Application of plant protein nifu2 in multi-pathway prevention and control of viruses

Abstract

The application belongs to the field of genetic engineering, and relates to plant chloroplast protein Nifu2, in particular to application of the plant protein Nifu2 in multi-pathway prevention and control of viruses. The application provides application of the plant protein Nifu2 in multi-pathway prevention and control of viruses, and solves the technical problem of economic loss caused by cucumber green mottle mosaic virus (CGMMV) infection in various crops and quality reduction of fruits in the prior art. The amino acid sequence of the plant protein Nifu2 is shown in SEQ ID No. 2. Nifu2 is involved in the infection process of the cucumber green mottle mosaic virus, and is related to the plant hormone abscisic acid. After exogenous spraying of ABA, the plant defense deficiency caused by the absence of Nifu2 can be compensated. The application first identifies the resistance of Nifu2 to CGMMV, which is conducive to subsequent utilization of genetic transformation technology for virus resistance regulation.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and relates to plant chloroplast protein Nifu2, particularly the application of plant protein Nifu2 in the prevention and control of viruses through multiple pathways. Background Technology

[0002] Cucumber green mottle mosaic virus (CGMMV) was first discovered and reported in the UK in 1935, and subsequently spread worldwide (Ainsworth, 1935). It is currently an important seed-borne virus that seriously harms cucurbitaceous crops (Dombrovsky). et al. (2017). CGMMV belongs to the family Cladoviridae ( Virgaviridae Tobacco mosaic virus ( ) Tobamovirus CGMMV is a positive-sense single-stranded RNA virus. It primarily infects cucurbitaceous plants such as gourd, pumpkin, loofah, bottle gourd, watermelon, cucumber, and melon, and can also infect the model plant, *Nicotiana benthamiana*. CGMMV infection causes symptoms such as yellow spots, mosaic patterns, chlorosis, and blistering on the leaves. Some plants may develop green protrusions, making the leaf surface uneven. Plant growth is slow or stunted, and in severe cases, it can lead to infertility. This affects fruit quality and causes significant economic losses.

[0003] The plant hormone abscisic acid (ABA) plays a crucial role in plant biotic and abiotic stress and is also involved in the regulation of various viruses in plants. ABA treatment can induce callose accumulation on plasmodesmata, inhibiting the intercellular movement of various viruses, such as Tobacco mosaic virus (TMV) (Whenham et al., 1985), Tobacco necrosis virus (TNV) (Iriti and Faoro, 2008), Bamboo mosaic virus (BMV) (Alazem et al., 2014), and Soybean mosaic virus (SMV) (Li et al., 2012). ABA can also inhibit the jasmonic acid pathway and regulate reactive oxygen species levels, promoting the infection of rice black-streaked dwarf virus (RBSDV) in rice (Xie et al., 2018).

[0004] A growing body of research indicates that plant endogenous proteins play a role in regulating viral infection. Commonly used methods include virus-mediated gene silencing, transient gene expression, Agrobacterium-mediated genetic transformation, and CRISPR / Cas9-mediated gene knockout. After gene mutation, the mutated plant material is inoculated with the virus, and the effect of the gene mutation on viral accumulation is detected using qPCR and Western blot. (Reference: Touraine) et al. , 2004; Yabe et al. In 2004, it was disclosed that knocking out Nifu2 in Arabidopsis thaliana resulted in stunted growth, accelerated water loss, and a decrease in ABA levels (Berger's Law). et al. (2020). The role of Nifu2 in crops and its role in cultivating plants with superior resistance to viral infections are the technical problems that our research group aims to solve. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention proposes the application of plant protein Nifu2 in multi-pathway virus control, solving the technical problem in the prior art where cucumber green mottle mosaic virus infects multiple crops, causing fruit quality decline and economic losses.

[0006] The technical solution of this invention is implemented as follows: Application of plant protein Nifu2 in virus prevention and control.

[0007] The application of abscisic acid regulation pathway in virus control, whereby the regulation of abscisic acid pathway is achieved through plant protein Nifu2 or plant hormones.

