A pathogenic fusarium virus and detection primer and detection method thereof

Abstract

The present application relates to a fungal virus, in particular to a pathogenic fusarium virus and a detection primer and a detection method thereof. The present application provides a fungal virus, the accession number of which is CCTCC NO:V202295, and the name of which is Fusarium fusarivirus 1 (FuFV1). A primer for detecting the fungal virus is also provided, the nucleotide sequence of which is as follows: FuFV1-F: 5'-CTCTTATGGCAGCGTTTCGC-3', FuFV1-R: 5'-TTTTGCCTTCGTGTCAAGCG-3'. A method for detecting the fungal virus is also provided, which comprises RNA extraction of a to-be-detected sample, RT-PCR amplification and detection of an amplification product. The primer and the method of the present application are specific and have high sensitivity, and can quickly and accurately detect the fungal virus.

Description

Technical Field

[0001] This invention relates to fungal viruses, specifically to a pathogenic Fusarium virus and its detection primers and detection method. Background Technology

[0002] Tobacco is one of my country's important economic crops. In recent years, the extent of Fusarium tumefaciens infection in tobacco crops has been on the rise, becoming one of the most serious root and stem diseases in my country's major tobacco-producing areas, causing severe economic losses to tobacco production. Infected tobacco plants exhibit stunted growth above ground, with yellowing and wilting leaves progressing from the bottom up. The underground root system is underdeveloped, with brown necrosis on the taproot or lateral roots, which can lead to rotting and a white mold layer under high humidity.

[0003] Fusarium fungi can infect both plants and survive in soil, belonging to the soil-dwelling fungi family. They are diverse and widely distributed, infecting a variety of plants, including food crops, cash crops, medicinal plants, and ornamental plants, causing root rot, stem rot, flower rot, and ear rot. Fusarium fungi have a strong sporulation capacity, and their spores can be spread through multiple routes, including soil and air. They infect the vascular system of plants, damaging the vascular tissue, and are one of the most widespread and serious fungal diseases affecting plants. Fungal viruses are a class of viruses that exist within fungi and can replicate stably. These viruses are mainly distributed in filamentous fungi, including plant pathogenic fungi. Some fungal viruses alter the pathogenicity of the host plant pathogenic fungi. Studying and detecting fungal viruses carried by pathogenic fungi will lay the foundation for research on the pathogenicity and pathogenic mechanisms of pathogenic fungi. Summary of the Invention

[0004] The inventors discovered a complete fungal virus while performing transcriptome sequencing on tobacco samples from Kunming using high-throughput sequencing technology, and further isolated the fungal virus from the pathogenic Fusarium carried by infected tobacco. The complete genome of this fungal virus consists of 6,391 nucleotides and contains two ORFs: ORF1 encodes an RNA-dependent RNA polymerase (RdRp; nt 66-4571), and ORF2 encodes a hypothetical protein (nt 4450-6072). Blastp analysis showed that this fungal virus has the highest sequence identity with *Fusarium poae* fusarivirus1 of the *Alphafusarivirus* genus, with an amino acid sequence identity of 68.49% (99% coverage) for RdRp and 48.96% (88% coverage) for the hypothetical protein. According to the International Committee on Taxonomy of Viruses (ICTV) classification of *Alphafusarivirus*, this fungal virus belongs to a novel species within the *Alphafusarivirus* genus. Therefore, this fungal virus was named Fusarium fusarivirus 1 (FuFV1).

[0005] Based on the above research, the present invention provides a fungal virus, with the preservation number CCTCC NO:V202295 and the name Fusarium fusarivirus 1 (FuFV1).

[0006] To investigate the effects of the aforementioned fungal virus (FuFV1) on the pathogenicity and pathogenic mechanism of pathogenic fungi, this invention provides primers for detecting the fungal virus (FuFV1), the nucleotide sequence of which is as follows:

[0007] FuFV1-F: 5'-CTCTTATGGCAGCGTTTCGC-3',

[0008] FuFV1-R: 5'-TTTTGCCTTCGTGTCAAGCG-3'.

[0009] The present invention also provides a kit for detecting the fungal virus (FuFV1), comprising the primers FuFV1-F and FuFV1-R described above.

[0010] The kit may include liquid or powdered primers FuFV1-F and FuFV1-R.

[0011] Preferably, the kit also includes standard PCR reagents and / or kit instructions.

[0012] The conventional PCR reagents may include DNA polymerase, dNTP mixture, PCR buffer, and ultrapure water.

