Protein for negatively regulating drought resistance of plant, gene encoding the protein and application thereof

Abstract

The application discloses a gene for negatively regulating drought resistance of plants and an application of a coded protein thereof, and particularly discloses a protein GmPLATZ17 with an amino acid sequence of SEQ ID No. 1 and an application of a coded gene GmPLATZ17 of the protein in regulating drought resistance of plants. The application obtains a gene knockout plant GmPLATZ17-RNAi and a gene editing plant gmplatz17 by performing gene knockout and gene editing on a soybean GmPLATZ17 gene. Experiments prove that, compared with wild-type soybean plants, the gene knockout plant and the gene editing plant have a higher survival rate, excellent growth and physiological detection indexes, and better drought resistance, indicating that the GmPLATZ17 gene has a function of regulating drought resistance of plants, and the drought resistance of plants can be significantly improved by inhibiting expression of the GmPLATZ17 protein and the coded gene thereof.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to proteins that negatively regulate plant drought resistance, their encoding genes, and their applications. Background Technology

[0002] Soybean (Glycine max (Linn.) Merr.) is an important food and oilseed crop. Its seeds are rich in protein, providing 70% of the world's edible protein, and are also an emerging feedstock for biodiesel. With the increasing frequency of global climate change and natural disasters, soybeans are subjected to various environmental stresses during their growth and development. Drought, high salinity, and low temperatures, in particular, severely impact soybean yield and quality. Therefore, studying the response and signal transduction mechanisms of soybeans to adverse conditions and improving their stress resistance has become a crucial task in soybean genetic research and variety improvement. Developing stress-resistant new varieties remains a significant requirement for sustainable agricultural development.

[0003] Abiotic stresses can cause changes in plant physiological traits and metabolism, affecting plant growth and development. Under abiotic stress, plants produce a series of responses, accompanied by many physiological, biochemical, and developmental changes. Clarifying the mechanisms of crop response to environmental stress will provide a scientific basis for breeding stress-resistant and high-yielding varieties. In addition to traditional breeding, research on plant stress resistance has gradually penetrated to the cellular and molecular levels. Therefore, identifying stress-resistance-related genes and applying them to crop genetic breeding will become an effective means of improving specific stress-resistance traits in crops. This has significant theoretical guiding significance and practical application value for breeding new stress-resistant varieties and improving crop stress resistance. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to regulate the drought resistance of plants, and / or how to improve the drought resistance of plants. The technical problem to be solved is not limited to the described technical subject matter; other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0005] To address the aforementioned technical problems, the present invention first provides the application of proteins or substances that regulate the activity and / or content of said proteins, wherein the application may be any of the following:

[0006] D1) The application of proteins or substances that regulate the activity and / or content of said proteins in regulating plant drought resistance;

[0007] D2) The use of proteins or substances that regulate the activity and / or content of said proteins in the preparation of products that regulate plant drought resistance;

[0008] D3) The application of proteins or substances that regulate the activity and / or content of said proteins in the cultivation of drought-resistant plants;

[0009] D4) The use of proteins or substances that regulate the activity and / or content of said proteins in the preparation of products for cultivating drought-resistant plants;

[0010] D5) The application of proteins or substances that regulate the activity and / or content of said proteins in plant breeding;

[0011] The protein is named GmPLATZ17 and can be any of the following:

[0012] A1) The amino acid sequence of this protein is that of SEQ ID No. 1;

[0013] A2) A protein that has more than 80% identity with and has the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 1.

[0014] A3) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0015] To facilitate the purification or detection of the protein in A1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No. 1 in the sequence listing.

[0016] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.

[0017] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein GmPLATZ17 of this invention using known methods, such as directed evolution or point mutation. Artificially modified nucleotides that possess 75% or more of the nucleotide sequence identity with the protein GmPLATZ17 isolated in this invention, provided they encode and function as protein GmPLATZ17, are derived from and equivalent to the nucleotide sequence of this invention.

[0018] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0019] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0020] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0021] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein GmPLATZ17.

[0022] In the above text, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0023] The substance that regulates gene expression can be any of the biological materials described in B1)-B4).

[0024] In the above applications, the protein may be derived from soybean (Glycine max (Linn.) Merr.).

[0025] The present invention also provides applications of biomaterials related to the protein GmPLATZ17, wherein the applications may be any of the following:

[0026] E1) Application of biomaterials related to the protein GmPLATZ17 in regulating plant drought resistance;

[0027] E2) Application of biomaterials related to the protein GmPLATZ17 in the preparation of products that regulate plant drought resistance;

[0028] E3) Application of biomaterials related to the protein GmPLATZ17 in the cultivation of drought-resistant plants;

[0029] E4) Application of biomaterials related to the protein GmPLATZ17 in the preparation of products for cultivating drought-resistant plants;

[0030] E5) Application of biomaterials related to the protein GmPLATZ17 in plant breeding;

[0031] The biomaterial may be any one of the following B1) to B8):

[0032] B1) The nucleic acid molecule encoding the protein GmPLATZ17;

[0033] B2) Nucleic acid molecules that inhibit, reduce, or silence the expression of the gene encoding the protein GmPLATZ17;

[0034] B3) An expression cassette containing the nucleic acid molecules described in B1) and / or B2);

[0035] B4) A recombinant vector containing the nucleic acid molecules described in B1) and / or B2), or a recombinant vector containing the expression cassette described in B3);

[0036] B5) Recombinant microorganisms containing the nucleic acid molecules described in B1) and / or B2), or recombinant microorganisms containing the expression cassette described in B3), or recombinant microorganisms containing the recombinant vector described in B4);

[0037] B6) A transgenic plant cell line containing the nucleic acid molecules described in B1) and / or B2), or a transgenic plant cell line containing the expression cassette described in B3);

[0038] B7) Transgenic plant tissue containing the nucleic acid molecules described in B1) and / or B2), or transgenic plant tissue containing the expression cassette described in B3);

[0039] B8) A transgenic plant organ containing the nucleic acid molecules described in B1) and / or B2), or a transgenic plant organ containing the expression cassette described in B3).

[0040] In the above applications, B1) the nucleic acid molecule may be a DNA molecule whose coding sequence (CDS) is SEQ ID No. 2 or a cDNA molecule whose nucleotide sequence is SEQ ID No. 2; B2) the nucleic acid molecule may be a DNA molecule whose nucleotide sequence is SEQ ID No. 3.

