Cotton stress inducible promoter pGhERF107, preparation method and application thereof

Abstract

The application discloses a cotton stress inducible promoter pGhERF107 and a preparation method and application thereof, and relates to the technical field of cotton genetic engineering. The promoter pGhERF107 has a nucleotide sequence as shown in SEQ ID NO. 1. The pGhERF107::GUS promoter pGhERF107::DR26 vector constructed in the application is transformed into cotton, non-biological stress treatment is carried out on the transgenic cotton, GUS expression activity analysis is observed, it is found that the pGhERF107::GUS multiple transgenic lines can enhance the expression of GUS and DR26 under stress treatment, and the pGhERF107::GUS can be applied to the genetic breeding practice of cotton stress resistance, so that the tolerance and resistance of cotton are improved, and the application has important significance.

Description

Technical Field

[0001] This application relates to the field of cotton genetic engineering technology, specifically to a cotton stress-inducible promoter pGhERF107, its preparation method, and its application. Background Technology

[0002] Cotton is an important economic crop and oilseed crop in China, as well as a major source of natural fiber, playing a vital role in the country's national economy and national security. In agricultural production, environmental factors have a significant impact on crop yield and quality. Crops with good stress resistance can grow stably in variable environments, maintaining high levels of yield and quality. With economic and social development, cotton cultivation areas in my country have begun to shift towards arid and saline-alkali lands. Furthermore, soil salinization, water scarcity, and global warming are unavoidable problems in cotton production, thus further increasing the demands on cotton's stress resistance.

[0003] Studying crop stress resistance at the genetic level can better guide the efficient conduct of breeding work. In transgenic crop research, the promoter is a crucial factor affecting the expression efficiency of the introduced gene. Successfully applying transgenic plants to express exogenous genes with high yield and high quality requires a highly efficient promoter. Current reports primarily use the CaMV35S promoter for gene overexpression studies in cotton. During cotton growth and development, regardless of whether external stress occurs, transgenic stress-resistant crops containing the CaMV35S promoter continuously express related stress-resistant proteins. However, in environments without drought or other adverse conditions, the expression of stress-resistant genes consumes limited energy, thus hindering normal crop growth and development. Summary of the Invention

[0004] The inventors of this application have creatively disclosed a cotton stress-inducible promoter pGhERF107, its preparation method, and its application. By adding this promoter to cotton, transgenic crops can reduce or stop expressing foreign genes under non-stress conditions, thereby saving plant energy and avoiding adverse effects of foreign genes on plants (such as growth delay and abnormal development of transgenic plants). Under stress conditions, it can significantly improve the expression ability of foreign genes in crops.

[0005] Therefore, the embodiments of this application disclose at least the following technical solutions:

[0006] In a first aspect, embodiments of this application disclose a cotton stress-inducible promoter pGhERF107, wherein the promoter pGhERF107 has a nucleotide sequence as shown in SEQ ID NO.1.

[0007] Secondly, embodiments of this application disclose an expression cassette comprising a nucleotide sequence of the promoter pGhERF107 as described in the first aspect.

[0008] Thirdly, embodiments of this application disclose a recombinant vector comprising a nucleotide sequence of the promoter pGhERF107 as described in the first aspect.

[0009] Fourthly, embodiments of this application disclose a transgenic cell line comprising the recombinant vector as described in the first aspect.

[0010] Fifthly, embodiments of this application disclose a recombinant microorganism comprising the recombinant vector as described in the first aspect.

[0011] Sixthly, embodiments of this application disclose a primer pair for amplifying the inducible promoter pGhERF107 as described in the first aspect, the primer pair comprising: a forward primer as described in SEQ ID NO.2 and a reverse primer as described in SEQ ID NO.3; or

[0012] The forward primer as described in SEQ ID NO. 12 and the reverse primer as described in SEQ ID NO. 13.

[0013] In a seventh aspect, embodiments of this application disclose a method for preparing the inducible promoter pGhERF107 as described in the first aspect, comprising the following steps: using cotton whole-genome DNA as a template, performing PCR amplification using primer pairs, wherein the primer pairs include: the forward primer as described in SEQ ID NO.2 and the reverse primer as described in SEQ ID NO.3; or

[0014] The forward primer as described in SEQ ID NO. 12 and the reverse primer as described in SEQ ID NO. 13.

[0015] Eighthly, embodiments of this application disclose the application of the inducible promoter pGhERF107 as described in the first aspect to induce the target gene in the cultivation of stress-resistant cotton.

[0016] Compared with the prior art, this application has at least one of the following beneficial effects:

[0017] This application confirms the gene expression pattern using RT-PCR and discovers that the gene GhERF107 is differentially expressed under different stress conditions. The promoter sequence of the upland cotton GhERF107 gene was analyzed using the online software Plant CARE, and it was found that it contains a cis-acting element related to stress response. An inducible promoter pGhERF107 is provided for the study of exogenous gene expression induced by stress.

