Chimeric antigen receptors targeting cd52 and uses thereof

Abstract

The application discloses a chimeric antigen receptor targeting CD52 and application thereof, and constructs T cells expressing the chimeric antigen receptor targeting CD52. + The application can be used for treating T cell blood tumors and combined treatment with other CAR-T cells.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to chimeric antigen receptors targeting CD52 and their applications. Background Technology

[0002] Although traditional chemotherapy, hematopoietic stem cell transplantation, and targeted drugs can treat leukemia, relapsed and refractory leukemia remains incurable. Compared to B-cell malignancies, T-cell malignancies face challenges in treatment, including lower response rates, shorter remission periods, and poorer prognoses. Monoclonal antibody-based therapies hold promise for overcoming chemotherapy resistance and treatment-related toxicities. Among these, CAR-T cell therapy is the most promising, as it can overcome MHC restrictions and directly recognize tumor antigens.

[0003] Chimeric antigen receptor (CAR) modified T cells, as an immunotherapy strategy, can specifically kill tumor cells expressing specific tumor-associated antigens, and have received widespread attention and application in cancer treatment. The structure of a CAR generally consists of an extracellular antigen-binding region, a transmembrane region, and an intracellular signal transduction region. The extracellular antigen-binding region is composed of a light chain variable region (VL) and a heavy chain variable region (VH) derived from a monoclonal antibody, linked by a hinge region to form a single-chain antibody (scFv). Currently, based on the number of co-stimulatory molecules added to the intracellular signal transduction region, CARs are classified into first-generation (no co-stimulatory molecule), second-generation (containing one co-stimulatory molecule), and third-generation (containing two co-stimulatory molecules). Currently, second-generation CAR-T cell therapy is more widely used in the clinical treatment of hematological malignancies.

[0004] CAR-T cells have been widely used in hematological malignancies. The emergence of CAR-T cell therapy has changed the treatment paradigm for relapsed / refractory acute B-lymphoblastic leukemia, especially CAR-T cell immunotherapy targeting CD19, which has achieved breakthrough progress, increasing the complete remission rate of adult acute lymphoblastic leukemia from 29% with conventional treatment to over 80%. Therefore, exploring and validating a suitable CAR-T therapeutic target for T-cell malignancies, enhancing the anti-tumor targeting potential of CAR-T cells, further improving the efficacy of T-cell tumor treatment, and making CAR-T cell therapy a novel treatment for T-cell tumors could also serve as a bridge between chemotherapy and bone marrow transplantation.

[0005] CD52 is a widely distributed antigen, with the highest expression in T lymphocytes and B lymphocytes, but not in hematopoietic stem and progenitor cells. CD52 is expressed in many hematological malignancies, such as chronic lymphocytic leukemia (CLL), non-Hodgkin's lymphoma, acute T-lymphocytic leukemia (T-ALL), and FLT3-ITD-mutant acute myeloid leukemia cells. Alemtuzumab is a CD52 monoclonal antibody that has shown some efficacy in the treatment of many leukemias, particularly CLL. The above findings suggest that CD52 is suitable as a treatment modality for CD52. + The goal is to find a target for hematologic malignancies that does not significantly affect the function of normal stem and progenitor cells. For these reasons, finding a chimeric antigen receptor that targets CD52 with better efficacy to replace monoclonal antibody therapy has become an urgent priority. Summary of the Invention

[0006] One aspect of the present invention addresses the poor efficacy, particularly the ineffectiveness or relapse, that occurs during conventional chemotherapy, hematopoietic stem cell transplantation, and targeted drug therapy in the prior art. It provides a CD52-specific chimeric antigen receptor (CAR) that specifically binds to a target antigen and exerts a cytotoxic effect against T-ALL, T-cell lymphoma, and CLL.

[0007] The technical solution provided by this invention is as follows:

[0008] A nucleic acid molecule encoding a chimeric antigen receptor targeting CD52, the chimeric antigen receptor comprising an extracellular region, a transmembrane region, and an intracellular signal transduction region, wherein the extracellular region encoded by the molecule includes a CD52-binding domain, the CD52-binding domain being an antigen-binding moiety against CD52, the antigen-binding moiety comprising the amino acid sequence of the light chain variable region CDR1, CDR2, or CDR3 as shown in SEQ ID No. 1-3, and the amino acid sequence of the heavy chain variable region CDR1, CDR2, or CDR3 as shown in SEQ ID No. 4-6.

[0009] In this invention, the antigen-binding portion can be, for example, Fab, Fab′, F(ab′)2, Fd, Fv, scFv, or a single-domain antibody (dAB), which can form an antigen-antibody complex with the target protein. Preferably, in one embodiment of this invention, the antigen-binding portion is scFv.

[0010] In some embodiments of the present invention, point mutations may be performed on the above-mentioned complementarity-determining regions (CDRs) for purposes such as obtaining better affinity and / or dissociation properties, obtaining better expression levels, etc., as long as they can form a complementary binding structure with the antigenic determinant. The mutated amino acid sequence is also considered to be included within the scope of protection of the present invention.

[0011] Preferably, in one embodiment of the present invention, the amino acid sequence of the light chain variable region encoded by the above-mentioned nucleic acid molecule is as shown in SEQ ID No. 7, or a sequence having more than 90% homology with it; the amino acid sequence of the heavy chain variable region encoded by it is as shown in SEQ ID No. 8, or a sequence having more than 90% homology with it.

[0012] In this invention, the above-mentioned homology of more than 90% refers to having more than 90% homology with the nucleotide or amino acid sequence described in this invention. It can be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology. The nucleotide or amino acid sequence described in this invention can be randomly or engineered to undergo point mutations in a suitable manner. The purpose can be, for example, to obtain better expression levels, affinity, and / or dissociation properties. All of these mutated nucleotide or amino acid sequences are included within the protection scope of this invention.

[0013] In some embodiments of the present invention, CD52 + Tumor cells can activate CAR-T cells and produce cytotoxic effects after binding to anti-CD52 scFv; while CD52 - Cells cannot activate CAR-T cells to produce a response. Therefore, CAR-T cells prepared with anti-CD52 scFv as the antigen recognition region cannot recognize and kill CD52. + Simultaneously with tumor cells, CD52 - The cells do not produce off-target effects.

[0014] In some embodiments of the present invention, the anti-CD52 scFv comprises a number of repeating VL and VH sequences, wherein the VL and VH sequences contain the aforementioned CDRs. The VL and VH sequences can be linked by a suitable linker, which is typically composed of glycine and serine, for example, GGGGS.

[0015] In some embodiments of the present invention, the anti-CD52 scFv is a monovalent antibody. In other embodiments of the present invention, the number of repeat sequences in the light chain variable region (VL) and heavy chain variable region (VH) can be 2 or 3. When the number of repeat sequences is 2, the anti-CD52 scFv forms a bivalent diabody; when the number of repeat sequences is 3, the anti-CD52 scFv forms a trivalent diabody. The light chain variable region (VL) and heavy chain variable region (VH) can be connected in any suitable order, for example, N-VL-VH-C, N-VH-VL-C.