[0013] The present invention further provides a method for detecting the fungal virus (FuFV1), comprising the following steps:

[0014] (1) RNA was extracted from the sample to be tested and cDNA was obtained by reverse transcription;

[0015] (2) Using the cDNA as a template, PCR was performed using the primers FuFV1-F and FuFV1-R to obtain the amplification product;

[0016] (3) If the amplification product is detected, and the target fragment of 841 bp is found, then the sample to be tested contains the fungal virus.

[0017] The sample to be tested can be a plant organ, tissue, or fungus suspected of containing the fungal virus.

[0018] The fungus can be a pathogenic fungus, such as pathogenic Fusarium.

[0019] In the above method, the amplification products can be detected by electrophoresis or sequencing. The electrophoresis can be agarose gel electrophoresis.

[0020] In some embodiments of the present invention, the above method is used to detect whether Fusarium pathogens contain the virus FuFV1, comprising the following steps: extracting total RNA from Fusarium pathogens and reverse transcribing it to obtain cDNA; using the cDNA as a template, performing PCR using the above primers FuFV1-F and FuFV1-R to obtain an amplification product; detecting the amplification product by agarose gel electrophoresis, and if an 841bp band appears in the amplification product, it is determined that the Fusarium pathogens contain the fungal virus (FuFV1).

[0021] In some embodiments of the present invention, the specific steps for extracting Fusarium oxysporum RNA are as follows:

[0022] (1) Weigh 0.1g of mycelium and put it into a 1.5mL centrifuge tube. Add liquid nitrogen and quickly grind the mycelium into powder. Then add 1mL of TRNzol reagent and let it stand at room temperature for 5min.

[0023] (2) Add 16 μL of 5M NaCl and 200 μL of chloroform, vortex for 15 s, and let stand at room temperature for 3 min;

[0024] (3) Centrifuge at 4℃ and 12000rpm for 15min, take the supernatant, add an equal volume of chloroform:isoamyl alcohol (24:1) solution, and let stand at room temperature for 5min;

[0025] (4) Centrifuge at 4℃ and 12000rpm for 10min, take the supernatant, add an equal volume of isopropanol, and let stand at room temperature for 10min;

[0026] (5) Centrifuge at 4℃ and 12000rpm for 10min, discard the supernatant, and add 1mL of 75% ethanol to wash the precipitate;

[0027] (6) Centrifuge at 4℃, 1000rpm for 5min, discard the supernatant, dry at room temperature, add 50-100μL RNase-freeddH2O to dissolve the RNA, and obtain the RNA solution.

[0028] In some embodiments of the present invention, the method for reverse transcription of RNA to synthesize cDNA is as follows: Add 4 μL of total RNA, 4 μL of 5×PrimeScript IV cDNA Synthesis Mix, and 2 μL of FuFV1-R to a 20 μL reaction system, and then add RNase-free ddH2O to a final volume of 20 μL. Perform the following program in a PCR instrument: 30℃ for 15 min, 42℃ for 15 min, and 70℃ for 15 min.

[0029] Preferably, the above PCR reaction system consists of 0.125 μL of Taq DNA polymerase (5 U / μL), 1.5 μL of 10×Taq buffer (20 mM), 1.5 μL of dNTP mixture (2.5 mM each), 2 μL of cDNA, 0.75 μL of FuFV1-F (10 μM), 0.75 μL of FuFV1-R (10 μM), and ddH2O added to a final volume of 25 μL.

[0030] Preferably, the above PCR reaction procedure is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min.

[0031] In summary, this invention isolated a novel Fusarium virus, FuFV1, from infected tobacco and established a method for detecting this virus. Specificity tests showed that the primers FuFV1-F and FuFV1-R provided in this invention have strong specificity for FuFV1, and a specific 841bp band can be detected in Fusarium strains infected with FuFV1. The 841bp specific band was not detected in healthy control Fusarium strains, CaPV1-containing *Anthracis aureus* strains, NoRV2-containing *Ustilago maydis* strains, and AbFV1-containing *Alternaria brassicae* strains. Figure 1 Sensitivity tests show that the method provided by this invention has high sensitivity and can detect FuFV1 in RNA samples with concentrations as low as 0.223 pg / μL. Figure 2Therefore, the primers and methods provided by this invention can be used to rapidly and accurately detect FuFV1 in samples, laying the foundation for research on the interaction mechanism between FuFV1 and pathogenic fungi and its pathogenicity to pathogenic fungi.