[0041] The DNA molecule shown in SEQ ID No. 2 (gene GmPLATZ17 that regulates plant drought resistance) encodes the protein GmPLATZ17 of SEQ ID No. 1.

[0042] The nucleotide sequence shown in SEQ ID NO.2 is the nucleotide sequence of the gene encoding the protein GmPLATZ17 (GmPLATZ17 gene). The protein GmPLATZ17 gene described in this invention can be any nucleotide sequence capable of encoding the protein GmPLATZ17. Considering codon degeneracy and codon preferences among different species, those skilled in the art can use codons suitable for expression in specific species as needed.

[0043] B1) The nucleic acid molecule may also include a nucleic acid molecule obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No. 2.

[0044] The nucleic acid molecules also include nucleic acid molecules that have a nucleotide sequence identity of more than 95% with that shown in SEQ ID No. 2 and originate from the same species.

[0045] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0046] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, they may be Peasyblunt vector, vector pCAMBIA1302, vector pCAMBIA3301, and / or Cas9 / gRNA-vector (pVK005, Beijing Weishang Lide Biotechnology Co., Ltd.).

[0047] The microorganisms described in this article may be yeast, bacteria, algae, or fungi. Among them, bacteria may originate from genera such as *Escherichia*, *Erwinia*, *Agrobacterium*, *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus*. Specifically, they may be *Agrobacterium* GV3101, *Agrobacterium* K599, and / or the TOP10 competent cells of *Escherichia coli*.

[0048] The recombinant vector may specifically be the recombinant vector Peasyblunt-GmPLATZ17, the recombinant vector 3301-GmPLATZ17, the recombinant vector 3301-GmPLATZ17-RNAi, and / or the recombinant vector Cas9-GmPLATZ17.

[0049] The recombinant vector Peasyblunt-GmPLATZ17 is obtained by using blunt-end cloning, where the DNA fragment with the nucleotide sequence of SEQ ID No. 2 in the sequence listing is ligated into the Peasyblunt vector while keeping the other sequences of the Peasyblunt vector unchanged.

[0050] The recombinant vector 3301-GmPLATZ17 is a recombinant expression vector obtained by replacing the fragment (small fragment) between the Nco I and BstE II recognition sites of the pCAMBIA3301 vector with the DNA fragment whose nucleotide sequence is SEQ ID No. 2 in the sequence listing, while keeping the other sequences of the pCAMBIA3301 vector unchanged.

[0051] The recombinant vector 3301-GmPLATZ17-RNAi is obtained by replacing the fragment (small fragment) between the Nco I and BstE II recognition sites of the pCAMBIA3301 vector with the DNA fragment whose nucleotide sequence is SEQ ID No. 3 in the sequence listing, while keeping the other sequences of the pCAMBIA3301 vector unchanged, resulting in a recombinant expression vector, i.e., an RNA interference vector.

[0052] The recombinant vector Cas9-GmPLATZ17 is a recombinant expression vector, i.e., an editing vector, obtained by inserting the sgRNA target sequence of GmPLATZ17 (5'-GGATTCACGGAGATGCCGCGAGG-3', positions 68-90 of SEQ ID No. 2) into the Cas9 / gRNA-vector plasmid.

[0053] The recombinant microorganism may specifically be recombinant Agrobacterium GV3101 / 1302-GmPLATZ17, recombinant Agrobacterium K599 / 3301-GmPLATZ17, recombinant Agrobacterium K599 / 3301-GmPLATZ17-RNAi and / or recombinant Agrobacterium GV3101 / Cas9-GmPLATZ17.

[0054] The recombinant Agrobacterium GV3101 / 1302-GmPLATZ17 contains the DNA molecule shown in SEQ ID No. 2 and is a recombinant bacterium obtained by introducing the recombinant vector 1302-GmPLATZ17 into Agrobacterium GV3101.

[0055] The recombinant Agrobacterium K599 / 3301-GmPLATZ17 contains the DNA molecule shown in SEQ ID No. 2 and is a recombinant bacterium obtained by introducing the recombinant vector 3301-GmPLATZ17 into Agrobacterium K599.

[0056] The recombinant Agrobacterium K599 / 3301-GmPLATZ17-RNAi contains the DNA molecule shown in SEQ ID No. 3 and is a recombinant bacterium obtained by introducing the recombinant vector 3301-GmPLATZ17-RNAi into Agrobacterium K599.

[0057] The recombinant Agrobacterium GV3101 / Cas9-GmPLATZ17 contains an sgRNA target sequence (GGATTCACGGAGATGCCGCGAGG, positions 68-90 of SEQ ID No. 2) and is a recombinant bacterium obtained by introducing the recombinant vector Cas9-GmPLATZ17 into Agrobacterium GV3101.

[0058] The present invention also provides a method for cultivating drought-resistant plants, the method comprising reducing the content and / or activity of the protein GmPLATZ17 in the target plant to obtain a drought-resistant plant with higher drought resistance than the target plant.

[0059] In the above method, the reduction of the content and / or activity of the protein GmPLATZ17 in the target plant can be achieved by reducing the expression level and / or activity of the gene encoding the protein GmPLATZ17 in the target plant.

[0060] In the above method, reducing the expression level and / or activity of the gene encoding the protein GmPLATZ17 in the target plant can be achieved by using gene mutation, gene knockout, gene editing or gene knockdown techniques to reduce or inactivate the gene encoding the protein GmPLATZ17 in the genome of the target plant.

[0061] In the above method, the use of gene editing technology to reduce or inactivate the gene encoding the protein GmPLATZ17 in the target plant genome can be performed using a CRISPR / Cas9 system. The CRISPR / Cas9 system includes a vector expressing sgRNA that targets the gene encoding the protein GmPLATZ17, and the target sequence of the sgRNA is positions 68-90 of SEQ ID No. 2.

[0062] In one embodiment of the present invention, the method for cultivating drought-resistant plants includes the following steps:

[0063] (1) Construct the CRISPR / Cas9 recombinant vector Cas9-GmPLATZ17 targeting positions 68-90 of SEQ ID No. 2;

[0064] (2) Introduce the recombinant vector Cas9-GmPLATZ17 constructed in step (1) into the target plant (such as soybean);

[0065] (3) Through screening and identification, drought-resistant plants with higher drought resistance than the target plant were obtained.