[0016] Preferably, in one embodiment of the present invention, the amino acid sequence of the single-chain antibody encoded by the above-mentioned nucleic acid molecule is as shown in SEQ ID No. 9, or a sequence having more than 90% homology with it.

[0017] In some embodiments of the present invention, the above-described nucleic acid molecules may also encode a signal peptide. The signal peptide can guide the translocation of the antigen recognition region and hinge region to the extracellular space. Any suitable signal peptide or combination of signal peptides can achieve the objectives of the present invention.

[0018] Preferably, in some embodiments of the present invention, the extracellular region encoded by the above-mentioned nucleic acid molecule further comprises a signal peptide constructed at the N-terminus of the chimeric antigen receptor or an amino acid sequence having more than 90% homology with the signal peptide.

[0019] More preferably, in one embodiment of the present invention, the signal peptide is a signal peptide sequence in CD8α or GM-CSF.

[0020] More preferably, in one embodiment of the present invention, the signal peptide is the signal peptide shown in SEQ ID NO.10.

[0021] In some embodiments of the present invention, the CD52 binding domain encoded by the nucleic acid molecule of the present invention is connected to its encoded transmembrane region via a hinge region. Any suitable hinge region sequence can achieve the purpose of the present invention. Preferably, in one embodiment of the present invention, the hinge region is a hinge region sequence in CD8α.

[0022] In some embodiments of the present invention, the above-mentioned nucleic acid molecules also encode transmembrane domains. Any suitable transmembrane domain can achieve the purpose of the present invention. Preferably, in some embodiments of the present invention, the transmembrane region is a transmembrane domain selected from the following proteins or an amino acid sequence having more than 90% homology with the protein: α, β or ζ chains of T cell receptors, CD2, CD3ε, CD4, CD7, CD8α, CD8β, CD11a, CD11b, CD11c, CD11d, CD18, CD19, CD27, CD28, CD29, CD30, CD40, CD48, CD49a, CD49d, CD49f, CD66a, CD66b, CD66c, CD66d, CD66e, CD69, CD79A, CD79B, CD84, CD96, CD100, CD103, CD134, CD137, CD150, CD158A, CD158B1, CD158B2, CD158C, CD158D, CD158F1, CD158F2, CD158K, CD160, CD162, CD226, CD229, CD244, CD247, CD2 58. CD268, CD270, CD272, CD276, CD279, CD314, CD319, CD335, CD336, CD337, CD352, CD353, CD355, CD357, LFA-1, NKG2C, DAP-10, ICAM-1, NKp80, IL-2R beta, IL-2Rgamma, IL-7R alpha, LFA-1, SLAMF9, LAT, GADS, SLP-76, PAG1 / CBP, CD83 ligand, Fc gamma receptor, integrin, activating NK cell receptor or Toll ligand receptor, or combinations thereof.

[0023] More preferably, in one embodiment of the present invention, the transmembrane region is a transmembrane region sequence in CD8α.

[0024] In some embodiments of the present invention, the intracellular signal transduction region encoded by the above-mentioned nucleic acid molecule further includes a co-stimulatory factor;

[0025] Preferably, in some embodiments of the present invention, the co-stimulatory factor is one or more functional signaling domains obtained by means of proteins selected from or amino acid sequences having more than 90% homology with the following proteins: integrin, BTLA, Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1, 4-1BB, B7-H3, CD278, GITR, BAFFR, LIGHT, HVEM, KIRDS2, SLAMF7, NKp80, NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7 Rα, ITGA4, VLA1, CD49α, IA4, CD49D, ITGA6, VLA6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11α, ITGAM, CD11b, ITGAX, CD11c, CD29, ITGB1, ITGB2, CD18 , ITGB7, NKG2D, NKG2C, TNFR2, CD226, CD84, CD96, CEACAM1, CRTAM, CD229, CD160, PSGL1, CD100, CD69, SLAMF6, SLAM, BLAME, CD162, LTBR, ​​LAT, GADS or SLP-76;

[0026] More preferably, in one embodiment of the present invention, the co-stimulatory factor is CD28 or 4-1BB, or an amino acid sequence having more than 90% homology with it.

[0027] In some embodiments of the present invention, the above-mentioned nucleic acid molecules also encode intracellular signal transduction regions. Preferably, in some embodiments of the present invention, the intracellular signal transduction region is a sequence of amino acids selected from the following proteins or having more than 90% homology with the proteins: 4-1BB, B7-H3, BAFFR, BLAME, BTLA, CD100, CD103, CD160, CD18, CD19, CD19a, CD2, CD247, CD27, CD276, CD28, CD29, CD3ζ, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8alpha, CD8beta, CD96, CDS, CEACAM1, CRTAM, DAP-10, DNAM1, Fc gamma receptor, GADS, GITR, HVEM, IA4, ICAM-1, ICAM-1, Ig alpha, IL2R beta, IL2Rgamma, IL7R alpha, integrin, ITGA4, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, KIRDS2, LAT, LFA-1, LFA-1, LIGHT, LIGHT, LTBR, ​​Ly9, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80, OX-40, PAG / Cbp, PD-1, PSGL1, SELPLG, SLAMF4, SLAMF6, SLAMF7, SLP-76, TNFR2, Toll ligand receptor, TRANCE / RANKL, VLA1 or VLA-6, or combinations thereof.

[0028] More preferably, in one embodiment of the present invention, the intracellular signal transduction region is CD3ζ.

[0029] As a preferred embodiment of the present invention, the chimeric antigen receptor encoded by the nucleic acid molecule of the present invention is a signal transduction domain consisting of a structure formed by the anti-CD52 scFv antigen recognition region, the CD8α hinge region and the transmembrane region, and the 4-1BB and CD3ζ intracellular signal domains connected in series, as shown in SEQ ID NO.11.

[0030] In addition, any peptide chain can be inserted as a spacer at appropriate positions between the antigen recognition region, hinge region, transmembrane region and intracellular signaling region, and the peptide chain can be an oligopeptide or a polypeptide.

[0031] The preparation methods for the aforementioned nucleic acid molecules can be based on the base sequences of the aforementioned antigen recognition region, hinge region, transmembrane region, and intracellular signaling region, and can be achieved through known techniques such as chemical synthesis or PCR amplification. Typically, the codons encoding the amino acids of these domains can be optimized to improve their expression in host cells. Information on the aforementioned base sequences can be obtained by searching known literature or databases such as NCBI (https: / / www.ncbi.nlm.nih.gov / ).

[0032] In one embodiment of the present invention, the inventors obtained the base sequence of the CD52 binding domain anti-CD52 scFv antigen recognition region using PCR amplification. Specifically, total RNA was extracted from mouse anti-human CD52 monoclonal antibody hybridoma cell lines, and the first strand of cDNA was synthesized by reverse transcription. Mouse anti-human CD52 scFv was then synthesized by PCR amplification using a "mouse antibody scFv gene amplification kit".