[0032] The patent accession information for the fungal virus (FuFV1) provided by this invention is as follows:

[0033] Preservation name: Fusarium virus FuFV1

[0034] Fusarium fusarivirus 1 (FuFV1)

[0035] Accession number: CCTCC NO:V202295

[0036] Deposit date: October 29, 2022

[0037] Depository Institution: China Center for Type Culture Collection

[0038] Address: Wuhan University, Wuhan, China Attached Figure Description

[0039] Figure 1 This is a specificity test result for the detection method of fungal virus FuFV1; where lane M is DL2000. + DNA Marker: Lane 1 is the RT-PCR product of Fusarium strain infected with FuFV1; Lane 2 is the RT-PCR product of Anthracnose strain containing CaPV1; Lane 3 is the RT-PCR product of Ulva rice strain containing NoRV2; Lane 4 is the RT-PCR product of Alternaria brassicae strain containing AbFV1; and Lane 5 is the RT-PCR product of healthy control Fusarium strain.

[0040] Figure 2 These are the sensitivity test results for the detection method of fungal virus FuFV1; lane M is DL2000. + DNA Marker: Lanes 1-7 contain RT-PCR products of RNA samples (total RNA from Fusarium strains infected with FuFV1) at concentrations of 22.3 ng / μL, 2.23 ng / μL, 0.223 ng / μL, 22.3 pg / μL, 2.23 pg / μL, 0.223 pg / μL, and 22.3 fg / μL, respectively; Lane 8 contains ddH2O. Detailed Implementation

[0041] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for explanation and illustration only and do not limit the scope of the present invention in any way.

[0042] Main reagents: TRNzol total RNA extraction reagent was purchased from Tiangen Biotech (Beijing) Co., Ltd. (PrimeScript) TM IV 1st strand cDNASynthesis Mix Reverse Transcription Kit and TaKaRa Ex The DNA Polymerase kit was purchased from TaKaRa.

[0043] Unless otherwise specified, the reagents used in the following examples are all conventional reagents in the art, commercially available or prepared according to conventional methods in the art, and are of laboratory purity. Unless otherwise specified, the experimental methods and conditions used in the following examples are conventional experimental methods and conditions in the art, and can be found in relevant experimental manuals, public literature, or manufacturer's instructions. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0044] Example 1. Discovery and isolation of fungal virus FuFV1

[0045] The inventors discovered a complete fungal virus while performing transcriptome sequencing on tobacco samples from Kunming using high-throughput sequencing technology. RT-PCR and RACE confirmed that this fungal virus was present in *Fusarium*, the pathogen isolated from infected tobacco. The complete genome of this fungal virus consists of 6,391 nucleotides and contains two ORFs: ORF1 and ORF2. ORF1 encodes an RNA-dependent RNA polymerase (RdRp; nt 66-4571), and ORF2 encodes a hypothetical protein (nt 4450-6072). Blastp analysis showed that this fungal virus has the highest sequence identity with *Fusariumpoae fusarivirus 1* of the *Alphafusarivirus* genus, with 68.49% amino acid sequence identity (99% coverage) for RdRp and 48.96% (88% coverage) for the hypothetical protein. The International Committee on Taxonomy of Viruses (ICTV) classifies Alphafusariviruses based on an amino acid sequence identity of less than 80% for RdRp. Therefore, this fungal virus is a novel virus within the Alphafusarivirus genus, named Fusarium fusarivirus 1 (FuFV1). We isolated this fungal virus and deposited it with the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: V202295, with the accession name and noted identification characteristics as: Fusarium fusarivirus FuFV1, Fusariumfusarivirus 1 (FuFV1).

[0046] Example 2. Establishment of a detection method for fungal virus FuFV1

[0047] 1. Primer design and synthesis

[0048] Based on the RdRp gene sequence of the fungal virus FuFV1, specific primer pairs were designed using Primer Primer 5.0.

[0049] The upstream primer and its sequence are as follows:

[0050] FuFV1-F: 5'-CTCTTATGGCAGCGTTTCGC-3';

[0051] The downstream primers and their sequences are as follows:

[0052] FuFV1-R: 5'-TTTTGCCTTCGTGTCAAGCG-3'.

[0053] 2. RNA extraction

[0054] (1) Weigh 0.1g of the sample to be tested (taking mycelium as an example) and put it into a 1.5mL centrifuge tube. Add liquid nitrogen and quickly grind the mycelium into powder. Add 1mL of TRNzol total RNA extraction reagent (Tiangen Biotech, Beijing) and let it stand at room temperature for 5min.