[0018] This application constructed the pGhERF107::GUS promoter pGhERF107::DR26 vector and transformed it into cotton. The transgenic cotton was subjected to abiotic stress treatment and the GUS expression activity was observed. It was found that multiple transgenic lines of pGhERF107::GUS could enhance GUS expression under stress treatment. This can be applied to the genetic breeding practice of cotton stress resistance, and can improve the tolerance and resistance of cotton, which is of great significance. Attached Figure Description

[0019] Figure 1 A technical roadmap for cloning and validating the GhERF107 promoter provided in this application embodiment;

[0020] Figure 2 The graph shows the expression analysis of the GhERF107 gene under different adverse conditions provided in the embodiments of this application; where CK represents normal conditions, and the adverse treatments are salt treatment, low temperature treatment, PEG treatment and ABA treatment, respectively; 0, 2, 4, 8 represent 0, 2, 4, 8 hours after treatment, respectively; A is a cotton root sample, and B is a cotton leaf sample with gene expression.

[0021] Figure 3 PCR positive detection results of nine T0 single plants (numbered pE1-pE9) of pGhERF107::GUS transgenic cotton provided in the embodiments of this application; where M: Trans5K Marker; wt: negative control;

[0022] Figure 4 The diagram shows the GUS expression of pGhERF107::GUS transgenic cotton in NaCl and mannitol treatments provided in the embodiments of this application; where A. pE2 staining results, B. pE4 staining results, C. pE5 staining results, and D. pE6 staining results.

[0023] Figure 5 The image shows a quantitative analysis of GUS in pGhERF107::GUS transgenic cotton plants provided in this application embodiment; where A: BSA standard curve (absorbance value on the x-axis, BSA concentration (μg / ml) on the y-axis); B: 4-MU standard curve (fluorescence value on the x-axis, 4-MU concentration (nM) on the y-axis); C: GUS protein activity value (x-axis: pGhERF107::GUS transgenic line; y-axis: GUS protein activity value).

[0024] Figure 6This diagram illustrates the qRT-PCR expression of the GhRD26 gene in pGhERF107::RD26 transgenic plants under stress treatment, as provided in this application embodiment. WT represents the transgenic negative control. pE-RD2, pE-RD6, pE-RD10, and pE-RD13 are four pGhERF107::RD26 transgenic cotton plants. Normal represents the control treatment, and PEG indicates the PEG treatment. Primers were RD26-RT-F: GGTTTCAAAGTCTGGGTATCG and RD26-RT-R: CTCGCTGAGTTCTGAGTCCA. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not specifically described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0026] It should be noted that the terms "first," "second," etc., in the specification, claims, and accompanying drawings of this invention are used to distinguish similar objects and are not necessarily used to describe a specific order or sequence, nor do they substantially limit the technical features thereafter. It should be understood that such data can be interchanged where appropriate so that the embodiments of the invention described herein can be implemented in orders other than those illustrated or described herein. Furthermore, the terms "comprising" and "having," and any variations thereof, are intended to cover non-exclusive inclusion; for example, a process, method, system, product, or apparatus that comprises a series of steps or units is not necessarily limited to those steps or units explicitly listed, but may include other steps or units not explicitly listed or inherent to such processes, methods, products, or apparatus.

[0027] To better understand the invention and not to limit its scope, all figures indicating amounts, percentages, and other numerical values ​​used in this application should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0028] To address the drawback of existing technologies where the expression of stress-resistance genes consumes limited energy, thus hindering normal crop growth and development, this application discloses a cotton stress-inducible promoter pGhERF107, wherein the promoter pGhERF107 has the nucleotide sequence shown in SEQ ID NO.1.

[0029] This application also discloses an expression cassette containing a nucleotide sequence of the promoter pGhERF107 as described above.

[0030] This application also discloses a recombinant vector containing a nucleotide sequence of the promoter pGhERF107 as described above.

[0031] This application also discloses a transgenic cell line comprising the recombinant vector described above.

[0032] This application also discloses a recombinant microorganism comprising the recombinant vector described above.

[0033] This application also discloses a primer pair for amplifying the inducible promoter pGhERF107 as described above, the primer pair comprising: a forward primer as described in SEQ ID NO.2 and a reverse primer as described in SEQ ID NO.3; or a forward primer as described in SEQ ID NO.12 and a reverse primer as described in SEQ ID NO.13.

[0034] The forward primer is: ggggacaagtttgtacaaaaaagcaggctcattgtccaatgatgtcaactaaatact, as shown in SEQ ID NO.2; the reverse primer is: ggggaccactttgtacaagaaagctgggtatgttaaagtttacaaggaatttgtatatg, as shown in SEQ ID NO.3; the ggggacaagtttgtacaaaaaagcaggctca in the forward primer and the ggggacaagtttgtacaaaaaagcaggctca in the reverse primer

[0035] ggggaccactttgtacaagaaagctgggta is the BP connector sequence.

[0036] The forward primer is ttgtccaatgatgtcaactaaatact, as shown in SEQ ID NO.12; the reverse primer is tgttaaagtttacaaggaatttgtatatg, as shown in SEQ ID NO.13.

[0037] This application also discloses a method for preparing the inducible promoter pGhERF107 as described above, comprising the following steps: using cotton whole genomic DNA as a template, performing PCR amplification using primer pairs, wherein the primer pairs include: the forward primer as described in SEQ ID NO.2 and the reverse primer as described in SEQ ID NO.3; or the forward primer as described in SEQ ID NO.12 and the reverse primer as described in SEQ ID NO.13.