[0033] The mouse anti-human CD52 monoclonal antibody hybridoma cell line (HI186) was developed by the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences. The monoclonal antibody produced using this hybridoma has been commercialized and can be used for the detection and diagnosis of CD52-positive chronic lymphocytic leukemia.

[0034] Another aspect of the present invention is to provide a chimeric antigen receptor encoded by the aforementioned nucleic acid molecule.

[0035] In some embodiments of the present invention, the extracellular region of the chimeric antigen receptor includes a CD52 binding domain, wherein the CD52 binding domain is an amino acid sequence of scFv composed of the light and heavy chains of a mouse anti-human CD52 antibody.

[0036] As a preferred embodiment of the present invention, the chimeric antigen receptor of the present invention is a signal transduction domain consisting of a CD52scFv antigen recognition region, a CD8α hinge region and a transmembrane region, and intracellular signal domains of 4-1BB and CD3ζ connected in series, and its amino acid sequence is shown in SEQ ID NO.12 of the sequence listing.

[0037] Another aspect of the present invention is to provide a carrier comprising the above-described nucleic acid molecules.

[0038] In this invention, the vector can be a linear vector or a circular vector. It can be a non-viral vector such as a plasmid, a viral vector, or a vector utilizing transposons. The vector may contain regulatory sequences such as promoters and terminators, as well as marker sequences such as drug resistance genes and reporter genes. Furthermore, the vector may also contain a sequence encoding a suicide gene, allowing for the control of the number of CAR-T cells in vivo by administering substances that activate the suicide gene, depending on the treatment process.

[0039] The viral vectors described above can be retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, etc. In one embodiment of the present invention, a lentiviral expression vector is used.

[0040] Another aspect of the present invention is to provide a cell comprising the above-described nucleic acid molecule, the above-described chimeric antigen receptor, or the above-described carrier.

[0041] In some embodiments of the present invention, the cells described above are human T cells. The T cells can be derived from bodily fluids such as blood and bone marrow, or from tissues such as the spleen, thymus, and lymph nodes, or from cancerous tissues such as primary tumors, metastatic tumors, and cancerous ascites, obtained after separation and purification. Preferably, the T cells are autologous T cells. Furthermore, the T cells can be CD4+. + T cells, CD8 + T cells, αβ T cells, or γδ T cells, or a mixture of the above-mentioned T cells, may be used. The T cells may be replaced with NK cells in a suitable manner, which are also considered to be included within the scope of protection of this invention.

[0042] Another aspect of the present invention is to provide the use of the above-mentioned nucleic acid molecule, the above-mentioned chimeric antigen receptor, the above-mentioned carrier or the above-mentioned cell in the preparation of a drug for treating hematologic malignancies.

[0043] As long as the T-cell hematologic malignancies express CD52 during the pathological process, the aforementioned T-cell hematologic malignancies include, but are not limited to, T-ALL, CLL, and T-cell lymphoma. Preferably, the aforementioned T-cell hematologic malignancies are T-ALL, CLL, or T-cell lymphoma.

[0044] Furthermore, in some embodiments of the present invention, the aforementioned hematologic malignancy is a recurrent or ineffective hematologic malignancy;

[0045] More preferably, in some embodiments of the present invention, the aforementioned hematologic malignancy is a recurrent or ineffective CD52-mediated hematologic malignancy. + Hematologic malignancies.

[0046] Another aspect of the present invention is to provide a pharmaceutical composition comprising the above-described nucleic acid molecule, the above-described chimeric antigen receptor, the above-described carrier or the above-described cell, and a pharmaceutically acceptable carrier.

[0047] In addition to the above-mentioned components, the pharmaceutical compositions of the present invention may also contain any pharmaceutically permissible additives, such as physiological saline, cell culture medium, glucose, water for injection, glycerol, ethanol and combinations thereof, stabilizers, surfactants, preservatives, isotonic agents, etc.

[0048] Similarly, the pharmaceutical compositions of the present invention can also be used in combination with other suitable anticancer agents. For example, vincristine, daunorubicin, asparaginase, cyclophosphamide, prednisone, etc.

[0049] Another aspect of the present invention is to provide a method for treating hematologic malignancies by administering the above-described cells or the above-described pharmaceutical composition to a patient;

[0050] Preferably, in some embodiments of the present invention, the aforementioned hematologic malignancy is CD52. + Hematologic malignancies.

[0051] The beneficial effects of this invention are as follows:

[0052] This invention constructs T cells expressing a chimeric antigen receptor targeting CD52. Flow cytometry, degranulation analysis, and ELISA detection of cytokines secreted by the T cells demonstrate that these CAR-T cells can be effectively expanded in vitro and exhibit strong killing activity against acute T-cell lymphoblastic leukemia cells expressing CD52, while showing almost no killing effect on cells not expressing CD52, effectively preventing off-target effects. The chimeric antigen receptor CD52 scFv-CD8α-4-1BB-CD3ζ of this invention can be used for CD52... + Treatment of T-cell hematologic malignancies, and combination therapy with other CAR-T cells. Attached Figure Description

[0053] Figure 1 This is an electrophoresis diagram of PCR amplification of the light chain (VL) and heavy chain (VH) of mouse anti-human CD52 monoclonal antibody in an embodiment of the present invention, wherein 1 is the standard lane for 2kb nucleic acid molecular weight, 2 is the VL lane, and 3 is the VH lane;

[0054] Figure 2 These are electrophoresis images of 5'RACE and 3'RACE amplification of mouse anti-human CD52 monoclonal antibodies VL and VH in embodiments of the present invention. Figure 2 In lane A, lanes 1 and 4 are standard lanes for 2kb nucleic acid molecular weight; lane 2 is the 5' RACE amplification VL lane; lane 3 is the 5' RACE amplification VH lane; Figure 2 In lane B, lanes 1 and 3 are standard lanes for 2kb nucleic acid molecular weight; lane 2 is the 3'RACE amplification VL lane; and lane 4 is the 3'RACE amplification VH lane.

[0055] Figure 3 This is an electrophoresis diagram of the restriction endonuclease digestion fragments of the lentiviral expression plasmid CD52 scFv-CD8α-4-1BB-CD3ζ in an embodiment of the present invention. Lane 1 is the 15kb molecular weight marker lane; lane 2 is the lane containing the DNA fragment (1411bp) and vector fragment (7303bp) encoding CD52 scFv-CD8α-4-1BB-CD3ζ obtained by double digestion of the lentiviral expression plasmid CD52 scFv-CD8α-4-1BB-CD3ζ with endonucleases NheⅠ and NotⅠ.

[0056] Figure 4 This is a schematic diagram of a lentiviral expression vector in an embodiment of the present invention, wherein the counterclockwise sequence is the forward gene fragment and the clockwise sequence is the reverse gene fragment;

[0057] Figure 5 The image shows the results of flow cytometry analysis of the expression of CAR molecules in T cells modified with CD52scFv-CD8α-4-1BB-CD3ζ constructed in this embodiment of the invention. In the image, GFP represents the expression of the marker protein carried by the vector, and scFv represents the expression of recombinant human CD52-hFc recombinant protein labeled with anti-human Fc antibody.

