducible expression vector, pMD2.G plasmid, psPAX2 plasmid, and Lipfectamine 2000 were mixed in serum-free DMEM and added to 293T cells. Forty-eight hours after transfection, the virus-containing cell supernatant was collected into centrifuge tubes. The viral supernatant was added to complete culture medium at a 1:1 ratio to leukemia cells, and polybrene was added to a final concentration of 10 μg / mL.

[0089] After routine lentiviral packaging and cell infection (on the third day post-infection), 1 μg / mL puromycin was added for selection over 2–3 weeks to obtain stably induced silencing HEL cells for HK2 leukemia, named inHK2 shRNA HEL. A stably induced silencing control leukemia cell line was named inScra shRNA HEL. After induction with 0.5 μg / mL tetracycline for 48 or 72 hours, the silencing effect of inHK2 shRNA HEL on HK2 was assessed by fluorescence microscopy, real-time PCR, and Western blot.

[0090] Fluorescence microscopy revealed the successful construction of a stably silenced HK2 leukemia cell line, which exhibited green fluorescence 72 hours after tetracycline induction. Compared to the inScra shRNA HEL, the mRNA and protein levels of HK2 in the inHK2 shRNA HEL were significantly decreased. Figure 3 (D and 3G). In Figure 3 In the figure, D represents the mRNA level of HK2 in HEL cells without tetracycline induction or after 48 hours of tetracycline induction, measured by real-time PCR; G represents the protein levels of HK2, HK1, and c-Myc in HEL cells without tetracycline induction and after 72 hours of tetracycline induction, measured by Western blot.

[0091] Example 5: Determination of the proliferation rate of stable silenced HK2 leukemia cells

[0092] Stable silenced HK2 leukemia cells were plated and proliferated for 24, 48, and 72 hours. The uptake values ​​were measured using the MTT assay. The growth rate of these stably silenced HK2 leukemia cells was assessed using the MTT assay. The results showed that HK2shRNA significantly inhibited the growth rate of leukemia cells compared to Scra shRNA (3C). Tetracycline-induced inHK2 shRNA HEL cells showed a significantly slower growth rate than inScra shRNA HEL cells (3H). Figure 3 In the figure, C represents the experimental results of the effect of HK2 shRNA1 on the proliferation of leukemia cells; H represents the growth curve of the induced stable silenced HK2 leukemia cell line.

[0093] Example 6: Determination of the cell cycle induction of stable silencing in HK2 leukemia cells

[0094] Stable silenced HK2 leukemia cells were collected 72 hours after tetracycline induction, fixed overnight in pre-cooled 70% ethanol, stained with PI method, and analyzed using a Novocyte 2040R flow cytometer. The flow cytometry software parameters were set, and the cell proportions at each phase were measured. Flow cytometry results showed that, compared with inScramble shRNA HEL, inHK2 shRNA HEL significantly arrested the cell cycle at the G0 / G1 phase. Figure 3 I). Figure 3 I represents the changes in the cell cycle of inHK2 shRNA HEL cells 72 hours after tetracycline induction, with inScra shRNA HEL serving as a control.

[0095] Example 7: Study on the regulatory relationship between c-Myc and HK2

[0096] A lentivirus-mediated HK2-induced silencing leukemia strain was constructed. After tetracycline induction for 72 hours, Western blot results showed that HK2 expression was significantly downregulated, while the expression of HK1 and c-Myc remained largely unchanged. Figure 3 G). After tetracycline induction for 48 hours, real-time PCR results showed that HK2 expression was significantly downregulated, while the expression of HK1 and c-Myc remained largely unchanged. Figure 3 DF).

[0097] When c-Myc siRNA was transfected into leukemia cells, Western blot results showed decreased protein expression levels of both c-Myc and HK2. Figure 3 J). The c-Myc coding region expression vector pcDNA3.1(-)-c-Myc was transformed into leukemia cells. Western blot results showed increased protein expression levels of c-Myc and HK2. Figure 3 K).

[0098] exist Figure 3 In the table, G represents the protein levels of HK2, HK1, and c-Myc in HEL cells after tetracycline induction (without and after 72 hours of tetracycline induction) measured by Western blot; DF represents the mRNA levels of HK2 (D), HK1 (E), and c-Myc (F) in HEL cells after tetracycline induction (without and after 48 hours of tetracycline induction) measured by real-time PCR; J represents the effect of c-Myc siRNA on the expression of c-Myc, HK2, and HK1 in HEL cells after 72 hours of treatment by Western blot; and K represents the changes in the expression of HK2 and HK1 in HEL cells after 72 hours of c-Myc overexpression measured by Western blot.