[0008] The plant hormone mentioned above is abscisic acid.

[0009] The application of interaction with the MET domain of cucumber green mottle mosaic virus in virus control, wherein the interaction with the MET domain of cucumber green mottle mosaic virus is achieved through the plant protein Nifu2.

[0010] The amino acid sequence of the plant protein Nifu2 is shown in SEQ ID No. 2.

[0011] The virus mentioned above is the cucumber green mottle mosaic virus.

[0012] Application of expression vectors containing the plant protein Nifu2 gene in the control of cucumber green mottle mosaic virus.

[0013] The nucleotide sequence of the plant protein Nifu2 gene is shown in SEQ ID No. 1.

[0014] The above application involves the following steps: using the plant protein Nifu2 gene as the target gene, ligating it with an intermediate vector to obtain a transient expression vector containing the plant protein Nifu2 gene, and then transiently expressing it in the leaves of the plants to be controlled, which can improve the resistance of the plants to cucumber green mottle mosaic virus.

[0015] The present invention has the following beneficial effects: 1. This application is the first to screen a plant iron-sulfur transporter, Nifu2, which interacts with CGMMV MET, using a yeast library. It hypothesizes and verifies that the interaction between MET and Nifu2 affects the ABA synthesis pathway, thereby regulating viral pathogenicity. Furthermore, using TRV-mediated Nifu2 silencing in plants, it was found that Nifu2 can effectively inhibit viral infection, and overexpression of the Nifu2 gene can achieve viral control. This application is also the first to identify Nifu2 resistance to CGMMV, which is beneficial for subsequent antiviral regulation using genetic transformation technology.

[0016] 2. This application utilizes exogenous ABA spraying to control virus accumulation caused by Nifu2 deficiency, verifying that Nifu2 controls virus infection by regulating ABA, which is beneficial for subsequent use of plant hormone ABA to control viruses. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is a full-length nucleic acid electrophoresis image of Nifu2.

[0019] Figure 2 The figures show the results of Nifu2 silencing promoting CGMMV infection. A shows the plant and leaf symptoms of plants inoculated with CGMMV after Nifu2 silencing; B shows the silencing efficiency of Nifu2; C shows the effect of Nifu2 silencing on CGMMV accumulation as detected by Western blot; and D shows the effect of Nifu2 silencing on CGMMV accumulation as detected by qPCR.

[0020] Figure 3This diagram illustrates the plant defense deficiencies caused by ABA remediation of Nifu2 silencing. A shows the plant and leaf symptoms of CGMMV accumulation after ABA spraying following Nifu2 silencing; B shows the effect of ABA spraying after Nifu2 silencing on CGMMV accumulation as detected by Western blot; C shows the effect of ABA spraying after Nifu2 silencing on Nifu2 silencing efficiency; D shows the effect of ABA spraying after Nifu2 silencing on endogenous ABA1 expression in plants; and E shows the effect of ABA spraying after Nifu2 silencing on CGMMV accumulation as detected by qPCR.

[0021] Figure 4 The diagram shows the MET interaction between NbNifu2 and the CGMMV 129K protein domain. A shows the MET interaction between Nifu2 and the CGMMV 129K domain verified by yeast; B shows the MET interaction between Nifu2 and the CGMMV 129K domain verified by COIP; and C shows the MET interaction between Nifu2 and the CGMMV 129K domain verified by BiFC.

[0022] Figure 5 The figure shows the effect of Nifu2 overexpression on CGMMV infection. Detailed Implementation