[0066] In the above method, the gene knockout technique used to reduce or inactivate the gene encoding the protein GmPLATZ17 in the target plant genome can be performed using an RNA interference vector, wherein the RNA interference vector contains a DNA molecule whose nucleotide sequence is SEQ ID No. 3.

[0067] In one embodiment of the present invention, the method for cultivating drought-resistant plants includes the following steps:

[0068] (1) Construct the RNA interference vector 3301-GmPLATZ17-RNAi to inhibit the expression of the target gene GmPLATZ17;

[0069] (2) The RNA interference vector 3301-GmPLATZ17-RNAi constructed in step (1) is introduced into the target plant (such as soybean);

[0070] (3) Through screening and identification, drought-resistant plants with higher drought resistance than the target plant were obtained.

[0071] In the above methods, the RNA interference vector or gene editing vector is introduced into the recipient plant (such as soybean or Arabidopsis thaliana), including but not limited to: transforming plant cells or tissues using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electrocoagulation, Agrobacterium-mediated transformation, and cultivating the transformed plant tissues into plants.

[0072] The protein GmPLATZ17, and / or the biological material, and / or the nucleic acid molecule are also within the scope of protection of this invention.

[0073] In this article, the plant may be G1, G2, or G3:

[0074] G1) Monocotyledonous or dicotyledonous plants;

[0075] G2) Leguminosae or Brassicaceae plants;

[0076] G3) Soybean or Arabidopsis thaliana.

[0077] In this article, the plant may be a crop (such as an agricultural crop).

[0078] The present invention also provides the application of the method for cultivating drought-resistant plants in the creation of drought-resistant plants and / or plant breeding.

[0079] The plant breeding mentioned can be for drought-resistant transgenic breeding of crops (such as soybeans).

[0080] The regulation of plant drought resistance described in this article can be used to either increase or decrease plant drought resistance.

[0081] The expression level and / or activity of the GmPLATZ17 protein or its encoding gene are reduced in the target plant, thereby increasing the plant's drought resistance.

[0082] In this document, the term "drought-resistant plants" is understood to include not only the first-generation transgenic plants obtained by knocking out the GmPLATZ17 gene, but also their progeny. The term "drought-resistant plants" includes seeds, callus tissue, intact plants, and cells.

[0083] The method for cultivating a transgenic plant with improved drought resistance (drought-resistant plant) claimed in this invention may include the following steps: inhibiting the expression of nucleic acid molecules in a recipient plant (target plant) that can express or regulate the GmPLATZ17 protein to obtain a transgenic plant; the transgenic plant has improved drought resistance compared with the recipient plant.

[0084] The RNA interference (RNAi) technology described in this article refers to the phenomenon of specifically inhibiting the post-transcriptional expression of target genes through double-stranded RNA formed by antisense RNA and sense RNA. By artificially introducing double-stranded RNA (dsRNA) with homologous sequences to endogenous target genes, the degradation of mRNA of endogenous target genes is induced, thereby achieving the purpose of preventing gene expression.

[0085] This invention introduces the GmPLATZ17 gene, derived from soybean (Glycine max (Linn.) Merr.), which regulates plant drought resistance, into the recipient plant, wild-type Arabidopsis thaliana (WT, Col), resulting in two homozygous transgenic Arabidopsis lines, GmPLATZ17-1 and GmPLATZ17-2. Experiments showed that, compared to the untransgenic recipient control wild-type Arabidopsis thaliana (WT, Col), the survival rate of the GmPLATZ17-overexpressing Arabidopsis thaliana lines under drought conditions was significantly lower than that of wild-type Arabidopsis thaliana (WT, Col), indicating that overexpression of the GmPLATZ17 gene can significantly reduce plant drought resistance.

[0086] This invention simultaneously constructed plants overexpressing the GmPLATZ17 gene (GmPLATZ17-OE) and plants knocking out the GmPLATZ17 gene (GmPLATZ17-RNAi) using soybean Williams 82 as the recipient, and also constructed the gene-edited plant gmplatz17. Under drought conditions, the GmPLATZ17-RNAi plant exhibited excellent drought resistance. Comprehensive growth and physiological indicators showed that the GmPLATZ17-RNAi plant with the GmPLATZ17 gene knockout had stronger drought resistance. The growth and survival rate of the gene-edited plant gmplatz17 were also significantly better than the control plant (recipient control Williams82). In conclusion, the GmPLATZ17 gene can regulate plant drought resistance, and reducing the expression level and / or activity of the GmPLATZ17 gene (such as gene knockout or gene editing) can significantly improve plant drought resistance.

[0087] This invention has uncovered a new gene that can regulate plant drought resistance under drought stress, which is of great significance and application value for breeding new drought-resistant plant varieties and improving plant drought resistance. Attached Figure Description

[0088] Figure 1 Analysis of drought resistance in Arabidopsis thaliana transgenic with the GmPLATZ17 gene. Figure 1 In section A, the phenotypes of transgenic Arabidopsis thaliana and WT after drought treatment are shown. Figure 1 In Figure B, the survival rates of transgenic and WT Arabidopsis thaliana before and after drought treatment are shown. Figure 1 C represents the proline content in transgenic and WT Arabidopsis thaliana before and after drought treatment. Figure 1 D represents the malondialdehyde (MDA) content in transgenic and WT Arabidopsis thaliana before and after drought treatment.

[0089] Figure 2 To detect the relative expression level of the GmPLATZ17 gene in soybean hairy-rooted transgenic plants.

[0090] Figure 3 To identify the drought resistance of soybean hairy roots transgenic with the GmPLATZ17 gene. Figure 3 In Figure A, the phenotype of transgenic soybean hairy roots after drought treatment and rehydration is shown. Figure 3 Figure B represents the survival rate of hairy roots of transgenic soybean before and after drought treatment. Figure 3 C represents the diaminobenzidine (DAB) staining of transgenic soybean leaves before and after drought treatment. Figure 3 In image D, nitroblue tetrazolium (NBT) staining is used on transgenic soybean leaves before and after drought treatment. Figure 3 E represents the superoxide anion (O2) content in the hairy roots of transgenic soybeans before and after drought treatment. -)content, Figure 3 F represents the superoxide dismutase (SOD) content in the hairy roots of transgenic soybeans before and after drought treatment.