[0058] Figure 6 The image shows the results of flow cytometry analysis of the expression intensity of CD52 target antigen molecules in Hut78-19t and Molt4-19t cells, which are acute T-lymphoblastic leukemia cell lines in this invention. In the figure, A represents the positive rate of CD52 target antigen molecule expression, and B represents the mean fluorescence intensity (MFI) of CD52 target antigen molecule expression.

[0059] Figure 7 The graph shows the results of detecting the survival rate of residual tumor cells after co-culturing T cells and target cells in this embodiment of the invention using flow cytometry. In this graph, CAR-T represents the experimental group of T cells modified with CD52 scFv-CD8α-4-1BB-CD3ζ; vec-T represents the control group of T cells transfected with an empty vector; and A represents the percentage of CD52 cells in five replicate experiments. Figure B shows the residual tumor cell survival rates after co-culturing scFv-CD8α-4-1BB-CD3ζ modified T cells with CD52-positive Hut78-19t cell lines and CD52-negative Molt4-19t cell lines at effector-target ratios of 1:4, 1:2, 1:1, and 2:1 for 24 and 48 hours; B is a flow cytometry diagram showing the residual tumor cell survival rates after co-culturing CD52scFv-CD8α-4-1BB-CD3ζ modified T cells with CD52-positive Hut78-19t cell lines and CD52-negative Molt4-19t cell lines at an effector-target ratio of 1:1 for 24 and 48 hours.

[0060] Figure 8 This image shows the degranulation detection results of CD52 scFv-CD8α-4-1BB-CD3ζ modified T cells against Hut78-19t and Molt4-19t (effect-to-target ratio 1:1) in an embodiment of the present invention. Five replicate experiments were performed. CAR-T was the experimental group of CD52 scFv-CD8α-4-1BB-CD3ζ modified T cells; vec-T was the control group of T cells transfected with an empty vector.

[0061] Figure 9 This image shows the levels of cytokines IL-6 (left), IFN-γ (middle), and TNF-α (right) released by T cells after co-culturing CD52 scFv-CD8α-4-1BB-CD3ζ modified T cells with Hut78-19t and Molt4-19t cell lines at an effector-target ratio of 1:1 for 48 hours in an embodiment of the present invention. CAR-T is the experimental group of CD52 scFv-CD8α-4-1BB-CD3ζ modified T cells; vec-T is the control group of T cells transfected with an empty vector.

[0062] Sequence Description

[0063] SEQ ID No. 1-3 are the amino acid sequences of the light chain variable region CDR1-3 in the embodiments of the present invention;

[0064] SEQ ID No. 4-6 are the amino acid sequences of the heavy chain variable region CDR1-3 in the embodiments of the present invention;

[0065] SEQ ID No. 7 is the amino acid sequence of the light chain variable region in this embodiment of the invention;

[0066] SEQ ID No. 8 is the amino acid sequence of the heavy chain variable region in this embodiment of the invention;

[0067] SEQ ID No. 9 is the amino acid sequence of the single-chain antibody in the embodiments of the present invention;

[0068] SEQ ID No. 10 is the amino acid sequence of the signal peptide in the embodiments of the present invention;

[0069] SEQ ID No. 11 is the nucleotide sequence of the chimeric antigen receptor targeting CD52 in an embodiment of the present invention;

[0070] SEQ ID No. 12 is the amino acid sequence of the chimeric antigen receptor targeting CD52 in an embodiment of the present invention;

[0071] SEQ ID No. 13 is the amino acid sequence of CD8α-4-1BB-CD3ζ in the chimeric antigen receptor targeting CD52 in this embodiment of the invention. Detailed Implementation

[0072] This invention discloses a chimeric antigen receptor targeting CD52 and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. Furthermore, those skilled in the art can clearly modify or appropriately alter and combine the content described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0073] In this invention, unless otherwise stated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or variations thereof such as "including" or "comprising of," etc., shall be understood to include the stated elements or components without excluding other elements or other components. The terms "such as," "for example," etc., are intended to refer to exemplary embodiments and are not intended to limit the scope of this disclosure.

[0074] The following is an explanation of some of the terms used in this invention.

[0075] The term "antigen-binding moiety" refers to a polypeptide fragment containing a full-length antibody that retains the ability to specifically bind to the same antigen bound by the full-length antibody, and / or competes with the full-length antibody for specific binding to the antigen; it is also called an "antigen-binding fragment." See Fundamental Immunology, Ch. 7 (Paul, W., ed., 2nd ed., Raven Press, NY (1989), which is incorporated herein by reference in its entirety for all purposes. Antigen-binding fragments of antibodies can be generated through recombinant DNA technology or through enzymatic or chemical fragmentation of intact antibodies. In some cases, antigen-binding fragments include Fab, Fab′, F(ab′)2, Fd, Fv, etc.

[0076] The term “variable region” in antibody refers to the variable region of either the antibody light chain or the antibody heavy chain, alone or in combination. As is known in the art, the variable regions of both the heavy and light chains are each composed of four framework regions (FRs) linked by three complementarity-determining regions (CDRs), also known as hypervariable regions. The CDRs in each chain are held together tightly by the FRs, and also by those from other chains, which contribute to the formation of the antigen-binding site of the antibody. At least two techniques are used to determine the CDRs: (1) methods based on cross-species sequence variability (i.e., Kabat et al. Sequences of Proteins of Immunological Interest, (5th ed., 1991, National Institutes of Health, Bethesda MD)); and (2) methods based on crystallographic studies of antigen-antibody complexes (Al-lazikani et al., 1997, J. Molec. Biol. 273: 927-948). As used herein, a CDR may refer to a CDR defined by either method or by a combination of both.

[0077] The term "co-stimulation" refers to a secondary signaling event that activates the immune response in immune cells. Immune cells rely on co-stimulation to activate the immune response in the presence of antigen-presenting cells. For T cells, two stimuli are required to fully activate their immune response. That is, during lymphocyte activation, co-stimulation is usually crucial for the development of an effective immune response. In addition to antigen-specific signals from their antigen receptors, co-stimulation is also required. The second signal prevents activated T cells from becoming unresponsive and causes them to produce additional lymphokines necessary for T cell growth.

[0078] The term "treatment" refers to reducing the likelihood of a disease pathology, reducing the occurrence of disease symptoms, such as resulting in a longer survival or reduced discomfort for the subject to some extent. Treatment can refer to the ability of a therapy to reduce disease symptoms, signs, or causes when administered to a subject. Treatment also refers to alleviating or reducing at least one clinical symptom and / or inhibiting or delaying the progression of the condition and / or preventing or delaying the onset of the disease or disorder.

[0079] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be further described in detail below with reference to specific embodiments.