[0023] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0024] Example 1: Cloning of the Nifu2 gene in Nicotiana benthamiana I. Total RNA extraction from Nicotiana benthamiana 1) Using a punch, take 0.2 g of *Burmese tobacco* leaves into a 2 ml Eppendorf (EP) tube, quickly freeze in liquid nitrogen, and then rapidly grind by shaking; 2) After thorough grinding, add 1.5 ml of Trizol to the tissue powder, shake to mix, incubate on ice for 5 min, and centrifuge at 13,200 rpm for 5 min at 4°C; 3) Take the supernatant into a 2 ml EP tube, add 1 / 5 volume of chloroform, shake vigorously for 30 s, incubate on ice for 5 min, and centrifuge at 13,200 rpm for 15 min at 4°C; 4) Take the upper aqueous phase into a 2 ml EP tube, add an equal volume of isopropanol, gently shake for 30 s, incubate at room temperature for 10 min, and centrifuge at 13,200 rpm for 20 min at 4°C; 5) Discard the supernatant, add 1 ml of 75% ethanol, wash the precipitate, and centrifuge at 13,200 rpm for 5 min at 4°C; 6) Repeat step 5; 7) Discard the supernatant, carefully remove the residual liquid, dry at room temperature for 5 min, and dissolve in an appropriate amount of RNase-Free H2O; 8) After measuring the RNA concentration with a UV spectrophotometer, store at -80℃ for later use.

[0025] II. Reverse transcription to synthesize cDNA The extracted RNA was reverse transcribed into cDNA, following the instructions for the Takara Prime Script™ RT Regent Kit with gDNA Eraser. first step: Add the above mixture to the EP tube, mix thoroughly, incubate at 42°C for 10 min, then on ice for 5 min; Step Two: Add the above mixture to the EP tube and mix thoroughly. Perform the reverse transcription reaction on a PCR instrument under the following conditions: The reverse transcription product can be stored at -20°C for a long time.

[0026] III. RT-PCR amplification of the Nifu2 gene Using the above cDNA template and primers designed based on the Nifu2 gene nucleic acid sequence, PCR amplification was performed. The reaction system is as follows: The primer sequences are: Forward primer (5'-3'): ATGCTATCGAATCCTTTAACTCCT; Reverse primer (5'-3'): TGTTCTCTGCTGTAAGTGGTAAC.

[0027] After mixing, perform PCR under the following conditions: After the PCR procedure, agarose gel electrophoresis was performed directly. Once the target band was obtained, it was as follows: Figure 1 As shown, following the instructions of the QIAquick Gel Extraction Kit, nucleic acid purification was performed to obtain the full-length Nifu2 gene from Nicotiana benthamiana. Example 2: The effect of TRV-mediated Nifu2 gene silencing on CGMMV infection I. Construction of the TRV-RNA2-Nifu2 VIGS vector Systematic silencing of the Nifu2 gene was performed using TRV-mediated VIGS. Using *Nicotiana benthamiana* cDNA as a template, a 300bp fragment was predicted on the gene using the SGN VIGS Tool (http: / / vigs.solgenomics.net) for TRV-mediated VIGS. Primers were designed, and the target fragment was amplified by PCR. The primer sequences are: Forward primers (5'-3'): GGGG ACAAGTTTGTACAAAAAAGCAGGCT TCATGCTATCGAATCCTTTAACTCCT; Reverse primer (5'-3'): GGGG ACCACTTTGTACAAGAAAGCTGGGT C CTGCAAAAGTTGAACTGCGG The Nifu2-VIGS fragment was ligated to the entry vector pDonr207 using Gateway cloning technology, as shown in the following system: After mixing, the ligation product was transformed into DH5α competent cells at 25℃ for 1 h; after incubation at 37℃ overnight, single clones were picked for colony PCR and sequencing. Following sequencing, plasmids were extracted for a second round of LR reaction. The pDonr207 cell containing the target fragment was reacted with the treated expression vector in the following system: After mixing, the above ligation product was transformed into DH5α at 25℃ for 1 h; after incubation at 37℃ overnight, single clones were picked for colony PCR and plasmids were extracted.

[0028] II. Identification of silencing efficiency in Nifu2-silenced plants TRV2-Nifu2 and TRV1 were co-injected into Nicotiana benthamiana. After 10 days of Nifu2 silencing, the silencing efficiency was detected by RT-qPCR.

[0029] Add the above reagents sequentially to RNase-free EP tubes, mix well, aliquot into 384-well quantitative plates, and perform the reaction in a real-time quantitative PCR instrument: pre-denaturation at 95℃ for 3 min; 94℃ for 15 s, 60℃ for 15 s, and 72℃ for 15 s, for 40 cycles.