[0091] Figure 4 The drought resistance of soybean gmplatz17 plants was identified. Figure 4 In Figure A, the phenotypes of soybean plants edited with gmplatz17 and the control group after drought treatment are shown. Figure 4 In the middle B section, the survival rate of soybean plants edited and controlled by gmplatz17 before and after drought treatment is compared. Detailed Implementation

[0092] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0093] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0094] The soybean varieties “Williams 82” and “Zhonghuang 39” in the following examples are described in the following literature: Jiang Jinghan. Study on salt tolerance mechanism and salt tolerance gene localization in soybean seedling stage [D]. Chinese Academy of Agricultural Sciences, 2013., which can be obtained by the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0095] The wild-type Arabidopsis thaliana (WT, Col) used in the following examples is the Colombian ecotype Arabidopsis thaliana (Col-0), purchased from SALK.

[0096] The Agrobacterium tumefaciens GV3101 and Agrobacterium rhizogenes K599 used in the following examples were purchased from Beijing Bairddi Biotechnology Co., Ltd.

[0097] The following examples use GraphPad Prism statistical software to process the data. The experimental results are expressed as mean ± standard deviation. Two-way ANOVA test was used. P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference.

[0098] Example 1: Effects of transcription factor GmPLATZ17 on drought resistance in Arabidopsis thaliana

[0099] The inventors of this application isolated and cloned a plant drought resistance-related protein gene from the soybean variety "Zhonghuang 39" and named it the GmPLATZ17 gene. The coding sequence (CDS) of the GmPLATZ17 gene is SEQ ID No.2, and the protein GmPLATZ17 with the amino acid sequence of SEQ ID No.1 is encoded.

[0100] I. Construction of Recombinant Expression Vectors

[0101] 1. Total RNA was extracted from the leaves of Zhonghuang 39 seedlings and cDNA was obtained by reverse transcription.

[0102] 2. Using the cDNA from step 1 above as a template, the soybean GmPLATZ17 gene was amplified using specific primers, and the PCR product was recovered. The gene shown in SEQ ID No. 2 of the sequence listing is the GmPLATZ17 gene, and its open reading frame (also the coding sequence, CDS) is shown in SEQ ID No. 2 of the sequence listing. The protein encoded by SEQ ID No. 2 of the sequence listing is named GmPLATZ17 protein, and its amino acid sequence is shown in SEQ ID No. 1 of the sequence listing.

[0103] The specific amplification primers for the GmPLATZ17 gene are as follows:

[0104] GmPLATZ17-F: 5'-ACTCACCCATTGAGGCACAT-3',

[0105] GmPLATZ17-R: 5'-TGGGACCCAAACCCCAAAAG-3'.

[0106] 3. The amplified and recovered PCR products were ligated into the Peasyblunt vector (pEASY-Blunt Cloning Kit, catalog number CB101, TransGen, Beijing). The ligation product was transformed into *E. coli* competent cells TOP10 and plated on solid LB agar plates containing 50 μg / L kanamycin, and incubated overnight at 37°C. Colony PCR screening of *E. coli* clones was performed. Positive clones were sent to the company for sequencing. Single clones with correct sequencing were selected, preserved, and plasmids were extracted. The plasmid with the correct sequence was named Peasyblunt-GmPLATZ17.

[0107] The Peasyblunt-GmPLATZ17 plasmid is obtained by blunt-end cloning, where the DNA fragment whose nucleotide sequence is SEQ ID No. 2 in the sequence listing is ligated into the Peasyblunt vector while keeping the other sequences of the Peasyblunt vector unchanged.

[0108] 4. Using the plasmid Peasyblunt-GmPLATZ17 obtained in step 3 as a template, PCR amplification was performed using the primer pair composed of GmPLATZ17-1302F and GmPLATZ17-1302R (underlined are homologous arms) to obtain the PCR amplification product, and the PCR product was recovered by gel extraction.

[0109] GmPLATZ17-1302F:5'- GGACTCTTGACCATGG ACATGGGCACAATGTTGGTGCC-3',

[0110] GmPLATZ17-1302R: 5'- GTCAGATCTACCCATGG GGAGCCAAAAGGTGCCCTAT-3'.

[0111] 5. Digest the vector pCAMBIA1302 with the restriction endonuclease Ncol I and recover the vector backbone.

[0112] 6. The PCR product from step 4 and the vector backbone from step 5 were ligated using In-Fusion enzyme to obtain recombinant plasmid 1302-GmPLATZ17. Based on the sequencing results, the structure of recombinant plasmid 1302-GmPLATZ17 is described as follows: A DNA molecule as shown in SEQ ID No. 2 of the sequence listing was inserted into the Ncol I restriction site of the vector pCAMBIA1302.

[0113] II. Obtaining Transgenic Arabidopsis

[0114] 1. The recombinant plasmid 1302-GmPLATZ17 was introduced into Agrobacterium GV3101 to obtain recombinant Agrobacterium GV3101 / 1302-GmPLATZ17.

[0115] 2. Transfer the recombinant Agrobacterium culture to liquid YEP medium containing 50 μg / L rifampin and 50 μg / L kanamycin, and incubate at 28°C with shaking at 220 rpm until OD. 600nm =1.5-3.0.

[0116] 3. After completing step 2, collect the bacterial cells, centrifuge at 4℃ and 4000g for 10 minutes, and dilute with an aqueous solution containing 10% sucrose and 0.02% silwet to an OD value of [missing value]. 600nm Approximately 1.0, which is the amount of the inoculum.

[0117] 4. Place the Colombian ecotype Arabidopsis thaliana (Col-0) planted in flowerpots upside down in a container filled with the infection solution, immersing the inflorescence in the infection solution for 50 seconds. Then remove the flowerpots, place them on their sides in a tray, cover them with black plastic sheeting, and after 24 hours remove the plastic sheeting. Place the flowerpots upright and cultivate them under normal light conditions. Harvest the seeds, which are the seeds of the T0 generation Arabidopsis thaliana.