[0080] Example 1: Cloning of CD52 scFv, the antigen recognition region in a chimeric antigen receptor

[0081] 1. Total RNA was extracted from mouse anti-human CD52 monoclonal antibody hybridoma cell lines: at 5 × 10⁻⁶ cells / cells. 6Add 1 ml of RNAiso Plus (Takara) to the cells and mix well by pipetting. Add 200 μl of chloroform and mix by inverting and vortexing. Centrifuge at 12,000 rpm for 5 minutes at 4°C. Transfer the supernatant to a 1.5 ml EP tube, add an equal volume of isopropanol, and mix gently by inverting. Centrifuge at 12,000 rpm for 15 minutes at 4°C. Pre-cool 75% ethanol at 4°C to precipitate RNA, and dissolve the total RNA in 50 μl of DEPC water.

[0082] 2. Reverse transcription to synthesize the first strand of cDNA:

[0083] The PCR reaction mixture (20 μl) was prepared as follows:

[0084]

[0085]

[0086] Reaction conditions: 37℃ for 60 minutes, 70℃ for 10 minutes.

[0087] 3. PCR amplification of the light chain (VL) and heavy chain (VH) gene fragments of mouse anti-human CD52 monoclonal antibody using the "Mouse Antibody scFv Gene Amplification Kit" (Public Protein / Plasmid Library):

[0088] Amplifying the VL chain:

[0089] The PCR reaction mixture (50 μl) was prepared as follows:

[0090] MVL mix: 45μl;

[0091] DNA polymerase: 0.3 μl;

[0092] cDNA: 400ng;

[0093] ddH2O: Add to a final volume of 50 μl.

[0094] Reaction conditions: Pre-denaturation at 94℃ for 3 minutes; repeat the following cycle 30 times: 94℃ for 30 seconds, 56℃ for 30 seconds, 72℃ for 45 seconds; finally, extend at 72℃ for 10 minutes;

[0095] Amplifying the VH chain:

[0096] The PCR reaction mixture (50 μl) was prepared as follows:

[0097] MVH mix: 45μl;

[0098] DNA polymerase: 0.3 μl;

[0099] cDNA: 400ng;

[0100] ddH2O: Add to a final volume of 50 μl.

[0101] Reaction conditions: Pre-denaturation at 94℃ for 3 minutes; repeat the following cycle 30 times: 94℃ for 30 seconds, 56℃ for 30 seconds, 72℃ for 45 seconds; finally, extend at 72℃ for 10 minutes;

[0102] The VL and VH fragments were separated and recovered by agarose gel electrophoresis. Results are as follows: Figure 1 As shown.

[0103] VL and VH were ligated into the pMD19-simple T vector and sequenced. The nucleic acid sequences of the CD52 monoclonal antibodies VL and VH were determined based on the sequencing results.

[0104] 4. Use " The RACE 5' / 3' Kit User Manual PCR Amplification Kit (Takara) confirmed the backbone sequences of mouse anti-human CD52 monoclonal antibodies VL and VH:

[0105] (1) Reverse transcription to synthesize the first strand of 5' / 3' RACE cDNA:

[0106] 5'RACE cDNA:

[0107] RNA: 1 μg;

[0108] 5'-CDS Primer A: 1μl;

[0109] Sterile water: Add to a final volume of 11 μl.

[0110] 3'RACE cDNA:

[0111] RNA: 1 μg;

[0112] 3'-CDS Primer A: 1μl;

[0113] Sterile water: Add to a final volume of 12 μl.

[0114] Reaction conditions: 72℃ for 3 minutes, 42℃ for 2 minutes;

[0115] The PCR reaction system (20 μl) for reverse transcription to synthesize the first strand of cDNA is as follows:

[0116] In the first step reaction system, continue to add:

[0117] 5×First-Strand Buffer: 4μl;

[0118] DTT (100mM): 0.5μl;

[0119] dNTPs (20mM): 1μl;

[0120] RNase Inhibitor(40U / μl): 0.5μl;

[0121] SMARTScribe Reverse Transcriptase (100U): 2μl;

[0122] Sterile water: Add to a final volume of 20 μl.

[0123] In the 5'RACE cDNA reaction, an additional 1 μl of SMARTerII A Oligonucleotide needs to be added.

[0124] Reaction conditions: 42℃ for 90 minutes, 70℃ for 10 minutes;

[0125] After the reaction, the first strand of cDNA was diluted with 90 μl of Tricine-EDTA Buffer.

[0126] (2) RACE

[0127] Prepare the PCR reaction mixture (50 μl) as follows:

[0128] Or 3'RACE-Ready cDNA: 2.5μl;

[0129] 10×UPM: 5μl;

[0130] 5' or 3' GSP (10μM): 1μl;

[0131] SeqAmp DNA Polymerase: 1μl;

[0132] 2×SeqAmp Buffer: 25μl;

[0133] PCR-Grade H2O: 15.5 μl;

[0134] Reaction conditions: Pre-denaturation at 94℃ for 5 minutes; repeat the following cycle 25 times: 94℃ for 30 seconds, 68℃ for 30 seconds, 72℃ for 3 minutes; finally, extend at 72℃ for 10 minutes.

[0135] The VL and VH fragments were separated and recovered by agarose gel electrophoresis. Results are as follows: Figure 2 As shown.

[0136] (3) Connect VL and VH to the pUC19-based T vector and sequence them. Determine the nucleic acid sequences of the VL and VH backbone regions of the CD52 monoclonal antibody based on the sequencing results.

[0137] 5. Recombination method for constructing VL-linker-VH direction CD52 scFv fragments:

[0138] P1: 5'TGCTCCACGCCGCCAGGCCGGCTAGCGATGTTGTGATGACCCAGACTCCACTCACTTTGTC 3'

[0139] P2: 5'TTCGGAGCCCGCCGCCGCCAGAACCACCACCACCAGAACCACCACCACCAGCCCGTTTGATTTCCAGCTTGGT 3'

[0140] P3: 5'TGGTTCTGGCGGCGGCGGCTCCGAAGTGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGC 3'

[0141] P4: 5'TGGTCGCGGCGCTGGCGTCGTGGTGAATTCTGAGGAGACTGTGAGAGTGGTGCCTTGGCCCCA3'

[0142] Prepare the PCR reaction system to obtain the Nhe I-VL-linker fragment (50 μl):

[0143] 2×Pfu PCR Master Mix (TianGen): 25 μl;

[0144] 10μM P1+P2: 2μl;

[0145] pMD19-VL plasmid: 100 ng;

[0146] ddH2O: Add to a final volume of 50 μl.

[0147] Reaction conditions: Pre-denaturation at 94℃ for 5 minutes; repeat the following cycle 32 times: 94℃ for 30 seconds, 58.5℃ for 30 seconds, 72℃ for 24 seconds; finally, extension at 72℃ for 10 minutes;

[0148] Prepare the PCR reaction system to obtain the linker-VH-EcoR I fragment (50 μl):

[0149] 2×Pfu PCR Master Mix (TianGen): 25 μl;

[0150] 10μM P3+P4: 2μl;

[0151] pMD19-VH plasmid: 100 ng;

[0152] ddH2O: Add to a final volume of 50 μl.