[0055] (2) Add 16 μL of 5M NaCl and 200 μL of chloroform, vortex for 15 s, and let stand at room temperature for 3 min;

[0056] (3) Centrifuge at 4℃ and 12000rpm for 15min, take the supernatant and add an equal volume of chloroform:isoamyl alcohol (24:1), and let stand at room temperature for 5min;

[0057] (4) Centrifuge at 4℃ and 12000rpm for 10min, take the supernatant, add an equal volume of isopropanol, and let stand at room temperature for 10min;

[0058] (5) Centrifuge at 4℃ and 12000rpm for 10min, discard the supernatant, and add 1mL of 75% ethanol to wash the precipitate;

[0059] (6) Centrifuge at 1000 rpm for 5 min at 4℃, discard the supernatant, dry at room temperature, and add 50-100 μL of RNase-free ddH2O to dissolve the RNA. Store the RNA solution at -80℃.

[0060] 3. RT-PCR amplification

[0061] (1) Reverse transcription to synthesize cDNA

[0062] Using PrimeScriptTM IV 1st strand cDNA Synthesis Mix Reverse Transcription Kit (TaKaRa) was used to reverse transcribe the extracted RNA (RT) according to the kit instructions to synthesize cDNA. 4 μL of total RNA, 4 μL of 5×PrimeScript IV cDNA Synthesis Mix, and 2 μL of FuFV1-R were added to a 20 μL reaction mixture, followed by RNase-free ddH2O to a final volume of 20 μL. The PCR program was as follows: 30℃ for 15 min, 42℃ for 15 min, and 70℃ for 15 min. The resulting cDNA was stored at -20℃.

[0063] (2) PCR amplification

[0064] Using the synthesized cDNA as a template, TaKaRa Ex PCR amplification was performed using a DNA Polymerase kit (TaKaRa). The PCR reaction mixture consisted of: 0.125 μL TaKaRa Ex Taq (5 U / μL), 10× Ex Taq Buffer (Mg... 2+ 1.5 μL of dNTP Mixture (2.5 mM each), 1.5 μL of cDNA, 0.75 μL of FuFV1-F (10 μM), 0.75 μL of FuFV1-R (10 μM), and ddH2O to a final volume of 25 μL were added. The amplification program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, for 30 cycles; 72℃ extension for 5 min. PCR products were stored at -20℃.

[0065] The PCR products were analyzed by 1.2% agarose gel electrophoresis, and the images were taken on a gel imaging system. If a specific 841bp band appeared in the PCR product, the sample contained the fungal virus FuFV1; if no specific 841bp band appeared in the PCR product, the sample did not contain the fungal virus FuFV1.

[0066] Example 3. Specificity and sensitivity test of the detection method for fungal virus FuFV1

[0067] 1. Specificity test

[0068] Biological materials: Fusarium spp. strains infected with FuFV1 were isolated from infected tobacco. Healthy control Fusarium spp. strains are preserved in our laboratory. *Collectotrichum acutatum* strains containing CaPV1 (Colletotrichumacutatum RNAvirus 1), *Nigrospora oryzae* strains containing NoRV2 (Nigrospora oryzaevictorivirus 2), and *Alternaria brassicicola* strains containing AbFV1 (Alternaria brassicicola fusarivirus 1) were all isolated in our laboratory. These biological materials are available to the public from Yunnan Agricultural University.

[0069] Following the FuFV1 detection method described in Example 2, Fusarium strains infected with FuFV1, healthy control Fusarium strains, *Anthracis aureus* strains containing CaPV1, *Ustilago maydis* strains containing NoRV2, and *Alternaria brassicae* strains containing AbFV1 were tested. The results are as follows: Figure 1 As shown, primers FuFV1-F and FuFV1-R detected a specific 841 bp band in Fusarium strains infected with FuFV1 (lane 1), but no 841 bp specific band was detected in healthy control Fusarium strains (lane 5), CaPV1-containing Anthracnose strains (lane 2), NoRV2-containing Ustilago maydis strains (lane 3), and AbFV1-containing Alternaria brassicae strains (lane 4). Therefore, primers FuFV1-F and FuFV1-R of the present invention have strong specificity for the fungal virus FuFV1.