[0030] The result is Figure 2 According to B, Nifu2 achieves a silencing efficiency of 98% after undergoing VIGS.

[0031] The UBC quantitative primer sequences are as follows: Forward primer (5'-3'): TTTCGGTCCTGATGATACTCCC; Reverse primer (5'-3'): CACAGAGCAAAGACTGGATTGA The Nifu2 quantitative primer sequence is as follows: Forward primer (5'-3'): AAACTCCAAGGAGCATGTGG; Reverse primer (5'-3'): TGCGGCTATAGCTGGAATTT III. The Influence of Nifu2 Silencing and Transient Expression on CGMMV Infection After determining the silencing efficiency of Nifu2, plants that were silenced for 10 dpi were inoculated with CGMMV, and the viral accumulation was detected by RT-qPCR 7 days after inoculation.

[0032] Depend on Figure 2 As can be seen from C, Nifu2 silencing can effectively promote the enhancement of CGMMV CP transcription levels, that is, promote CGMMV infection.

[0033] The CGMMV CP quantitative primer sequences are as follows: Forward primer (5'-3'): ACAAGGTACCGCTTTCCAGA; Reverse primer (5'-3'): TACGACAGAGGGTAACG Western blot was used to detect changes in CGMMV virus accumulation. The total protein extraction method of Nicotiana benthamiana was as follows: Select an appropriate amount of Nicotiana benthamiana leaf tissue of the same area, quick freeze in liquid nitrogen and grind; lyse with protein tissue lysis buffer (100 mM Tris-HCl pH 8.8; 60% SDS; 2% β-mercaptoethanol), stand on ice for 30 min; centrifuge at 13200 rmp 4℃ for 10 min, collect the supernatant; add 5 × loading buffer, denature at 100℃ for 10 min. Take equal volumes of denatured protein samples and perform SDS-PAGE vertical electrophoresis at 80 V for 30 min, then adjust the voltage to 120 V for 1.5 h; perform semi-dry transfer at 300 mA for 25 min; add an appropriate amount of blocking buffer (5% skim milk) to block the NC membrane and incubate at room temperature for 1 h; add anti-CGMMV CP primary antibody dilution buffer and incubate at room temperature for 1-2 h; use goat anti-rabbit antibody as the secondary antibody and incubate at room temperature for 1-2 h; finally, develop the color with ECL chromogenic buffer. Results are as follows: Figure 2 As shown in C, by Figure 2 D indicates that Nifu2 silencing can effectively increase the accumulation of CGMMV CP protein, meaning that Nifu2 silencing promotes CGMMV infection.

[0034] A transient expression vector, Nifu2-GFP, for the NbNifu2 gene was constructed. Plants transiently overexpressing Nifu2 were inoculated with CGMMV, and the viral accumulation was detected by Western blot 7 days after inoculation. Figure 5 The results showed that overexpression of Nifu2-GFP reduced the accumulation of CGMMVCP, indicating that Nifu2 overexpression can effectively inhibit CGMMV infection.

[0035] Example 3: Plant defense defects caused by ABA-assisted Nifu2 silencing Exogenous spraying of 100 μM ABA on Nifu2 plants that had been silenced for 9 days, followed by inoculation with CGMMV the next day, and spraying with ABA again two days later, with 0.2% ethanol as a control; the time of disease onset was observed and recorded, and virus accumulation was detected by qPCR and Western blot 7 days after inoculation. Results are as follows. Figure 3 As shown, by Figure 3 A indicates that after Nifu2 was silenced, ABA and its control ethanol were sprayed and then inoculated with CGMMV, resulting in CGMMV infection symptoms on the plants and leaves. Figure 3 B indicates that spraying ABA or ethanol has no effect on the silencing efficiency of Nifu2, and Nifu2 can be effectively silenced. Figure 3C indicates that the expression of ABA1 in TRV:Nifu2 decreased significantly, indicating that Nifu2 silencing reduced the content of the hormone ABA in the plant. However, after ABA spraying, the expression of ABA1 in both TRV:00 and TRV:Nifu2 increased, indicating that the absence of ABA after spraying increased the content of ABA in the plant. Figure 3 D and 3E show that TRV:Nifu2 can effectively promote CGMMV infection, but compared with the control, spraying TRV:Nifu2 with ABA significantly inhibits CGMMV infection, indicating that the application of ABA can compensate for the defense deficiency caused by Nifu2 silencing.