[0038] Furthermore, this application also discloses the application of the inducible promoter pGhERF107 described above in inducing the target gene to cultivate stress-resistant cotton.

[0039] In some embodiments, the application specifically includes the following steps:

[0040] The cotton stress-inducible promoter pGhERF107 was linked into the vector to construct a recombinant expression vector;

[0041] The recombinant expression vector was transformed into Escherichia coli or Agrobacterium EHA105 strain for expression to obtain a bacterial culture containing the promoter pGhERF107 gene.

[0042] The bacterial solution is transferred into cotton cells, tissues, or organs.

[0043] In other embodiments, the target gene includes gibberellin-resistant genes, heat-resistant genes, drought-resistant genes, stress-resistant genes, salicylic acid-resistant genes, and / or trauma-resistant genes.

[0044] The following description is based on specific embodiments.

[0045] like Figure 1 The diagram shows the technical roadmap for cloning and validating the GhERF107 promoter provided in this application. This application further confirmed the gene expression pattern using RT-PCR, discovering differential expression of the GhERF107 gene under different stress conditions. Analysis of the promoter sequence of the upland cotton GhERF107 gene using the online software PlantCARE revealed the presence of a stress-responsive cis-acting element, suggesting that pGhERF107 could be applied to cotton stress resistance genetic breeding practices. Further research constructed the pGhERF107::GUS promoter vector pGhERF107::DR26 and transformed it into cotton. Abiotic stress treatment was applied to the transgenic cotton to observe GUS expression activity analysis, revealing that multiple pGhERF107::GUS transgenic lines enhanced GUS expression under stress treatment.

[0046] 1. Expression pattern analysis of GhERF107

[0047] The GhERF107 gene sequence (accession numbers are shown below) was extracted from the upland cotton genome database. Primers specific to its regions were designed for RT-PCR to verify its expression patterns under different stress conditions. The primer sequences are as follows:

[0048] GhERF107Sense: ttgtccaatgatgtcaactaaatact, as shown in SEQ ID NO.4;

[0049] GhERF107Anti: tgtttatgaaagcatcgggg, as shown in SEQ ID NO.5;

[0050] The RT-PCR procedure was as follows: Total RNA was extracted from different tissues: fibers and ovules 1-4 days before flowering from upland cotton TM-13, 5, 10, 15, and 23 DPA (days post-flowering anthesis); fibers and ovules 1-4 days before flowering from Sea Island cotton 3-79 (5, 10, 15, 17, 23, and 27 DPA); pollen, flowers, buds, leaves, ethylene-treated boll stalk abscission layer, gibberellin-treated boll stalk abscission layer, untreated boll stalk abscission layer, stems, and stems treated with Verticillium wilt. After RNA extraction, the tissues were treated with DNase I (purchased from Promega, USA). RNA integrity was detected by 1.4% (w / v) agarose gel (EtBr) electrophoresis (5V / cm). Nucleic acid concentration was determined on a Beckman DU800 spectrophotometer. RNA with a 260 / 280 ratio between 1.9 and 2.1, and a 260 / 230 ratio greater than 2.0, was used for the next step of analysis. cDNA synthesis was performed using 3 μg total RNA as a template, combined with 1 μl of 500 μg / ml oligo-dT. (15) Primers (purchased from Promega, USA), 1 μl of 10 mM dNTP, mixed with DEPC-water, total volume 12 μl; then denatured at 65 °C for 5 min and quenched on ice; then added 8 μl containing 4 μl RT buffer, 2 μl of 0.1 M dithiothreitol, and 40 units of [unclear - possibly a specific compound or product]. A mixture of Ribonuclease Inhibitor (purchased from Promega, USA) and 200 units of Superscript II RT (purchased from Invitrogen, USA) was used. The first strand was synthesized by incubating at 42°C for 1 hour (the reaction using random primers for first strand synthesis was first incubated at 25°C for 10 minutes). After the reaction, the reaction was inactivated by treating at 75°C for 15 minutes. Each cDNA sample was diluted to 300 μl and stored at -20°C for later use. The PCR reaction system (20 μl) included: 1 μl of diluted cDNA (equivalent to 10 ng of starting total RNA), 10 μl of 2×PCR Master Mix, and 200 nM primers. The PCR program was: 50°C for 2 minutes; 95°C for 10 minutes of denaturation; then 28 cycles (95°C denaturation for 15 seconds, 60°C annealing and extension for 1 minute).

[0051] RT-PCR results as follows Figure 2 As shown, GhERF107 was differentially expressed under different abiotic conditions. In the roots of upland cotton, the GhERF107 gene was expressed in all conditions except ABA treatment. In the leaves of upland cotton, GhERF107 was differentially expressed under all abiotic conditions except cold treatment.

[0052] 2. Obtaining the promoter pGhERF107 sequence and constructing the vector.

[0053] (1) Obtaining the promoter pGhERF107 sequence

[0054] The 1763 bp upstream sequence of the GhERF107 gene was obtained through genome sequencing, and its sequence is shown in SEQ ID NO.1. The 1.5 kb sequence was predicted using Plant CARE (http: / / www.dna.affrc.go.jp / PLACE / signalscan.html), a database of plant cis-regulatory elements, enhancers, and repressors. The results showed that this sequence contains a core promoter sequence (core region shown in SEQ ID NO.1) and several stress-response elements, as detailed in Table 1.