[0070] 2. Sensitivity Test

[0071] Following the FuFV1 fungal virus detection method in Example 2, total RNA was extracted from FuFV1-infected Fusarium strains, and the concentration of total RNA was measured using a UV spectrophotometer. The initial concentration of total RNA was 223 ng / μL, and it was serially diluted 10-fold with RNase-free ddH2O. 4 μL of each dilution was used for reverse transcription to synthesize cDNA. Using the cDNA as a template, PCR was performed using primers FuFV1-F and FuFV1-R. The PCR reaction system and amplification procedure were the same as in Example 2. The results are as follows. Figure 2As shown, a clear band is visible in lane 6, corresponding to an RNA concentration of 0.223 pg / μL. No amplification bands are observed after lane 6. Therefore, the detection method of this invention can detect the fungal virus FuFV1 from RNA samples with concentrations as low as 0.223 pg / μL, exhibiting high sensitivity.

[0072] sequence list

[0073] SEQ ID NO:1 Gene sequence (4506 bp) of RNA polymerase of fungal virus FuFV1

[0074] ATGTTTTTGATTATGTTGTTTTGTTTTGTTGTCCTTGTGGCTTTTGGGGCGCCACTTG

[0075] TCATTTGGTGGCTACTGGCCCCTTTTCTCAGCCCTTGGGGGGCCTTTTGGATCACC

[0076] GGGACCGGGGGCACCGCGATCGGTGTCGTGGGCCTTTTACTCACCTTTCCAGTTCG

[0077] CCGGTTCTTGGCTCGAGAGGCCCTGATCATCAGGGAGTATGGAGTTGAGCATGCTC

[0078] TGTGGATGGATGGCGGCAGTGTGTTCGGGTTCCGCAAGGCCGCTTCTGTCATCGTG

[0079] GCCGACTTTGATCCAAGCATGGGGACGCCAACAGAGGACCTCATCCTCTCCACTTT

[0080] GAGGAGGGTGAATGGCACTCACAAACTCTCAGATTGGTACACAAATTCTTCTATAC

[0081] TGTGGAGTTCCTGTGTGCTCTTCTGTTTGCAAGTGACCAATTCCGGGCTTCCCTC

[0082] CTGTGGCTGGTTGGTGCATTTGCCTTCCACCAAGCAACTAAAGGGGTCATGGGTGC

[0083] ACTGCGGCGTGTTTTGAATGTGTTTCGCTGGTTTACTTATGGTGCCCTTCTGATTTT

[0084] GACAGCCAACACCAGCACTTTGACAAGCATTGTGTTGGTGACTGGCGCTCTGATC

[0085] AGGACCGCTGTTTCAGCTGACTGGGGGAGACTTGGTCACAGGATCAAACTCGAGC

[0086] TCACCATATGTGTCGTCGAGGCCACCAACTTGTGGGTAGAGTATAACTTTATAGGC

[0087] ACAAAATGGTTTTCAGTAGAGGGTTTTGCCAAACGGAAGGGTCAGGGTGCTAAAG

[0088] TGTTCCTGGCTGATAAGCTTTCCAGGTTGGGTATAGTTATAAGCGATCTCGGTCTCC

[0089] CCAACTTGGTGTTGTCCAAGCAACCTGAAAGATTTTCACGGGATGACATTGATGGC