[0118] 5. Sow the seeds of T0 generation Arabidopsis thaliana on solid MS medium plates containing 40 mg / L hygromycin. The resulting plants are T1 generation Arabidopsis thaliana.

[0119] 6. Self-pollinate and harvest the seeds of T1 generation Arabidopsis thaliana; these are the seeds of T1 generation Arabidopsis thaliana. Plants cultured from the seeds of T1 generation Arabidopsis thaliana are the T2 generation Arabidopsis thaliana. Self-pollinate and harvest the seeds of T2 generation Arabidopsis thaliana; these are the seeds of T2 generation Arabidopsis thaliana. Plants cultured from the seeds of T2 generation Arabidopsis thaliana are the T3 generation Arabidopsis thaliana.

[0120] 7. PCR identification was performed on T2 generation Arabidopsis thaliana and sampled T3 generation Arabidopsis thaliana. If both a T2 generation Arabidopsis thaliana and its self-pollinated T3 generation Arabidopsis thaliana were positive for PCR, then the T2 generation Arabidopsis thaliana and its self-pollinated offspring constituted a homozygous transgenic Arabidopsis thaliana line carrying the GmPLATZ17 gene. The PCR primers were 5'-ATTTCATTTGGAGAGAACAC-3' and 5'-GAATTTCCGCCACCCTCACT-3'. A positive PCR result was achieved by using the genomic DNA of the Arabidopsis thaliana plant to be identified as a template and performing PCR amplification with these primers, yielding a 270bp PCR product. Two homozygous transgenic Arabidopsis thaliana lines carrying the GmPLATZ17 gene were identified and named GmPLATZ17-1 and GmPLATZ17-2.

[0121] III. Identification of drought tolerance in Arabidopsis thaliana

[0122] The seeds tested were: seeds of the T3 generation of the GmPLATZ17-1 line, seeds of the T3 generation of the GmPLATZ17-2 line, and seeds of wild-type Arabidopsis thaliana Col-0. Among them, the GmPLATZ17-1 and GmPLATZ17-2 lines were both homozygous transgenic Arabidopsis thaliana lines carrying the GmPLATZ17 gene.

[0123] Drought group: The seeds to be tested were sown, and the number of days from the start of seed germination was counted. After 20 days, drought treatment was started (no more watering), and photos were taken and the survival rate was counted.

[0124] Control group: The seeds to be tested were sown, and the number of days from the start of seed germination was counted. After 20 days, watering was continued normally, and then a photo was taken.

[0125] Three replicate experiments were set up, and in each replicate experiment, six plants of each type of seed were observed and statistically analyzed.

[0126] See results Figure 1 . Figure 1 In the text, WT represents wild-type Arabidopsis thaliana Col-0; OE-1 represents Arabidopsis thaliana of the GmPLATZ17-1 strain; and OE-2 represents Arabidopsis thaliana of the GmPLATZ17-2 strain.

[0127] Under normal conditions, the growth of Arabidopsis thaliana lines GmPLATZ17-1 and GmPLATZ17-2 was no different from that of wild-type Arabidopsis thaliana. After drought treatment, the growth of wild-type Arabidopsis thaliana was significantly better than that of lines GmPLATZ17-1 and GmPLATZ17-2, while the survival rate of lines GmPLATZ17-1 and GmPLATZ17-2 was significantly lower than that of wild-type Arabidopsis thaliana. This indicates that overexpression of the GmPLATZ17 gene can significantly reduce the drought resistance of plants.

[0128] Example 2: Effects of transcription factor GmPLATZ17 on drought resistance of soybean hairy-rooted plants

[0129] I. Construction of Recombinant Expression Vectors

[0130] 1. Using the plasmid (Peasyblunt-GmPLATZ17) obtained in Example 1 as a template, PCR amplification was performed using primer pairs composed of GmPLATZ17-3301F and GmPLATZ17-3301R to obtain PCR amplification products, and the PCR products were then recovered from the gel.

[0131] GmPLATZ17-3301F: 5'-GGACTCTTGACCATGATGGGCACAATGTTGGTGCC-3',

[0132] GmPLATZ17-3301R: 5'-ATTCGAGCTGGTCACCGGAGCCAAAAGGTGCCCTA-3'.

[0133] 2. Using a 146bp zeatol dehydrogenase intron fragment (positions 230-375 of SEQ ID No. 3), a 229bp GmPLATZ17 gene fragment (positions 1-229 of SEQ ID No. 3), and its reverse complementary sequence (positions 376-604 of SEQ ID No. 3), a GmPLATZ17-RNAi fragment was formed. For its specific sequence information, please refer to SEQ ID No. 3 in the sequence listing. This sequence was artificially synthesized at the company, and Nco I and BstE II restriction sites were added to both ends of the sequence.

[0134] 3. Digest the vector pCAMBIA3301 with restriction endonucleases Nco I and BstE II, and recover the vector backbone.

[0135] 4. Ligate the PCR product from step 1 and the fragment synthesized in step 2 to the vector backbone from step 3, respectively, to obtain recombinant plasmids 3301-GmPLATZ17 and 3301-GmPLATZ17-RNAi. After confirming correct sequencing by the company, extract the plasmid from the positive bacterial culture for later use.

[0136] The recombinant plasmid 3301-GmPLATZ17 (i.e., the recombinant vector 3301-GmPLATZ17) is obtained by replacing the fragment (small fragment) between the Nco I and BstE II recognition sites of the pCAMBIA3301 vector with the DNA fragment whose nucleotide sequence is SEQ ID No. 2 in the sequence listing, while keeping the other sequences of the pCAMBIA3301 vector unchanged.

[0137] The recombinant plasmid 3301-GmPLATZ17-RNAi (i.e., the recombinant vector 3301-GmPLATZ17-RNAi) is obtained by replacing the fragment (small fragment) between the Nco I and BstE II recognition sites of the pCAMBIA3301 vector with the DNA fragment whose nucleotide sequence is SEQ ID No. 3 in the sequence listing, while keeping the other sequences of the pCAMBIA3301 vector unchanged, resulting in a recombinant expression vector, i.e., an RNA interference vector.

[0138] The constructed RNA interference vector contains a DNA molecule with the nucleotide sequence SEQ ID No. 3, which can reduce or inactivate the gene encoding the GmPLATZ17 protein in the soybean genome through RNA interference technology.