[0153] Reaction conditions: Pre-denaturation at 94℃ for 5 minutes; repeat the following cycle 32 times: 94℃ for 30 seconds, 58.5℃ for 30 seconds, 72℃ for 24 seconds; finally, extension at 72℃ for 10 minutes;

[0154] NheⅠ-VL-linker and linker-VH-EcoRⅠ fragments were separated and recovered by agarose gel electrophoresis;

[0155] The sequence described in this embodiment can also be synthesized commercially.

[0156] Example 2: Construction of a chimeric antigen receptor vector

[0157] 1. The plasmid containing the CD8α-4-1BB-CD3ζ fragment, previously prepared in the laboratory, was digested with Nhe I and EcoRI restriction enzymes to obtain the CD8α-4-1BB-CD3ζ fragment, the amino acid sequence of which is shown in SEQ ID NO.13. The plasmid containing the CD8α-4-1BB-CD3ζ fragment can be prepared by any suitable method in the prior art.

[0158] 2. The CD52 scFv fragment obtained in Example 1 was recombined with the target vector. The constructed CD52 scFv-CD8α-4-1BB-CD3ζCAR expression vector was identified by NheⅠ and NotⅠ restriction enzyme digestion. The results are as follows: Figure 3 As shown, the enzyme digestion results indicate that the positive clone contains the target band and the sequencing identification is correct. A schematic diagram of the vector is shown below. Figure 4 As shown.

[0159] Example 3: Preparation of chimeric antigen receptor CD52 scFv-CD8α-4-1BB-CD3ζ lentivirus-modified T cells

[0160] 1. The expression plasmid CD52scFv-CD8α-4-1BB-CD3ζ and packaging plasmids PRSV-Rev, pMDlg-PRRE, and pMD.2G were extracted using the EndoFree Plasmid Maxi plasmid extraction kit (QIAGEN). The four plasmids were transfected using PEI transfection reagent (Polyscience) at a ratio of 12.2:4.11:8.75:3.5 (see PEI transfection reagent instructions for details). Fresh culture medium was added 12 hours after transfection. Viral supernatant was collected at 24 and 48 hours, centrifuged at 3000 rpm for 15 minutes at 4°C, filtered through a 0.45 μm filter, and concentrated 10-fold by ultracentrifugation at 50000g, 4°C, for 2.5 hours. The concentrated supernatant was then aliquoted and stored at -80°C.

[0161] 2. Preparation of T cells: Take 10ml of fresh peripheral blood from healthy individuals and extract T cells using RosetteSep T cell enrichment Cocktail (Stemcell) and Ficoll-Paque PLUS (GE Healthcare) (follow the RosetteSep T cell enrichment Cocktail instructions). Add anti-CD3 / CD28 magnetic beads (Gibco) at a cell:magnetic bead ratio of 1:1 and culture for 24 hours to obtain pre-transfection T cells.

[0162] 3. Lentiviral infection of T cells and culture of post-infection T cells: Viral supernatant was removed from -80℃, thawed on ice, and cultured at a concentration of 1×10⁻⁶ cells / day. 6 Add 100 μl of viral supernatant to T cells, then add Polybrene to a final concentration of 8 μg / ml. Centrifuge at 1800 rpm for 1.5 hours at 32°C, then transfer to a 5% CO2 incubator at 37°C.

[0163] 4. Flow cytometry detection of the positive rate of CAR-modified T cells: 2 × 10⁻⁶ cells were used. 5 Cells were treated with 0.5 μg of recombinant human CD52-hFc protein, transferred to 5% CO2, and incubated at 37°C for 3 hours. After washing twice with PBS, cells were labeled with anti-human Fc antibody, and flow cytometry was used to analyze the expression of Fc and GFP in T cells. Results are as follows: Figure 5 As shown, the positive rate of vec-T was 93.73%, and the positive rate of CAR-T was 71.59%.

[0164] Experiment Example 4: Killing effect of chimeric antigen receptor CD52 scFv-CD8α-4-1BB-CD3ζ lentiviral modified T cells on leukemia cells

[0165] 1. CD52 expression levels in hematologic malignancy cell lines:

[0166] Both Hut78 and Molt4 cell lines were purchased from ATCC in the United States. Our laboratory used lentivirus to transfect truncated CD19 surface protein to obtain Hut78-19t and Molt4-19t cell lines. After culturing separately, 5 × 10⁶ cells were harvested from each line. 5 Cell suspensions were washed twice with PBS and then labeled with APC anti-human CD52 monoclonal antibody (Biolegend). APC-isotype was used as a control group. Cells were incubated on ice for 30 minutes. Flow cytometry was used to detect the expression of CD52 target antigen molecules in the cell lines. Results are shown below. Figure 6 As shown in Figure A, the positive rates of CD52 expression in the Hut78-19t and Molt4-19t cell lines were 90.44% and 0.19%, respectively. The mean fluorescence intensity (MFI) of CD52 expression in the Hut78-19t and Molt4-19t cell lines were 12823 and 2071, respectively. Figure 6 (B). The results showed that Hut78-19t cells were CD52 positive cells and Molt4-19t cells were CD52 negative cells in this experimental case.

[0167] 2. Flow cytometry analysis of residual tumor cells after co-culturing CAR-modified T cells with Hut78-19t and Molt4-19t cell lines:

[0168] The above cells were divided into 2×10 5 Cells were seeded into 24-well culture plates, and 5 × 10⁶ cells were added to each well. 4 (E:T = 1:4), 1×10 5 (E:T = 1:2), 2 × 10 5 (E:T = 1:1) and 4×10 5 CAR-modified T cells (E:T = 2:1) were repeatedly co-cultured with empty vector T cells (vec-T) transfected without CAR (as a control group). The co-cultured cells were then labeled with APC anti-human CD19 monoclonal antibody (Biolegend) on Hut78-19t and Molt4-19t cell lines, and residual cells were detected by flow cytometry. The results of five independent replicate experiments are summarized below. Figure 7As shown in Figure A, after co-culturing CAR-T cells with CD52-expressing Hut78-19t for 24 hours, the residual tumor cells in each effector-to-target ratio group were 57.15%, 19.07%, 2.66%, and 0.258%, respectively, while the residual Hut78-19t cells in the control group were 84.37%, 73.92%, 56.66%, and 36.64%, respectively. After co-culturing CAR-T cells with CD52-expressing Hut78-19t for 48 hours, the residual tumor cells in each effector-to-target ratio group were 35.25%, 8.33%, 1.01%, and 0.18%, respectively, while the residual Hut78-19t cells in the control group were 80.947%, 71.42%, 56.86%, and 36.28%, respectively. Figure 7 As shown in B-1, after Hut78-19t was mixed with vec-T and CAR-T at a 1:1 ratio, the proportion of target cells at 0 h was 47.03% and 45.15%, respectively. After co-culturing for 24 hours, the proportion of target cells was 56.15% and 7.49%, respectively. After co-culturing for 48 hours, the proportion of target cells was 55.75% and 0.4%, respectively. Figure 7 As shown in Figure B-2, after Molt4-19t was mixed 1:1 with vec-T and CAR-T, the proportions of target cells at 0 h were 40.5% and 41.29%, respectively. After 24 hours of co-culture, the proportions were 54.87% and 49.22%, respectively. After 48 hours of co-culture, the proportions were 74.33% and 51.1%, respectively. These results indicate that CAR-T has a killing effect on tumor cells expressing CD52, while showing no off-target effect on target cells that do not express CD52.