[0090] ACACTTGAGTTAATGCGCGAGCTCGGTTGGCCCATCAATGTTGACACAGCTGACCC

[0091] TTCCAGGTTTGGGTCTAGTTCGGCTTACCGAGATTGGCTCGTTTCAGGTTCCACTT

[0092] GGGCCCAGGGACTTCACCAGCGTGTCATGTACCTTGATGAAATACTTGACCCTCTG

[0093] CGCGTGAATGCAGTTGAATTCCGTCGAACAGAGGAGTACAGAGATCTGAACAATG

[0094] AACTTGAATCCGTTGCTCGATACTTTCATAGTCCGCGGTATGATTTCCCTGAACTCC

[0095] CGCTGGATGATGTGTGGTTTCTTGTGGGGGACATATTCAAGCATTCTAGAATTGCAC

[0096] CATTCAACCACATCATTCGGCTTTGGGAGAAGAAGTATGCGCTCGGATCATTCATG

[0097] GTTGATCCTGCCAATCCCAGGAAGAAATATTCCAGATGGAAGTTCATCTCTACCATT

[0098] GGATATCGTAAATTCAAGGATTTGTGGCGCCGTACGTTCGAAGTTGCGAGTCGATT

[0099] TGCACCAGTGGCGCATGTGTCTGTCAAAGATGAAGCACTTCCACCCAAAAAGTTT

[0100] CTTGCCAACAAAGTCAGGACCGTGATAGGCTCACCTTTGGGGCAATATATCCTGTC

[0101] CACAGTCTTCAATTTTATGCCCAACCACAATTTCCGTTTTGAGTCCACGCCCGTGA

[0102] AAGTCGGCATGCCGTTAAATGGTTACTGGTTTAATAAAGTGTACAGCAGACATTCG

[0103] AGGTGTCAAGTTCACTTTGCAGGGGACTTCTCCGACTTTGATTCCACACTTAGTGG

[0104] AAAAGTTAGGGATATGATCAAGCAGGTGCGGAAGAAAGGGTTTGAAAAACACAA

[0105] AGACTTTGACAGGATCTGCAAACTTATTGACGTGAATTATGCTCAAGTAAACAGTC

[0106] AGTTGCTCAACACGACTTCCACTGGCGATGTCTATGACAAGGGCACAGGCCTCAC

[0107] CACTGGCCACTCATCCACTTCCATGGATAATTCTCTGGGGACCGTCATTTTGTACCT

[0108] CATGGCTTGGAAAGAGTTGACAGGATTGGATGCTCAAGCCTTTAGGCACTATAATG

[0109] AACTTGATGTCTTCGGTGACGATCACATCATTTCGTGGTTGTCCACTTGCCCGGTTG

[0110] GCTGGGCGTTCCCCAACATACAGAAAGTGATGGCGAAATGGGGGCTTGAACTTCG

[0111] CACAGAGGCATCTGGCAAGCTTAATTCCCTTCCTTTTCTTTCCAAGTTTGTCAGAC

[0112] AACCGAACCCCACGGATGTGCGTGAACTCAAGGCTGCTGGTGTTTACAGCCATGG

[0113] TTCATGGGTCGTTTATCATGACAAAGAACGTCTTCTTGGCAAGCTCGTTTCCAAAG

[0114] TGAAGTCTATGGCCCCAGAATATCGGTTGAAAAGGCTATTGAGTTACCTTTCTCTGA

[0115] CGGCTCATCATAAAGATGTCTACGATCAGTTGTCTGATATTCTGCGCCGAACCAACA

[0116] GCTTCAAAGGCATCATTTCTTCCAAGAAGATCAAAATACCTTCTTACGAGAAAGTG

[0117] TTGCAGGATTGGTACAGCTCCAACTCTTTCGAGCCGCATATGGAAATGGAGGATGT

[0118] GGACCCCAGTTTGGTGGATCCTGCGCTCAT CTCTTATGGCAGCGTTTCGC TTTTTGA

[0119] TTCAGTTCTGGGCTTAGCGGCTCAAATTCCTGACGTGATCAACCCAGTCTTGTTCA

[0120] ATTTTGGATATCTGCGTGCCTTCCAGGCAAGGGCTGTGCACTGCTTTGACTGGCCA

[0121] CTGCAGTTGCTTGAGTGCAGTAACAACGTTTGGGGCCCCGGAGAGCTTGGAGCCT

[0122] TGTGTTCCAGGACCCCGTATTCTTTCCTTGACCCAATGATCAGGTCAGGAGGTGAA