[0139] The first 229 positions (positions 1-229) and the last 229 positions (positions 376-604) of SEQ ID No. 3 are inverse complementary sequences linked by an intron sequence. After transcription in the cell, they form a hairpin double-stranded RNA (dsRNA). The dsRNA is degraded by the Dicer enzyme into short siRNA (small interfering RNA). The siRNA is unstranded into single strands, and the antisense strand of siRNA binds to RISC (RNA-induced silencing complex) and guides RISC to an endogenous mRNA molecule with a homologous sequence, degrading the target mRNA and thus inhibiting the expression of the target gene GmPLATZ17.

[0140] II. Obtaining transgenic soybean hairy-rooted plants

[0141] 1. Recombinant plasmids 3301-GmPLATZ17 and 3301-GmPLATZ17-RNAi were transformed into Agrobacterium rhizogenes K599, respectively, to obtain Agrobacterium K599 / 3301-GmPLATZ17 and K599 / 3301-GmPLATZ17-RNAi containing recombinant plasmids.

[0142] 2. Select soybean seeds of Williams 82 that are growing in a uniform and plump shape, and sow them evenly in the nutrient soil, 12 seeds per pot. Place them in a greenhouse at 25℃ with a photoperiod of 14h light / 10h darkness and a relative humidity of 60% for 5-7 days until the two cotyledons have fully emerged.

[0143] 3. The Agrobacterium (K599 / 3301-GmPLATZ17 and K599 / 3301-GmPLATZ17-RNAi) obtained in step 1 were streaked on YEP solid medium containing kanamycin and streptomycin, respectively, and incubated upside down in an incubator at 28°C for 3 days.

[0144] 4. Carefully pick up Agrobacterium colonies of the recombinant plasmid with a syringe and inject them into the cotyledon node of soybean Williams 82. After injection, cover with a transparent plastic cup to maintain high humidity, which is conducive to the growth of hairy roots. Continue to grow in the dark in the greenhouse for one day, and then grow normally for one week with 14 hours of light / 10 hours of darkness.

[0145] 5. Cover the cotyledon nodes with nutrient soil and let them continue to grow for about two weeks until hairy roots appear.

[0146] 6. Cut off the taproot of the soybean seedling and bury the newly grown hairy roots at the cotyledon nodes in the soil to continue growing, thus obtaining soybean hairy root plants transgenic with the GmPLATZ17 gene, i.e., plants overexpressing the GmPLATZ17 gene (GmPLATZ17-OE) and soybean hairy root plants transgenic with GmPLATZ17-RNAi, i.e., plants with downexpressed GmPLATZ17 gene (GmPLATZ17 gene knockout) (GmPLATZ17-RNAi).

[0147] III. Obtaining Soybeans with Air Transfer Carriers

[0148] Replace the recombinant plasmid 3301-GmPLATZ17 with the pCAMBIA3301 vector and proceed with step two to obtain soybean plants with empty vectors (EV-control).

[0149] IV. Detection of the relative expression level of the GmPLATZ17 gene

[0150] After completing step two or three, soybean leaves were taken, total RNA was extracted and reverse transcribed to obtain cDNA, and qRT-PCR was performed using cDNA as a template. The Actin gene was used as an internal reference gene to detect the relative expression level of the GmPLATZ17 gene.

[0151] The primers used to detect the GmPLATZ17 gene are as follows:

[0152] RT-GmPLATZ17-F: 5'-AGGCATCAACAATGGAGGGT-3',

[0153] RT-GmPLATZ17-R: 5'-CTTGCGTTTGAAGCAGGTGG-3'.

[0154] The primers used to detect the Actin gene are as follows:

[0155] Actin-F: 5'-ACATTGTTCTTAGTGGTGGCT-3',

[0156] Actin-R: 5'-CTGTTGGAAGGTGCTGAG-3'.

[0157] See results Figure 2 .

[0158] The expression level of the GmPLATZ17 gene in soybean transgenic with the GmPLATZ17 gene (GmPLATZ17-OE) was 1.5 times that in soybean transgenic with the empty vector (EV-control), while the expression level of the GmPLATZ17 gene in soybean transgenic with GmPLATZ17-RNAi (GmPLATZ17-RNAi) was significantly reduced.

[0159] V. Obtaining edited genetically modified soybean plants

[0160] The activity of the gene encoding the protein GmPLATZ17 in the genome of a target plant can be reduced or inactivated using gene editing technology. This can be done using the CRISPR / Cas9 system, which includes a vector that expresses the sgRNA encoding the target protein GmPLATZ17. The target sequence of the sgRNA is designed to be positions 68-90 of SEQ ID No. 2.

[0161] The steps for constructing a gene-editing vector are as follows:

[0162] 1. Based on the target sequence of sgRNA, design the following oligo primers and synthesize them.

[0163] gRNA-F: 5'-TTGGGATTCACGGAGATGCCGCG-3',

[0164] gRNA-R: 5'-CGCGGCATCTCCGTGAATCCCAA-3'.

[0165] 2. Dilute the synthesized oligo primers to 10 μM, mix them at a ratio of 5 μL gRNA-F, 5 μL gRNA-R and 15 μL H2O, incubate at 95 °C for 3 minutes, and then allow to cool naturally to room temperature to form oligo dimers.

[0166] 3. Mix the oligo dimer obtained in step 2 with Cas9 / gRNA Vector, Solution, and Solution2 from the plant Cas9 / gRNA plasmid construction kit (Beijing Weishang Lide Biotechnology Co., Ltd.) in a ratio of 1:1:1: and react at 16°C for 2 hours.

[0167] 4. Add 10 μL of the product from step 3 to freshly thawed TOP10 competent cells for transformation. After confirming correct sequencing by the company, extract the positive bacterial culture plasmid for later use. The constructed gene-editing vector was named Cas9-GmPLATZ17.

[0168] The recombinant plasmid Cas9-GmPLATZ17 was introduced into Agrobacterium GV3101 to obtain Agrobacterium GV3101 / Cas9-GmPLATZ17 containing the recombinant plasmid. The specific steps are as follows:

[0169] 1. Inoculate Agrobacterium GV3101 / Cas9-GmPLATZ17 containing the recombinant plasmid into YEP liquid medium and incubate at 28°C and 3000 rpm for about 18 hours.