[0099] Example 8: Study on the effects of azadirachtin

[0100] Studies have shown that azadirachtin inhibits c-Myc protein expression, downregulates HK2 expression, and blocks the binding of c-Myc to the first intron of HK2, thereby inhibiting HK2 expression regulated by the c-Myc pathway. Azadirachtin can serve as a c-Myc and HK2 binding inhibitor, and can be applied to research on the pathogenic mechanisms of c-Myc and HK2 binding or for the treatment of related diseases. c-Myc binding to HK2 and regulating HK2 expression are associated with various physiological processes, such as angiogenesis and tumors. Azadirachtin can inhibit c-Myc and HK2 binding, and can be considered a potential drug for diseases related to c-Myc and HK2 binding. This technical approach specifically illustrates the effects by using the inhibition of leukemia cell proliferation as an example. Azadirachtin can also serve as a basic research tool, used as a c-Myc and HK2 binding inhibitor, to explore changes in associated signaling pathways after the inhibition of c-Myc and HK2 binding (not limited to leukemia-related cells), thereby revealing the mechanisms of disease occurrence and development.

[0101] (1) Real-time PCR showed azadirachtin (structural formula see below) Figure 4 A) Downregulates HK2 mRNA levels, while having little effect on the regulation of HK1 and c-Myc. Figure 4 BD). Western blot results showed that azadirachtin downregulated the protein levels of c-Myc and HK2, but did not downregulate the protein level of HK1. Figure 4 E). In Figure 4In the figure, BD represents the effect of real-time PCR on the expression of azadirachtin (B), HK1 (C), and c-Myc (D); E represents the effect of Western blot on the expression of c-Myc, HK2, and HK1.

[0102] The primer sequences used are as follows:

[0103] c-Myc forward primer: CCTACCCTCTCAACGACAGC (SEQ ID NO.24);

[0104] c-Myc reverse primer: ACTCTGACCTTTTGCCAGGA (SEQ ID NO.25);

[0105] HK2 forward primer: GATTTCACCAAGCGTGGACT (SEQ ID NO.26);

[0106] HK2 reverse primer: ACAGGTGCTCTCAAGCCCTA (SEQ ID NO.27).

[0107] (2) Azadirachtin inhibits the binding of c-Myc to HK2 in leukemia cells.

[0108] The c-Myc coding region expression vector pcDNA3.1(-)-c-Myc and the wild-type luciferase vector pGL3 basic-HK2intron1 were transfected into 293T cells at a dose of 1.25 μg / well in 6-well plates. Transfection was performed 48 hours later, with azadirachtin added during transfection. Luciferase activity was measured 16 hours after azadirachtin treatment. Results showed that, compared to the untreated group, luciferase activity was reduced after treatment with 100 nM azadirachtin in 293T cells. Figure 2 B). Among them. Figure 2 B represents the effect of a luciferase assay on c-Myc binding due to a point mutation in the HK2 binding sequence. Azadirachtin inhibits the binding of c-Myc to the HK2 binding sequence. Without azadirachtin, c-Myc binds to HK2 intron1 and exhibits strong fluorescence intensity. However, after treatment with azadirachtin, the binding of c-Myc to HK2 intron1 weakens, and the fluorescence intensity significantly decreases. This demonstrates that azadirachtin can act as a binding inhibitor between c-Myc protein and the HK2 gene.

[0109] ChIP experiments showed that, compared to the untreated group, HEL cells treated with 100 nM azadirachtin for 1 hour exhibited a significant decrease in the binding of c-Myc to HK2 intron1. Figure 4(F and G). Based on the above experimental results, it is suggested that azadirachtin may induce the downregulation of HK2 by downregulating c-Myc expression and inhibiting the binding of c-Myc to HK2. Figure 4 In the figure, F and G represent the effects of HEL-treated azadirachtin on the binding of c-Myc to HK2 intron1 as detected by ChIP experiments.

[0110] (3) Azadirachtin inhibits the proliferation of leukemia cells.

[0111] Treatment of leukemia cells with different concentrations of azadirachtin for 1–3 days showed that azadirachtin inhibited the proliferation of leukemia cells in a concentration- and time-dependent manner. Figure 4 H). Figure 4 Growth curves of HEL cells treated with 3.125nM to 100nM azadirachtin for 1 to 3 days. Figure 4 I represents the inhibition rate and IC50 of HEL cells treated with 3.125 nM to 100 nM azadirachtin for 3 days. 50 .

[0112] The above descriptions are merely embodiments of the present invention, and common knowledge such as specific technical solutions and / or characteristics are not described in detail here. It should be noted that those skilled in the art can make various modifications and improvements without departing from the technical solutions of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications and improvements will not affect the effectiveness of the implementation of the present invention or the practicality of the patent. The scope of protection claimed in this application should be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.

Claims

1. The application of HK2 and / or c-Myc regulatory agents in the preparation of drugs targeting HK2, characterized in that, The regulatory agent for HK2 and / or c-Myc is an shRNA with the sequence shown in SEQ ID NO.10, and the drug is a drug for treating erythroleukemia.

Images