[0055] Table 1. Analysis of cis-acting elements in pGhERF107 (1763bp)

[0056] GARE-motif 1 TCTGTTG Gibberellin Response Element HSE 4 AAAAAATTTC / AGAAAATTCG Response to thermal stress MBS 2 CGGTCA / CAACTG drought-induced sequences TC-rich 2 ATTTTCTCCA / ATTTTCTTCA Participate in defense and stress response TCA-element 2 CCATCTTTTT / CAGAAAAGGA Salicylic acid response WUN-motif 1 TCATTACGAA Trauma response elements

[0057] Bioinformatics techniques were used to analyze the stress response elements in a region approximately 1500 bp upstream of the transcription start site (ATG).

[0058] The results, as shown in Table 1, indicate that the promoter sequence of the GhERF107 gene contains a variety of abiotic stress response elements, such as the drought response element MBS, the heat response element HSE, and the trauma response element WUN-motif.

[0059] Therefore, it is predicted that these promoters play an important role in responding to abiotic stress, a conclusion consistent with the findings of RT-PCR in section 2.

[0060] (2) PCR amplification of the promoter pGhERF107 sequence

[0061] Primers with a BP adapter were designed to amplify the promoter, replacing the 35S promoter driving GUS expression on the pBI121 vector (purchased from Clontech, USA). Primer sequences are shown in SEQ ID NO. 2–3. PCR amplification was performed using the whole genome DNA of cotton Jin668 as a template.

[0062] (3) Construction of promoter pGhERF107::GUS and pGhERF107::DR26 vectors

[0063] ①TA cloning

[0064] The PCR products that tested positive by electrophoresis were ligated into the pGEM-T easy vector and then transferred to the Top 10 strains of *E. coli* via heat shock. The steps are as follows:

[0065] Table 2 TA cloning system

[0066] 2X Rapid Ligation Buffer 2.5 T4 DNA Ligase 0.5 pGEM-T easy 1 PCR products 1

[0067] The above table system was placed in a 4°C refrigerator overnight to obtain the ligation product. The ligation product was added to the Top10 bacterial culture, mixed by aspiration, and placed on ice for about 30 minutes. During this idle time, the water bath temperature was adjusted to 42°C, heat-shocked at 42°C for 90 seconds, placed on ice for 2 minutes, and then transferred to a 2 ml centrifuge tube (sterile) containing 300 μl SOC. The tube was then activated in a shaker at 37°C for 30-40 minutes.

[0068] Preparation of LB medium (AMP) + Add 200 μl of the heat shock product to the culture medium and spread it evenly. Cover the culture dish and invert it to incubate at 37°C for 10-12 hours. Then select single clones and culture them in liquid LB medium (AMP). + In a container, shake at 37°C until the bacterial solution becomes turbid, then store in a refrigerator at 4°C.

[0069] Six positive monoclonal bacterial culture samples were selected and sent to the company for sequencing. The sequencing results were compared using the software ClustalX 1.83. The bacterial samples that did not produce sequence mutations were activated and plasmids were extracted.

[0070] Table 3 LB medium (1L system)

[0071] trypsin 10g Yeast extract 5g NaCl 10g pH value 7.0

[0072] ②BP reaction

[0073] The extracted plasmid was used as a template for PCR amplification, and the result was confirmed positive by electrophoresis. The BP reaction mixture (5 μl) is as follows:

[0074] Table 4 BP Reaction System

[0075] <![CDATA[ddH2O]]> 2.5 PCR products 1 Carrier PDONR-zeo 1 BP enzyme Enzyme 0.5

[0076] The BP reaction system was placed at room temperature for 4 hours, and the above heat shock steps were repeated. The reaction mixture was then cultured in LB medium (ZEO). + Single clones were screened out, positive bacterial cultures were preserved, and plasmids were extracted.

[0077] ③LR reaction

[0078] The plasmid extracted in the previous step was used for the LR reaction. The following system (5 μl) was incubated at room temperature for 4 h, followed by heat shock (as above), and plated (using a Speech gel). + Using LB medium (other methods are the same as above), select single clones and perform positive detection, extract plasmids and preserve bacterial culture.

[0079] Table 5 LR reaction system

[0080] <![CDATA[ddH2O]]> 2.5 plasmid extracted in the previous step 1 carrier PKGWFS7 1 LR enzyme 0.5

[0081] ④ Electro-rotation

[0082] The plasmid was electroporated into Agrobacterium EHA105 strain using an electroporator. The steps are as follows:

[0083] 1. Sterilize pipette tips and centrifuge tubes;

[0084] 2. Turn on the electric converter to preheat and adjust the voltage to 1800V;

[0085] 3. Clean the electric transfer cup with ddH2O and alcohol in sequence, and sterilize it under ultraviolet light for 10 minutes, then pre-cool it;

[0086] 4. Mix 2 μL each of competent Agrobacterium EHA105 strain and previously extracted plasmid, mix thoroughly with a sterile pipette tip, and then add to the gap of the electroporation cup.