[0036] Example 4: Binding mechanism of Nifu2 and CGMMV virus I. Yeast verification of the interaction between Nifu2 and the MET domain AD-Nifu2, AD-CsNifu2, BK-MET, BK-IR, and BK-HEL were constructed and yeast two-hybrids were performed. Figure 4 A indicates that Nifu2 interacts with the MET domain of the 129K protein.

[0037] Primer: ADNifu2F:ATCGAATTCATGCTATCGAATCCTTTAACTCCT ADNifu2R:TCAGGATCCCTACTGCAAAAGTTGAACTGCG BKMETF: ATCGAATTCATGGCAAACATTAATGAACA BKMETR: TCAGGATCCTTACTCGATCTGTACCTTCCT II. BiFC Verification of Nifu2 and MET Interaction Vectors pYFPn-Nifu2, pYFPc-Nifu2, pYFPn-MET, and pYFPc-MET were constructed, transformed with Agrobacterium tumefaciens GV3101, and then used in combination of YFPn and YFPc to infiltrate Nicotiana benthamiana. After 48-72 h of infiltration, the fluorescence of the infiltrated tobacco tissue was observed under a confocal microscope. Figure 4 B indicates that Nifu2 and MET interact in the chloroplasts of plant cells.

[0038] Primers: pNC-Nifu2-F: AGTG GTCTCTGTCC AGTCCT ATGCTATCGAATCCTTTAACTCCT pNC-Nifu2-R: GGTCTCAGCAGACCACAAGT CTGCAAAAGTTGAACTGCGG pNC-MET-F: AGTG GTCTCTGTCC AGTCCTATGGCAAACA TTAATGAA pNC-MET-R:GGTCTCAGCAGACCACAAGTCTCGATCTGT ACCTTCCT III. COIP Verification of Nifu2 and MET Interaction The vectors Nifu2-GFP and MET-flag were constructed, and Agrobacterium GV3101 was electroporated. The OD of the Agrobacterium culture was adjusted using transient transfection buffer. 600 =1.0, mixed in equal volumes and injected with fumes Benedict's flue gas. Samples were taken 3 days later for subsequent CoIP experiments. In this experiment, GFP magnetic beads from Chromotek were used to enrich interacting proteins, followed by Western blotting to verify the interaction results. Figure 4 C indicates that Nifu2 and MET interact within the plant.

[0039] Primers: pNC-Nifu2-F: AGTG GTCTCTGTCC AGTCCT ATGCTATCGAATCCTTTAACTCCT pNC-Nifu2-R:GGTCTCAGCAGACCACAAGT CTGCAAAAGTTGAACTGCGG MET-flag-F: AA CTGCAGATGGCAAACATTAATGAACA MET-flag-R:CGGGATCCTTACTCGATCTGTACCTTCCT We determined the in vitro and in vivo interaction mechanism between Nifu2 and CGMMV virus in plant cells. The plant chloroplast protein Nifu2 participates in plant antiviral processes through interaction with the MET domain of the CGMMV 129K protein. Silencing Nifu2 protein affects the plant's endogenous hormone ABA, and exogenous ABA supplementation effectively alleviates the defense defects caused by Nifu2 deficiency. We hypothesize that Nifu2 participates in plant antiviral processes by modulating the plant's endogenous hormone ABA.

[0040] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of the interaction between plant protein Nifu2 and cucumber green mottle mosaic virus in the control of cucumber green mottle mosaic virus, characterized by: The amino acid sequence of the plant protein Nifu2 is shown in SEQ ID No. 2.

Images