[0169] 3. Degranulation assay to analyze the activation of CAR-modified T cells:

[0170] CAR-T and vec-T cells were co-cultured with Hut78-19t and Molt4-19t cells at an effector-target ratio of 1:1, respectively. Anti-human CD107a antibody and monensin were added to the co-culture system. GFP was detected by flow cytometry after 4 hours. + Expression levels of CD107a on the cell surface. Results are as follows: Figure 8As shown, in the co-culture systems of CAR-T cells with Hut78-19t and Molt4-19t, the cell activation percentages were 56.27% and 12.98%, respectively, while in the co-culture systems of vec-T cells with Hut78-19t and Molt4-19t, the cell activation percentages were 2.91% and 0.72%, respectively. There was a significant difference in activation between CAR-T and vec-T cells in the co-culture system with Hut78-19t (P<0.001); the activation level of CAR-T cells co-cultured with Molt4-19t was significantly lower than that of CAR-T cells co-cultured with CD52-positive Hut78-19t cells (P<0.001). These results indicate that CAR-T cells are effective against CD52-positive cells. + It has a specific killing effect on tumor cells.

[0171] 4. ELISA was used to detect the levels of cytokines IL-6, IFN-γ, and TNF-α in the supernatant of leukemia cell lines co-cultured with CAR-T cells:

[0172] Hut78-19t and Molt4-19t cell lines were respectively divided into two groups of 2 × 10⁻⁶ cells. 5 Seed cells / well in 24-well plates. 2 × 10⁶ cells / well. 5 CAR-T and vec-T cells were added separately, and culture medium was added to a final volume of 1 ml. After co-culturing in an incubator for 48 hours, the co-culture supernatant was analyzed using a human IL-6, IFN-γ, and TNFα ELISA kit (R&D Company) (see the ELISA kit instructions for specific steps). Results are as follows: Figure 9 As shown, the results indicated that the levels of IL-6, IFN-γ, and TNF-α cytokines in the supernatant of co-cultured Hut78-19t leukemia cell line expressing CD52 were significantly higher than those in the vec-T group (P<0.01). However, the level of IFN-γ in the supernatant of co-cultured Molt4-19t cells, which do not express CD52, was very low, and IL-6 and TNF-α were almost not secreted. These results suggest that CAR-T cells can secrete Th1-type cytokines when stimulated by tumor cells expressing CD52.