[0087] 5. Place the electro-rotator cup into the instrument and double-click "PLUSE" to complete the electro-rotation;

[0088] Add 400 μL of SOC to an electric rotary vat and mix thoroughly. Transfer the well-mixed bacterial solution to a 2 mL sterile centrifuge tube. Activate the bacterial solution by shaking at 28°C for 1 hour. Then, transfer 100 μL to a spreader (using a Spreader). + LB medium); invert the petri dish and incubate at 28℃ for 2 days, pick single clones, shake the bacteria, detect positive results, and store in glycerol at -78℃ for later use.

[0089] 3. Genetic transformation of pGhERF107::GUS and pGhERF107::DR26 vectors in cotton

[0090] The donor material was the upland cotton variety (Jin668). Plump and uniform Jin668 seeds were selected, the seed coat was removed, and the seeds were sterilized with 0.1% mercuric chloride solution for 7-10 minutes, shaking continuously during the process. The seeds were then rinsed three times with sterile water for 3 minutes each time, and placed on the surface of MS medium. After incubating in the dark at 30℃ for 1 day, the seedlings were propped up and incubated in the dark for another 4-5 days.

[0091] Agrobacterium EHA105 strain containing the pGhERF107::GUS and pGhERF107::DR26 vectors was inoculated into 2 ml of LB medium containing 100 mg / L spectinomycin and 100 mg / L kanamycin, and cultured at 28°C with shaking for 1 day. The activated bacterial solution was then inoculated into 20 ml of fresh LB medium containing 100 mg / L spectinomycin and 100 mg / L kanamycin, respectively, and cultured at 28°C with shaking overnight. 1 ml of the turbid bacterial solution was transferred to a 2 ml sterile centrifuge tube, centrifuged at 8000 rpm for 30 s to collect the bacterial cells, and the cells were resuspended in 20 ml of MGL medium containing 50 mg / L acetylsyringone (AS) (specific components are described later), and cultured at 28°C with shaking for 30 min for infection of hypocotyls.

[0092] The specific steps of Agrobacterium-mediated transformation of cotton hypocotyls are as follows:

[0093] In a laminar flow hood, 30 sterile seedlings were taken, and hypocotyls were cut into 0.7 cm segments on sterile filter paper and inoculated into 50 ml sterile Erlenmeyer flasks. The segments were then added to activated Agrobacterium tumefaciens EHA105 bacterial suspension containing the target vectors pK2GW7-GhCIPK6D1 and pRGEB32-7-GhCIPK6D1, respectively, and inoculated for 10 min, shaking several times during this period. The bacterial suspension was then discarded, and the hypocotyls were blotted dry on sterile filter paper. After being placed in the laminar flow hood and blown for 10–15 min, they were inoculated into antibiotic-free 2,4-D induction medium (specific components described later). The cells were co-cultured at 21°C in the dark for 36–48 h. After co-culture, hypocotyl segments were inoculated into 2,4-D induction medium containing kanamycin (100 mg / L) and cephalosporin (100 mg / L) (specific components are described later) and cultured at 28°C under low light. Subculture was performed monthly until embryogenic callus appeared. Embryogenic callus was then successively inoculated into embryo differentiation medium (specific components are described later) and subcultured monthly until somatic embryos matured. Mature cotyledonary embryos were inoculated into rooting medium (specific components are described later) to germinate until complete plants were obtained.

[0094] The culture formula used in this embodiment:

[0095] MGL medium: tryptone 5 g / L, NaCl 5 g / L, MgSO4·7H2O 0.1 g / L, KH2PO4 0.25 g / L, mannitol 5 g / L, glycine 1 g / L, and distilled water to make up to 1 L.

[0096] 2,4-D induction medium: MS medium was used as the basal medium, with the addition of 0.1 mg / L 2,4-D, 0.1 mg / L cytokinin (KT), 30 g / L glucose, and 2.5 g / L Phytagel, and the volume was supplemented with distilled water to 1 L. The pH was adjusted to 5.9.

[0097] Embryo differentiation medium: MS medium was used as the basal medium, with the following added: 1.9 g / L KNO3, 0.1 mg / L KT, 30 g / L glucose, 1.0 g / L Gln, 0.5 g / L Asn, and 2.5 g / L Phytagel. The volume was then adjusted to 1 L with distilled water. The pH was adjusted to 5.9.

[0098] Rooting medium: Use 1 / 2 MS as the basal medium, add 15 g / L glucose and 2.5 g / L Phytagel, and make up to 1 L with distilled water. Adjust the pH to 5.9.

[0099] The basic MS medium formulation described above is as follows: macroelements (KNO3 1.9 g / L, NH4NO3 1.65 g / L, KH2PO4 0.17 g / L, MgSO4·7H2O 0.37 g / L, CaCl2·2H2O 0.44 g / L), microelements (KI 0.83 mg / L, H3BO3 6.2 mg / L, MnSO4·4H2O 22.3 mg / L, ZnSO4·7H2O 8.6 mg / L, Na2MoO4·2H2O 0.25 mg / L, CuSO4·5H2O 0.025 mg / L, CoCl2 0.025 mg / L), and iron salts (Na2·EDTA). 37.3 mg / L, FeSO4·7H2O 27.8 mg / L), organic components (inositol 100 mg / L, Gly 2 mg / L, VB1 0.1 mg / L, VB6 0.5 mg / L, VB5 0.5 mg / L). 4. PCR positive identification of transgenic plants.