[0170] 2. Streak the bacterial culture obtained in step 1 onto YEP solid medium (containing 50 μg / L streptomycin and 50 μg / L kanamycin) and incubate at 28°C for about 2 days.

[0171] 3. Sterilize soybean seeds (Williams 82) with chlorine for 8 hours, then sow them evenly in sterilized B5 medium and culture until the radicle forms.

[0172] 4. After completing step 2, remove the soybean cotyledons and the radicle below the cotyledon node, and then culture the soybean callus until it grows. Infect the callus with Agrobacterium GV3101 (GV3101 / Cas9-GmPLATZ17) containing the recombinant vector. After culturing, obtain gmplatz17 edited soybean.

[0173] 5. Perform PCR identification on T1 generation soybeans and sampled T2 generation soybeans. If a certain T1 generation and its resulting T2 generation soybeans are all identified as mutants by PCR, then the T1 generation soybeans and their offspring are homozygous GmPLATZ17 gene-edited soybean plants, and the resulting edited plants are named gmplatz17.

[0174] VI. Identification of drought resistance in soybean hairy-rooted plants

[0175] The plants to be tested were: GmPLATZ17 overexpressing plants (GmPLATZ17-OE), GmPLATZ17 interference plants (GmPLATZ17-RNAi) obtained in step 2, and soybean plants with empty vectors obtained in step 3 (EV-control).

[0176] Water control was applied to the well-growing plants, and phenotypes were observed. When significant growth differences appeared between the different lines, rehydration was performed. Survival rates were recorded 6 days after rehydration, and photos were taken before and during treatment. Three replicate experiments were conducted, with 5 plants of each test line observed and statistically analyzed in each replicate. Survival rates, leaf staining, and superoxide anion radical (O2) levels were also measured after treatment. - The content of ) and the activity of superoxide dismutase (SOD) are among the various growth and physiological indicators.

[0177] See results Figure 3 .

[0178] Under normal conditions, there was no difference in growth among GmPLATZ17-OE, GmPLATZ17-RNAi, and EV-control plants. After drought treatment, GmPLATZ17-OE plants showed the most severe growth inhibition, followed by the empty vector control. GmPLATZ17-RNAi plants exhibited drought resistance. Figure 3 (A)

[0179] Statistical analysis of plant survival rates after drought treatment showed that the survival rate of GmPLATZ17-RNAi plants with GmPLATZ17 gene knockout was significantly higher than that of GmPLATZ17-OE plants with GmPLATZ17 gene overexpression and empty vector control EV-control plants. Figure 3 (B)

[0180] Figure 3 C and D represent DAB and NBT staining to detect the levels of reactive oxygen species (ROS). DAB staining represents the level of H2O2 accumulation, and NBT staining represents the level of O2 accumulation. - Accumulation levels. Under normal growth conditions, all plant leaves showed very low levels of H2O2 and O2. -After drought treatment, increased ROS accumulation was observed in the leaves of all plants, with the lowest ROS accumulation level observed in GmPLATZ17-RNAi plants.

[0181] Superoxide anion radicals (O2) in GmPLATZ17-RNAi plants - The content of ) was significantly lower than that of GmPLATZ17-OE plants and empty vector control EV-control plants. Figure 3 In GmPLATZ17-RNAi plants, the SOD enzyme activity was significantly higher than that in GmPLATZ17-OE plants and the empty vector control EV-control plants. Figure 3 (China F).

[0182] The results of various growth and physiological tests indicate that GmPLATZ17-RNAi plants with the GmPLATZ17 gene knocked out have stronger drought resistance.

[0183] VII. Identification of drought resistance in soybean plants

[0184] The plants to be tested were: gmplatz17 edited and receptor Williams 82 soybean plants (CK) obtained in step 5.

[0185] Water control treatment was applied to the test plants. The specific method was as follows: equal amounts of soil were weighed, and the same number of soybean seeds were sown for both the edited and recipient control plants. Water control was applied after the seedlings reached the four-leaf stage. Irrigation was stopped for 1-2 weeks, and phenotypes were observed. Survival rates were calculated when significant differences were observed. Three replicate experiments were conducted, with five plants of each test line observed and statistically analyzed in each replicate.

[0186] See results Figure 4 .

[0187] After drought treatment, the control plants (CK) showed severe wilting, while the soybean plants edited with gmplatz17 grew better than the control (CK), and the survival rate of the soybean plants edited with gmplatz17 was significantly higher than that of the control (CK).

[0188] In summary, the GmPLATZ17 gene can regulate plant drought resistance, and reducing the expression level and / or activity of the GmPLATZ17 gene (such as gene knockout or gene editing) can improve plant drought resistance.