[0123] CGCCCGAACTTCAGCACCCTATTGCTCAGGAACTTTGTTTTCCTTCTTTTCAAGGA

[0124] CAAATTCAAAATGCCTAAGCTAGTGTCACAGTTTGGCGCTGCTCACAGGAAAGTG

[0125] GCGCAGACTCAGTTTTGGCTCAATGGAAAATGCCTGGATGATGTGCGGTCTGGTGA

[0126] TCTGCCTATTTGGCCCATGGCACTTGTGTTCCTGCTGAGTTTTCTCTACGTTCCGCC

[0127] TTGGTTTGAGTGGGTTGAGCCTCTTGAATTGCCTAATGTTCCCTTGCTGCTTGAAA

[0128] GGGGACTGTTGTCTGCCAGCAATTTCTTTTGGTCTTCACTCCCTCCGAATTACAGC

[0129] GATGTGATCCACCACGTTAAGTCTCTCTCCGGTATTGATGATGCCAAGCTTTGTGTT

[0130] GAGGCACCCACTGGGTCAGGGAAGAGCACTGCACTCATAAAGTGCATCAGCGACC

[0131] ATCTCCCGCTGTGCTTTGATCGGGTGATCGTCATTGAGCCCAGATCGGCCATTGTGA

[0132] GGGGCATAGTCCCTTACACTCAGCAGTCTCTCGCCCTAGACTCTTCTGGGGCCACC

[0133] AGTGGTATGA CGCTTGACACGAAGGCAAAA GTTTGGTATGTGACTGCGCAGGAAG

[0134] CACTGATGCACACCTCCTGGTGGAGCAAGAAAAATCTGTTCATCCTGGATGAGTGT

[0135] CATATAGGGGAAACAGCTTACCTGCTCATGAAGGAGTTGCTGTTCAAGCGTCGTCA

[0136] ACTCACATTGTTCGTGTCCGCCACACCAGATGCCGGCACCCTCTCGCAATGTGTGC

[0137] ATCTGCCTTTGAACACCGCTCGCGTTTGGAAGCTTCATGTGCGGAGTTCCTCACAC

[0138] GGGGATGTGGAGTCCTACAAGCAGGCTTGGCGACACTATAAGTCCGAGGCGTTGG

[0139] GTTGCCTTGCAAGACTCCCCAAGTCTAGCAAGGCCTTGATCTTTGTGAATACAATC

[0140] ATTGAAGCCAATGAATTGGCAGGTGCTGTGGGGTCAAAGGCAGTCGTGTTATCATC

[0141] TTCCAGTGATCAATCTCACCTCGGTGACGCTTCGGTCATTGTCACCACAAGCGTGG

[0142] CAGACGTTGGAGTAACCCTGCCCAATGTTGATTTTGTGATGACACATGACATAGGT

[0143] TTCACTGTGGTTGAGAGTGTTGACCAATCCATCCCCAAGCACTACAGGCTGTCAGG

[0144] AGGGCAGCTTAAACAAAGGGTTGGCAGGACAGGCCGCACCAACCATGGTCAAGG

[0145] CATGGTTCTGAGATACCCCAACGTGCGGGTGATGAATTTAGAGGACAATCTTCAAA

[0146] GTGTCGGTTCTGTCCTCTCTCTCATTAAATCCGGCATCCCTGTCGCTGTGCTCTCTG

[0147] AACATATGAGTGGTCCTTTGCTGGAACTTCTCGGGTTGTCCAACGAGCAAGGCCC

[0148] GGCCAAGGATGACATGATTGACTTTGCTCTTAAGCAGTTGGACCGGTACTCAGAAA

[0149] ATTTTGGTTTGTTGCTGCAAGAACGTGCCGCAGCCTCAGAGTTACCCACTGCCACA

[0150] GGAGAAGCTGCAGCACACATCGACAATGCGAGGATGGGGTTGGTGCGGATCAGTT

[0151] CTCTCATACCAAGCTCAGAAATCGTCAATGCCATTATAGGTGTTGCAACAAGTTTG

[0152] GCCAAAGCCAGTTTTTCAAATGGTGAAGAGAAAGATCACTGGGTGGAGCAAGCAT

[0153] CACTCCACACCAATAGGATCGGATTCGGAACCAAGGGTCTCCGCCCTCTTCCTGAC

[0154] CCTGAGCTGGGTGAATTGGGGTTTGACTAA

[0155] SEQ ID NO: 2 Gene sequence of the hypothetical protein of mycovirus FuFV1 (1623 bp)