[0100] Genomic DNA was extracted from the young leaves of the transgenic plants prepared in step 3 above. DNA extraction was performed using the Plant Genomic DNA Extraction Kit from Tiangen Biotech (Beijing) Technology Co., Ltd. (see the kit's instruction manual for specific operating procedures). PCR amplification was performed using the primer pair: forward primer NPTII-F: gcttgggtggagaggctatt, as shown in SEQ ID NO. 6; reverse primer NPTII-R: cgataccgtaaagcacgaggaa, as shown in SEQ ID NO. 7. The product length was 700 bp. PCR detection of the corresponding T-DNA insertion was performed using NPTII-R and NPTII-S. The PCR reaction conditions were: 94℃ pre-denaturation for 5 min; 28 cycles of 94℃ for 30 sec, 58℃ for 30 sec, and 72℃ for 1 min; extension at 72℃ for 5 min.

[0101] Among them, the PCR positive detection results of 9 T0 single plants (numbered pE1-pE9) of pGhERF107::GUS transgenic cotton are shown in the figure. Figure 3 .

[0102] 5. GUS staining of cotton transgenic pGhERF107 under stress

[0103] (1) GUS staining of T1 transgenic cotton

[0104] Prepare a kanamycin-based aseptic seedling selection medium (aseptic seedling medium + 200 mg / L kanamycin). Disinfect seeds with 84 disinfectant and plant seedlings. Two days later, transplant seedlings. On the 5th day, observe the growth of lateral roots. If lateral roots are present, the test result is positive, and the corresponding plant can be subjected to stress treatment. If no lateral roots are present, the plant is negative and can be used as a negative control for stress treatment. On the 6th day after transplanting, transfer positive and negative seedlings to the prepared stress culture medium (aseptic seedling medium + NaCl at the appropriate concentration / mannitol), insert the roots into the stress culture medium, and continue to incubate in a 28℃ constant temperature dark incubator for 2 days.

[0105] The sterile seedlings subjected to the above-mentioned stress treatment were removed and cut into three parts: roots, hypocotyls, and leaves. Lateral roots were retained, and the hypocotyls were cut into three segments, each 2-3 mm long. Leaves were protected from bending and mechanical damage. The treatment groups (NaCl, mannitol, and ABA treatment) were placed into different centrifuge tubes, labeled, and an appropriate amount of GUS staining solution was added to immerse the material. The tubes were then placed in a 37°C dark chamber for 12-14 hours. The GUS histochemical localization method was performed according to the method of Jefferson et al. (Gus fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J, 1987, 6: 3901-3907). Different organs and tissues of the transgenic plants were placed in GUS staining solution and incubated at 37°C for 2 hours to overnight. After decolorization with 70% alcohol, the tissues were fixed with FAA and stored. GUS gene expression was observed with the naked eye or under a stereomicroscope, and then photographed under a stereomicroscope (Leika MZFLⅢ). The GUS staining solution (100 mL) consists of the following components: x-gluc 90 mg, chloramphenicol 10.0 mg, 0.1 M sodium phosphate buffer (pH 7.0) 50 mL, methanol 20% (v / v), and sterile water to a final volume of 100 mL; tissue fixative (FAA): 70% ethanol 90 mL, 5% acetic acid 5 mL, 38% formaldehyde 5 mL.

[0106] The promoter pGhERF107 was fused with a GUS fusion vector and cotton was transformed. The GUS histochemical staining results are as follows: Figure 4 As shown, the results indicate that the active sites or locations of GUS on the leaves appear as blue or blue spots. In cotton transgenic pGhERF107::GUS that has not been treated with stress, the staining effect is not obvious or there is no staining effect. Plants treated with stress have a more obvious staining effect.

[0107] 6. Quantitative analysis of GUS in pGhERF107::GUS transgenic cotton plants

[0108] (1) Extraction of total GUS protein

[0109] Total GUS protein was extracted from cotton leaves in the treatment and control groups, following these steps:

[0110] (a) Solution preparation and preparation. Prepare GUS extraction buffer according to the table below, prepare two insulated containers and fill them with an appropriate amount of liquid nitrogen, prepare multiple grinding media and grinding rods and clean and dry them with paper towels, prepare a 0.1g balance, 2ml centrifuge tubes, pipettes, distilled water, gloves, spatula, and marker pen.

[0111] Table 6 GUS Extraction Buffer (100ml system)

[0112] Potassium phosphate buffer (pH 7.0) 90ml β-mercaptoethanol 100μl Na2EDTA 0.37g glycerin 10ml PVPP-40(m / v) 2g

[0113] Note: The items glycerin and PVPP in the table above can be replaced with 100 μL of Triton-X-100.

[0114] (b) Sample grinding and sampling. Pre-cool the grinding media with liquid nitrogen. Weigh 1-2g of sterile seedling leaves into the grinding media, add an appropriate amount of liquid nitrogen, and grind the leaves, replenishing the liquid nitrogen as needed until the leaves are ground into powder. Aliquot the powder into centrifuge tubes, with each tube containing approximately 0.2g of sample. Label the tubes and store them at -80℃.

[0115] (c) Extraction of GUS protein. Add 0.5 ml of GUS extraction buffer to the centrifuge tube containing the sample, mix thoroughly, and place on ice for 30 min. Then centrifuge at 4°C and 12000 rpm for 15 min. Transfer the supernatant to a new centrifuge tube; this is the total GUS protein. Proceed directly to the next step or store at -20°C.