[0189] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. SEQUENCE LISTING <110> Institute of Crop Science, Chinese Academy of Agricultural Sciences <120> Proteins that negatively regulate plant drought resistance and their encoding genes and applications <160> 3 <170> PatentIn version 3.5 <210> 1 <211> 208 <212> PRT <213> Soybeans (Glycine max) <400> 1 Met Gly Thr Met Leu Val Pro Pro Trp Leu Glu Pro Leu Leu Asn Thr 1 5 10 15 Ser Phe Phe Asn Val Cys Arg Ile His Gly Asp Ala Ala Arg Ser Glu 20 25 30 Cys Asn Met Phe Cys Leu Asp Cys Asn Glu Asn Ala Phe Cys Phe Tyr 35 40 45 Cys Arg Ser Ser Lys His Lys Asp His Gln Val Ile Gln Ile Arg Arg 50 55 60 Ser Ser Tyr His Asp Val Val Arg Val Ala Glu Ile Gln Lys Val Leu 65 70 75 80 Asp Ile Ser Gly Val Gln Thr Tyr Val Ile Asn Ser Ala Arg Val Leu 85 90 95 Phe Leu Asn Glu Arg Pro Gln Pro Lys Ser Gly Lys Gly Val Ala His 100 105 110 Ile Cys Glu Ile Cys Gly Arg Ser Leu Leu Asp Pro Phe Arg Phe Cys 115 120 125 Ser Leu Gly Cys Lys Leu Val Gly Ile Lys Arg Asn Gly Asp Ala Ser 130 135 140 Phe Thr Leu Asp Ala Lys Asn Glu Ala Ser Thr Met Glu Gly Met Ser 145 150 155 160 Arg Arg Ser Val Ser Ser Arg His His Gln Glu Glu Glu Leu Arg Glu 165 170 175 Gly Ser Gln Gln Asp Met Tyr Pro Ala Thr Pro Ser Pro Pro Ala Ser 180 185 190 Asn Ala Arg Arg Arg Lys Gly Ile Pro His Arg Ala Pro Phe Gly Ser 195 200 205 <210> 2 <211> 627 <212> DNA <213> Glycine max <400> 2 atgggcacaa tgttggtgcc accatggctt gagccactcc taaacacatc cttcttcaat 60 gtgtgtcgga ttcacggaga tgccgcgagg agcgaatgta acatgttttg tctcgactgc 120 aatgagaatg cgtttgctt ctattgccgt tcctcaaaac acaaggatca ccaagtcatt 180 cagatacgga gatcttcgta tcacgatgta gtgagggtgg cggaaattca gaaagtgttg 240 gacattagtg gagttcaaac atatgtgatc aacagtgcca gagttttgtt tctgaatgag 300 aggcctcaac caaagtctgg aaaaggagta gctcacattt gtgagatttg tggaagaagc 360 ctcttggacc catttcgctt ctgttctttg gggtgtaagc ttgtaggaat aaagagaaat 420 ggggatgcaa gttttacttt ggatgctaaa aatgaggcat caacaatgga gggtatgtca 480 aggagatcgg tttcttcaag acatcatcaa gaagaagaat tgcgtgaagg ctcacaacaa 540 gacatgtacc cggccacacc ttctccacct gcttcaaacg caaggagaag aaaagggatt 600 cctcataggg caccttttgg ctcctaa 627 <210> 3 <211> 604 <212> DNA <213> Artificial sequence <400> 3 cttgagccac tcctaaacac atccttcttc aatgtgtgtc ggattcacgg agatgccgcg 60 aggagcgaat gtaacatgtt ttgtctcgac tgcaatgaga atgcgttttg cttctattgc 120 cgttcctcaa aacacaagga tcaccaagtc attcagatac ggagatcttc gtatcacgat 180 gtagtgaggg tggcggaaat tcagaaagtg ttggacatta gtggagttcg atccgatcga 240 aaaacgggag tctgccccta agacagataa gccgccaaga aggcgcaagt caaccgcgag 300 ttgttgtatc atatctactg acaaagatca caaatgggat ggctgattag ataccttggc 360 ctcccagatc gattcgaact ccactaatgt ccaacacttt ctgaatttcc gccaccctca 420 ctacatcgtg atacgaagat ctccgtatct gaatgacttg gtgatccttg tgttttgagg 480 aacggcaata gaagcaaaac gcattctcat tgcagtcgag acaaaacatg ttacattcgc 540 tcctcgcggc atctccgtga atccgacaca cattgaagaa ggatgtgttt aggagtggct 600 caag 604

Claims

1. The application of proteins, characterized in that, The application is any one of the following: D1) Application in improving plant drought resistance; D2) Application in the preparation of products that improve plant drought resistance; Application of D3 in the cultivation of drought-resistant plants; D4) Application in the preparation of products that cultivate drought-resistant plants; The amino acid sequence of the protein is shown in SEQ ID No. 1; The application is achieved by reducing the expression level of the gene encoding the protein in a plant, such as soybean or Arabidopsis thaliana.

2. The application of biomaterials related to the protein described in claim 1, characterized in that, The application is any one of the following: E1) Application in improving plant drought resistance; E2) Application in the preparation of products that improve plant drought resistance; E3) Application in cultivating drought-resistant plants; E4) Application in the preparation of products that cultivate drought-resistant plants; The application is achieved by reducing the expression level of the gene encoding the protein of claim 1 in a plant; the plant is soybean or Arabidopsis thaliana; The biomaterial is any one of B1) to B8) below: B1) A nucleic acid molecule encoding the protein described in claim 1; B2) Nucleic acid molecules that inhibit, reduce, or silence the expression of the gene encoding the protein described in claim 1; B3) An expression cassette containing the nucleic acid molecules described in B1) and / or B2); B4) A recombinant vector containing the nucleic acid molecules described in B1) and / or B2), or a recombinant vector containing the expression cassette described in B3); B5) Recombinant microorganisms containing the nucleic acid molecules described in B1) and / or B2), or recombinant microorganisms containing the expression cassette described in B3), or recombinant microorganisms containing the recombinant vector described in B4); B6) A transgenic plant cell line containing the nucleic acid molecules described in B1) and / or B2), or a transgenic plant cell line containing the expression cassette described in B3); B7) Transgenic plant tissue containing the nucleic acid molecules described in B1) and / or B2), or transgenic plant tissue containing the expression cassette described in B3); B8) A transgenic plant organ containing the nucleic acid molecules described in B1) and / or B2), or a transgenic plant organ containing the expression cassette described in B3).

3. The application according to claim 2, characterized in that, B1) The nucleic acid molecule is a DNA molecule whose coding sequence (CDS) is SEQ ID No. 2; B2) The nucleic acid molecule is a DNA molecule whose nucleotide sequence is SEQ ID No.

3.

4. A method for cultivating drought-resistant plants, characterized in that, The method includes reducing the content of the protein described in claim 1 in the target plant to obtain a drought-resistant plant with higher drought resistance than the target plant; the plant is soybean or Arabidopsis thaliana.

5. The method according to claim 4, characterized in that, The reduction of the protein content in the target plant as described in claim 1 is achieved by reducing the expression level of the gene encoding the protein in the target plant.

6. The method according to claim 5, characterized in that, The reduction of the expression level of the gene encoding the protein in the target plant is performed using a CRISPR / Cas9 system, which includes a vector expressing sgRNA targeting the gene encoding the protein, wherein the target sequence of the sgRNA is positions 68-90 of SEQ ID No.

2.

7. The method according to claim 5, characterized in that, The reduction of the expression level of the gene encoding the protein in the target plant is achieved using an RNA interference vector containing a DNA molecule with the nucleotide sequence SEQ ID No. 3.

Images