[0173] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention. sequence list <110> Chinese Academy of Medical Sciences Blood Diseases Hospital (Institute of Hematology, Chinese Academy of Medical Sciences) <120> Chimeric antigen receptors targeting CD52 and their applications <160> 13 <170> SIPOSequenceListing 1.0 <210> 1 <211> 16 <212> PRT <213> Artificial <400> 1 Lys Ser Ser Gln Ser Leu Leu Asp Ser Asp Gly Lys Thr Tyr Leu Asn 1 5 10 15 <210> 2 <211> 7 <212> PRT <213> Artificial <400> 2 Leu Val Ser Ala Leu Asp Ser 1 5 <210> 3 <211> 9 <212> PRT <213> Artificial <400> 3 Trp Gln Gly Thr His Phe Pro Trp Thr 1 5 <210> 4 <211> 10 <212> PRT <213> Artificial <400> 4 Gly Phe Thr Phe Ser Asp Ala Trp Met Asp 1 5 10 <210> 5 <211> 19 <212> PRT <213> Artificial <400> 5 Glu Ile Arg Asn Lys Ala Lys Asn His Val Thr Tyr Tyr Ala Ala Ser 1 5 10 15 Val Lys Gly <210> 6 <211> 3 <212> PRT <213> Artificial <400> 6 Leu Asp Lys 1 <210> 7 <211> 114 <212> PRT <213> Artificial <400> 7 Asp Val Val Met Thr Gln Thr Pro Leu Thr Leu Ser Val Thr Ile Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Asp Ser 20 25 30 Asp Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Arg Pro Gly Gln Ser 35 40 45 Pro Lys Arg Leu Ile Phe Leu Val Ser Ala Leu Asp Ser Gly Val Pro 50 55 60 Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Arg Ile 65 70 75 80 Asn Arg Val Glu Ala Glu Asp Leu Gly Ile Tyr Tyr Cys Trp Gln Gly 85 90 95 Thr His Phe Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 110 Arg Ala <210> 8 <211> 114 <212> PRT <213> Artificial <400> 8 Glu Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Met Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Ala 20 25 30 Trp Met Asp Trp Val Arg Arg Ser Pro Glu Lys Gly Leu Glu Trp Val 35 40 45 Ala Glu Ile Arg Asn Lys Ala Lys Asn His Val Thr Tyr Tyr Ala Ala 50 55 60 Ser Val Lys Gly Arg Phe Ser Ile Ser Arg Asp Asp Ser Lys Ser Ser 65 70 75 80 Val Tyr Leu Gln Met Asn Ser Leu Arg Pro Glu Asp Thr Gly Ile Tyr 85 90 95 Tyr Cys Thr Thr Leu Asp Lys Trp Gly Gln Gly Thr Thr Leu Thr Val 100 105 110 Ser Ser <210> 9 <211> 243 <212> PRT <213> Artificial <400> 9 Asp Val Val Met Thr Gln Thr Pro Leu Thr Leu Ser Val Thr Ile Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Asp Ser 20 25 30 Asp Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Arg Pro Gly Gln Ser 35 40 45 Pro Lys Arg Leu Ile Phe Leu Val Ser Ala Leu Asp Ser Gly Val Pro 50 55 60 Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Arg Ile 65 70 75 80 Asn Arg Val Glu Ala Glu Asp Leu Gly Ile Tyr Tyr Cys Trp Gln Gly 85 90 95 Thr His Phe Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 110 Arg Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Glu Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly 130 135 140 Gly Ser Met Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp 145 150 155 160 Ala Trp Met Asp Trp Val Arg Arg Ser Pro Glu Lys Gly Leu Glu Trp 165 170 175 Val Ala Glu Ile Arg Asn Lys Ala Lys Asn His Val Thr Tyr Tyr Ala 180 185 190 Ala Ser Val Lys Gly Arg Phe Ser Ile Ser Arg Asp Asp Ser Lys Ser 195 200 205 Ser Val Tyr Leu Gln Met Asn Ser Leu Arg Pro Glu Asp Thr Gly Ile 210 215 220 Tyr Tyr Cys Thr Leu Asp Lys Trp Gly Gln Gly Thr Thr Leu Thr 225 230 235 240 Val Ser Ser <210> 10 <211> 21 <212> PRT <213> Artificial <400> 10 Met Wing Leo Pro Val Thr Wing Leo Leo Pro Leo Wing Leo Leo 1 5 10 15 His Wing Wing Arg Pro 20 <210> 11 <211> 1473 <212> DNA <213> Artificial <400> 11 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccggctagcg atgttgtgat gacccagact ccactcactt tgtcggttac cattggacaa 120 ccagcctcca tctcttgcaa gtcaagtcag agcctcttag atagtgatgg aaagacatat 180 ctgaattggt tgttacagag gccaggccag tctccaaagc gcctaatctt tctggtgtct 240 gcactggact ctggcgtccc tgacaggttc actggcagtg gatcagggac agatttcaca 300 ctgagaatca acagagtgga ggctgaggat ttgggaattt attattgctg gcaaggtaca 360 cattttccgt ggacgttcgg tggaggcacc aagctggaaa tcaaacgggc tggtggtggt 420 ggttctggtg gtggtggttc tggcggcggc ggctccgaag tgaagcttga ggagtctgga 480 ggaggcttgg tgcaacctgg aggatccatg aaactctctt gtgctgcctc tggattcact 540 tttagtgacg cctggatgga ctgggtccgc cggtctccag agaaggggct tgagtgggtt 600 gctgaaatta gaaacaaagc taaaaatcat gtaacatact atgctgcgtc tgtgaaaggg 660 aggttctcca tctcaagaga tgattccaaa agtagtgtct acctgcagat gaacagctta 720 agacctgaag acactggcat ttattactgt accaccctcg acaagtgggg ccaaggcacc 780 actctcacag tctcctcaga attcaccacg acgccagcgc cgcgaccacc aacaccggcg 840 cccaccatcg cgtcgcagcc cctgtccctg cgcccagagg cgtgccggcc agcggcgggg 900 ggcgcagtgc acacgagggg gctggacttc gcctgtgata tctacatctg ggcgcccttg 960 gccgggactt gtggggtcct tctcctgtca ctggttatca ccctttactg caaacggggc 1020 agaagaaac tcctgtatat attcaaacaa ccatttatga gaccagtaca aactactcaa 1080 gaggaagatg gctgtagctg ccgatttcca gaagaagaag aaggaggatg tgaactgaga 1140 gtgaagttca gcaggagcgc agacgcccc gcgtaccagc agggccagaa ccagctctat 1200 aacgagctca atctaggacg aagagaggag tacgatgttt tggacaagag acgtggccgg 1260 gaccctgaga tgggggaaa gccgagaagg aagaaccctc aggaagcct gtacaatgaa 1320 ctgcagaaag atagatggc ggaggcctac agtgagattg ggatgaagg cgagcgccgg 1380 aggggcaagg ggcacgatgg cctttaccag ggtctcagta cagccaccaa ggacacctac 1440 gacgcccttc acatgcaggc cctgccccct cgc 1473 <210> 12 <211> 491 <212> PRT <213> Artificial <400> 12 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Ala Ser Asp Val Val Met Thr Gln Thr Pro Leu 20 25 30 Thr Leu Ser Val Thr Ile Gly Gln Pro Ala Ser Ile Ser Cys Lys Ser 35 40 45 Ser Gln Ser Leu Leu Asp Ser Asp Gly Lys Thr Tyr Leu Asn Trp Leu 50 55 60 Leu Gln Arg Pro Gly Gln Ser Pro Lys Arg Leu Ile Phe Leu Val Ser 65 70 75 80 Ala Leu Asp Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly 85 90 95 Thr Asp Phe Thr Leu Arg Ile Asn Arg Val Glu Ala Glu Asp Leu Gly 100 105 110 Ile Tyr Tyr Cys Trp Gln Gly Thr His Phe Pro Trp Thr Phe Gly Gly 115 120 125 Gly Thr Lys Leu Glu Ile Lys Arg Ala Gly Gly Gly Gly Ser Gly Gly 130 135 140 Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Lys Leu Glu Glu Ser Gly 145 150 155 160 Gly Gly Leu Val Gln Pro Gly Gly Ser Met Lys Leu Ser Cys Ala Ala 165 170 175 Ser Gly Phe Thr Phe Ser Asp Ala Trp Met Asp Trp Val Arg Arg Ser 180 185 190 Pro Glu Lys Gly Leu Glu Trp Val Ala Glu Ile Arg Asn Lys Ala Lys 195 200 205 Asn His Val Thr Tyr Tyr Ala Ala Ser Val Lys Gly Arg Phe Ser Ile 210 215 220 Ser Arg Asp Asp Ser Lys Ser Ser Val Tyr Leu Gln Met Asn Ser Leu 225 230 235 240 Arg Pro Glu Asp Thr Gly Ile Tyr Tyr Cys Thr Thr Leu Asp Lys Trp 245 250 255 Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Glu Phe Thr Thr Thr Pro 260 265 270 Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu 275 280 285 Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His 290 295 300 Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu 305 310 315 320 Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr 325 330 335 Cys Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe 340 345 350 Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg 355 360 365 Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser 370 375 380 Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr 385 390 395 400 Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys 405 410 415 Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn 420 425 430 Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu 435 440 445 Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly 450 455 460 His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr 465 470 475 480 Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 485 490 <210> 13 <211> 223 <212> PRT <213> Artificial <400> 13 Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala 1 5 10 15 Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly 20 25 30 Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile 35 40 45 Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val 50 55 60 Ile Thr Leu Tyr Cys Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe 65 70 75 80 Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly 85 90 95 Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg 100 105 110 Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln 115 120 125 Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp 130 135 140 Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro 145 150 155 160 Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp 165 170 175 Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg 180 185 190 Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr 195 200 205 Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 210 215 220

Claims

1. A nucleic acid molecule encoding a chimeric antigen receptor targeting CD52, said chimeric antigen receptor comprising an extracellular region, a transmembrane region, and an intracellular signal transduction region, characterized in that, The sequence of the nucleic acid molecule is shown in SEQ ID NO.

11.

2. A chimeric antigen receptor targeting CD52, characterized in that, The chimeric antigen receptor is encoded by the nucleic acid molecule as described in claim 1.

3. A carrier, characterized in that, The carrier comprises the nucleic acid molecule as described in claim 1.

4. A cell characterized in that, The cell contains the nucleic acid molecule as described in claim 1, the chimeric antigen receptor as described in claim 2, or the vector as described in claim 3.

5. The cell according to claim 4, characterized in that, The cells mentioned are T cells and NK cells.

6. The cell according to claim 5, characterized in that, The cells in question are autologous T cells.

7. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the nucleic acid molecule as claimed in claim 1, the chimeric antigen receptor as claimed in claim 2, the carrier as claimed in claim 3, or the cell as claimed in any one of claims 4 to 6, and a pharmaceutically acceptable carrier.

Images