[0116] (2) Detection of GUS protein concentration

[0117] The concentration of GUS protein extracted in the previous step was determined using the Bradforf method, as follows:

[0118] (a) Preparation. Prepare the solutions in the following order.

[0119] Preparation of Coomassie Brilliant Blue G-250 solution: Weigh 0.05g of Coomassie Brilliant Blue G-250 powder into a 500ml bottle and dissolve it in 25ml of 90% ethanol. Add 50ml of phosphoric acid, then add distilled water to bring the volume to 500ml. Store at 4℃ protected from light; shelf life is one month.

[0120] Preparation of BSA stock solution (100μg / ml): Weigh 0.01g of BSA powder and add water to make up to 100ml (the amount of solid is small, so you can directly measure 100ml of distilled water with a graduated cylinder).

[0121] Table 7. Preparation of BSA standard solutions with different concentration gradients (2 ml system) (prepare fresh before use)

[0122]

[0123]

[0124] (b) Preparation of BSA standard curve. 200 μL of the above-mentioned BSA standard solutions at different concentration gradients were drawn into an ELISA plate, and the positions were recorded.

[0125] First, turn on the multi-functional microplate reader, then turn on the computer. Double-click to open the software, select the program starting with Abs, click editProtocls to start editing the program, set the measurement area, wavelength (595nm), and result file path, then click Set in the upper right corner to pop up the receiver. Place the microplate in the receiver and click Set again to put it into the instrument; click run-yes to start the process; record the results (absorbance value), then click close the software, and shut down the computer and the instrument.

[0126] Use Excel to fit a BSA standard curve with absorbance value on the x-axis and BSA concentration on the y-axis.

[0127] (c) Detection of GUS protein concentration in the sample. Take a 2 ml centrifuge tube, add 150 μL of distilled water, then add 10 μL of extracted total GUS protein (for the blank control group, use GUS extraction buffer instead of total GUS protein), and then add 500 μL of Coomassie Brilliant Blue G-250 solution. Mix thoroughly and let stand at room temperature for 5 minutes. Take 200 μL of each solution and add it to an ELISA plate. Measure the absorbance at 595 nm using a multi-functional ELISA reader (this can be done using the same ELISA plate as step (b)). Calculate the GUS protein concentration based on the standard curve obtained in (b).

[0128] (3) Determination of GUS protein activity

[0129] The activity of GUS protease in GUS extract was determined. The steps are as follows:

[0130] Solution preparation

[0131] Prepare the solution in the following order:

[0132] (a) Reaction termination solution (300 ml required): Weigh 21.1 g Na2CO3, dissolve in ddH2O, and bring the volume to 100 ml. Can be stored for a long time.

[0133] (b) 4-MU stock solution (1 mM): Weigh 19.8 mg of 4-MU powder and dissolve it in 100 ml of reaction termination solution. Store at 4°C protected from light. Shelf life is one month.

[0134] (c) Dilute the mother liquor in (b) by 1000 times: Take 100 μL of 4-MU mother liquor (1 mM) and add it to 100 ml of reaction termination solution.

[0135] (d) Preparation of 4-MU standard solution.

[0136] Table 8. 4-MU standard solutions of different concentration gradients (2 ml system) (prepare fresh before use)

[0137]

[0138]

[0139] (e) 4-MUG solution (40mM): Weigh 1.408g of 4-MUG powder and dissolve it in 100ml of extraction buffer. Prepare fresh before use.

[0140] Protein activity assay

[0141] Principle: GUS protein is an enzyme that, under suitable conditions, catalyzes the breakdown of 4-MUG into 4-MU. 4-MUG is the substrate of the GUS protease, and 4-MU is the product of the catalytic reaction. Measuring protease activity essentially measures the amount of product produced by a unit amount of enzyme protein per unit time. The formula is as follows:

[0142] GUS protease activity = Amount of reaction product (4-MU) / (Reaction time × Protein content)

[0143] Multiplying both the numerator and denominator of the above equation by the volume V of the reaction solution system, we get:

[0144] Formula 1: GUS protease activity = Concentration of reaction product (4-MU) / (Reaction time × Protein concentration)

[0145] The protein concentration is the GUS protein concentration determined in step (2), and the concentration of the reaction product 4-MU is determined as follows:

[0146] (1) Add 400 μL of GUS protein extraction buffer and 10 μL of 4-MUG solution to a 2 ml centrifuge tube and preheat in a 37°C incubator for 20 min.

[0147] (2) Add 8 μL of the total GUS protein obtained in 2.2.8.1 to a preheated centrifuge tube, mix thoroughly, centrifuge briefly (using the centrifuge used when preparing the PCR system), and place in a 37°C incubator for 30 min (time accurately).

[0148] (3) Add 1580 μL of reaction stop solution and mix well. Use a multi-functional microplate reader (FI program) to detect the absorbance under emission light of 365 nm and excitation light of 455 nm. A 4-MU standard curve can be prepared simultaneously: detect the absorbance of 4-MU standard solutions at different concentration gradients under this program.

[0149] (5) Calculate the concentration of 4-MU in the reaction system based on the 4-MU standard curve, and obtain the activity of GUS protein according to Formula 1.