[0156] ATGGTGAAGAAAGATCACTGGGTGGAGCAAGCATCACTCCACACCAATAGGAT

[0157] CGGATTCGGAACCAAGGGTTCCCGCCCTCTTCCTGACCCTGAGCTGGGTGAATTG

[0158] GGGTTTGACTAAGTTGTTTAGGCGTCTGGTACTGATGAGTACGCCTCGAAACATCT

[0159] CAAGGATGTCTACCATGACTGGTACAAGTTCACACTGCTCACAGGAGCAATTGTCT

[0160] GTTGCGGGATCACAGACCACACATTACCGAAGTTTGTCACTTTTCCGAAAAGTGG

[0161] AGAAAATAATCAAAGACCAGACCACTGGTGCCATGATGCATGGGAGCGGAGTGCG

[0162] GGTTGTCGACAACGAAAAGATTGACGACCTCGCTGAAGCCATCATGAAGGTGCTT

[0163] GTGGCTGATTCGGACACTACTGTCCCAAAAAGTACTTTAGCTGAGCTCACGGCTCA

[0164] ACTTGCAACTGTGCGGCTTGAATTGTCTTCGTTCAAGGACCGTGCAGCAAAGGCG

[0165] TCCTATGCTGAACAGGAGGCCAAGACTACGTTGGGGGCCCTTAACAAAGAGTTGG

[0166] CGCGCTACAAAGTTGAAGCCAACAACGAGGTTTGCCGCCTTCGAAGCCAAAAAA

[0167] CCAGTTGGGATCTGGACAGAGCAGCCATCCAAGCCAACCTCAAGGATCTGCGGAA

[0168] GCATATGAAGGCTTTTCCTGGGGGTTCAGATCGTGTGGCCCCAGAAGAAGCTGAAT

[0169] GGCAGGCTGGGAATATGGCCGCTCGCATCACTGAGCTCAACAACCTGGCCCAAGA

[0170] TGCCAACAAACAGGTGATTGCTTTACGCAGCAAAGAGGCTAAATTAGAGCACCATA

[0171] TTCTCACTCTGTCAAATGAGCTCAATATCGCCAGGGCCTCTGTTGTCGCTTCTGCTA

[0172] AGAAGGATTCAGGCACCTTTTCAGAAGTGGCACGTAGCGCTGGCACAGCCAACTT

[0173] TGAGCTTGCTCACAAAGGGATGGCGCTTTTGACAAATGAAGCGCGCAACAAGCTC

[0174] AAGAAAGCTTATGCCTCTACTGATGGTGTGAAAGACCGGCTCTTTTGGATCAAAGC

[0175] GTCTCTGCAGAATGTGAAGCATGCTGCTCTCTCAAACTATCGGCATGTTGTCACCC

[0176] AACTGCACAAAGAGTCTCTGCTTCTGGACTATCAAAGTCGCGCCAAAGCTCTGGG

[0177] CCCGGTTGTCGATGATATGTTGGAAGAGTTATCTGTCCGTGTGGACCCTGACTGCA

[0178] ACAGTGTCACTAATAAGTACTTGTTGAGCGTGGATCCTTCACTCATGAAACTCAAG

[0179] CCTCTGCTCCGAAAAGCAACAGGTTGCACCAACATAGGGCAGGCATACGAGGAAG

[0180] GGTGGCATCTCGACGACCTGATCGATCTTGAAGATTTCATAAAGAAAGGTGGAGAT

[0181] CCTTCTAAGAGGTCACCCCCAGTAAGGGACGACGAGAAAGACGCCGCTTGGGCTG

[0182] AGATCTGGCCTGAGGTGGACCCTGCTGGTGTCCCCCTCCCCGACGTGAGCGATGAT

[0183] GATCTCTCTCCGGGTTTCTGGAACAAATTGTTAATCGGCTGGAGGCATTCGCTTGG

[0184] TGCTTTCTTGTCGTTTGGGTCTGTTTTGTTCAGCCCGTTTCGTAAGTTTTTCTCCAT

[0185] GTTTCATATTTAA

[0186] SEQ ID NO: 3 Primer FuFV1-F (20 bp)

[0187] CTCTTATGGCAGCGTTTCGC

[0188] SEQ ID NO: 4 Primer FuFV1-R (20 bp)

[0189] TTTTGCCTTCGTGTCAAGCG.

Claims

1. A fungal virus, with accession number CCTCC NO: V202295, named Fusarium fusarivirus1, abbreviated as FuFV1.

2. Primers for detecting the fungal virus of claim 1, having the following nucleotide sequence: FuFV1-F: 5'-CTCTTATGGCAGCGTTTCGC-3', FuFV1-R: 5'-TTTTGCCTTCGTGTCAAGCG-3'.

3. A kit for detecting the fungal virus of claim 1, comprising the primers of claim 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes standard PCR reagents and / or kit instructions.

5. A method for detecting the fungal virus of claim 1, comprising the following steps: (1) Extract RNA from the sample to be tested and reverse transcribe it to obtain cDNA; (2) Using the cDNA as a template, PCR is performed using the primers described in claim 2 to obtain the amplification product; (3) If the amplification product is detected, and the target fragment of 841 bp is found, then the sample to be tested contains the fungal virus.

6. The method according to claim 5, characterized in that, The sample to be tested is a plant organ, tissue, or fungus suspected of containing the fungal virus.

7. The method according to claim 6, characterized in that, The fungus in question is a pathogenic fungus.

8. The method according to claim 5, characterized in that, The amplified products were detected using electrophoresis or sequencing.

9. The method according to claim 5, characterized in that, The PCR reaction system was as follows: 0.125 µL of Taq DNA polymerase 5 U / µL, 1.5 µL of 10× Taq buffer 20 mM, 1.5 µL of dNTP mixture 2.5 mM each, 2 µL of cDNA, 0.75 µL of FuFV1-F 10 µM, 0.75 µL of FuFV1-R 10 µM, and ddH2O added to a final volume of 25 µL.

10. The method according to claim 5, characterized in that, The PCR reaction procedure was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min.

Images