[0150] The calculated activity of the GUS protein is as follows: Figure 5 As shown.

[0151] 7. qRT-PCR expression of the GhRD26 gene in pGhERF107::RD26 transgenic plants under stress treatment.

[0152] After obtaining the pGhERF107::RD26 transgenic line, plants from different lines were subjected to normal culture and PEG treatment, respectively. Leaves were collected after treatment for target gene expression analysis. The expression levels and gene expression patterns of the cotton transgenic plants were detected using qRT-PCR.

[0153] RNA was extracted using a Tiangen reagent kit (Tiangen Biotech, DP411). RNA quality was assessed by agarose gel electrophoresis, and RNA concentration was measured using a NanoDrop 2000 micro-spectrophotometer. 3 μg of RNA was reverse transcribed into cDNA using PROMEGA reagents. In a 0.5 ml enzyme-free centrifuge tube, 3 μg RNA and 1 μL ligo(dT) were added, and DEPC water was added to a final volume of 15 μl. The mixture was incubated at 70°C for 5 min on a reverse centrifuge, followed by 10 min on ice. Then, 5 μl of 5×MLV buffer, 1.25 μl of 10 mmol / L dNTPs, 1 μl of Rnasin (40 U), 1 μl of M-MLV RTase (200 U), and 1.75 μl of RNase-free H2O were added, for a total volume of 25 μl. After mixing, place the mixture in a reverse transcription apparatus and incubate at 42℃ for 60 min, then at 70℃ for 15 min. The resulting cDNA is diluted to 250 μl with ddH2O and can be stored at -20℃. Then, dilute the cDNA 10-fold as a template for subsequent expression analysis.

[0154] The qRT-PCR reaction system consisted of 15 μl of the following components: 7.5 μl cDNA template, 7 μl SybrGreen-mix (BIO-RAD), and 0.25 μl forward and reverse primers. After mixing, the mixture was placed on an ABI Prism 7500 system. The program was set as follows: Stage 1, 95℃ for 30 s, 1 cycle; Stage 2, 95℃ for 5 s + 60℃ for 35 s, 40 cycles. GhUBQ7 was used as an internal control gene (GenBank accession number DQ116411). Results were exported using Excel.

[0155] For the qRT-PCR reaction, 0.25 μl of forward and reverse primers were used:

[0156] RD26-QRT-F:tcaaagtctgggtatcggga, as shown in SEQ ID NO.8;

[0157] RD26-QRT-R:gacaaagtgtaggcggcatt, as shown in SEQ ID NO.9.

[0158] For the qRT-PCR reaction of the internal reference gene UBQ7, the forward and reverse primers are:

[0159] UBQ7-F: gaaggcattccacctgaccaac, as shown in SEQ ID NO.10;

[0160] UBQ7-R: cttgaccttcttcttcttgtgcttg, as shown in SEQ ID NO.11.

[0161] The results are as follows Figure 6 As shown, the GhRD26 gene in pGhERF107::RD26 transgenic plants is expressed at a higher level under stress treatment.

[0162] The above description is merely a preferred embodiment of this application, but the scope of protection of this application is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application.

Claims

1. A cotton stress-induced promoter pGhERF107, wherein, The promoter pGhERF107 has the nucleotide sequence shown in SEQ ID NO.

1.

2. An expression cassette comprising the nucleotide sequence of the promoter pGhERF107 as described in claim 1.

3. A recombinant vector comprising the nucleotide sequence of the promoter pGhERF107 as described in claim 1.

4. A transgenic cell line comprising the recombinant vector as described in claim 3.

5. A recombinant microorganism comprising the recombinant vector as described in claim 3.

6. A primer pair for amplifying the inducible promoter pGhERF107 as described in claim 1, said primer pair comprising: The forward primer as described in SEQ ID NO.2 and the reverse primer as described in SEQ ID NO.3; or The forward primer as described in SEQ ID NO. 12 and the reverse primer as described in SEQ ID NO.

13.

7. A method for preparing the inducible promoter pGhERF107 as described in claim 1, comprising the following steps: using cotton whole-genome DNA as a template, performing PCR amplification using primer pairs, wherein the primer pairs comprise: The forward primer as described in SEQ ID NO.2 and the reverse primer as described in SEQ ID NO.3; or The forward primer as described in SEQ ID NO. 12 and the reverse primer as described in SEQ ID NO.

13.

8. The application of the inducible promoter pGhERF107 as described in claim 1 in inducing the target gene to be used in the cultivation of stress-resistant cotton, wherein the target gene is a stress-resistant gene.

9. The application according to claim 8 specifically includes the following steps: The cotton stress-inducible promoter pGhERF107 described in claim 1 was linked into the vector to construct a recombinant expression vector; The recombinant expression vector was transformed into Agrobacterium EHA105 strain for expression, and a bacterial culture containing the promoter pGhERF107 was obtained. The bacterial solution is transferred into cotton cells, tissues, or organs.

10. The application according to claim 9, wherein the stress resistance gene includes gibberellin-resistant stress resistance gene, heat-resistant stress resistance gene, drought-resistant stress resistance gene, stress-resistant stress resistance gene, salicylic acid-resistant stress resistance gene and / or trauma-resistant stress resistance gene.

Images