Method for creating tomato controllable male sterile line by using slidi2 protein and propagation method of the sterile line

Abstract

The application discloses a method for cultivating a controllable male sterile line of tomato by using SlIDI2 protein and a propagation method of the sterile line. The method comprises the following steps: by inhibiting or reducing the activity of SlIDI2 protein in the genome of the tomato, or silencing or inhibiting the expression of the gene coding the SlIDI2 protein in the tomato or knocking out the gene coding the SlIDI2 protein, thereby generating the controllable male sterile line of the tomato. The sterile line cultivated by the method can realize self-propagation by regulating fertility conversion through an exogenous substance, can overcome the problems that traditional nuclear sterile line propagation needs artificial cross and screening of 50% fertile plants, and can simply and quickly realize the propagation of the sterile line.

Description

Technical Field

[0001] This invention belongs to the field of crop breeding technology, specifically relating to a method for creating a controllable male-sterile tomato line using the SlIDI2 protein and a method for propagating the male-sterile line. More specifically, the method uses CRISPR / Cas9 to knock out the SlIDI2 gene to create a male-sterile mutant. This mutant can restore its fertility by applying exogenous substances, thereby achieving rapid and simple propagation of the male-sterile line, thus establishing a controllable male-sterile tomato breeding system. Background Technology

[0002] Hybrids are increasingly widely used in the production of various crops because they exhibit significant advantages over self-pollinated varieties in terms of growth, stress resistance, yield, and early maturity, demonstrating strong heterosis. However, breeding hybrids requires technical steps such as artificial emasculation and cross-pollination, which leads to high seed production costs and difficulties in ensuring hybrid purity. Male sterility not only eliminates the need for artificial emasculation but also improves the purity of hybrid seeds and prevents the loss of parental lines (Du et al., 2017), making it an effective way to solve the above problems.

[0003] Tomato (Solanum lycopersicum) is the world's largest vegetable crop and also the vegetable crop with the largest area of ​​greenhouse production in China. Currently, all tomato varieties on the market are hybrids, representing a huge market size. To date, more than 50 male-sterile mutants of tomatoes have been discovered, mainly divided into three types: functional sterility, such as sl (Gomez et al., 1999); structural sterility, such as ps-2 (Atanassova, 1999); and sporophytic sterility, such as ms10 (Jeonget et al., 2014). These mutants are all recessive nuclear sterile, and some of the sterility genes have already been cloned. Ps-2 encodes polygalacturonase; mutations in this gene prevent anther dehiscence during flowering, hindering pollen release (Gorguet et al., 2009). Ms10 and Ms32 encode basic cyclic-helical-cyclic (bHLH) transcription factors; mutations in these genes prevent tapetum degradation and tetrad formation in sporocytes (Jeong et al., 2014; Liu et al., 2019). Ms15 (TM6) and 7B-1 (GLO2) both encode class B MADS-box transcription factors; mutations in these genes lead to carpel formation in stamens and significantly abnormal pollen development (Cao et al., 2019; Pucciet et al., 2017). SlMPK20 and SlMPK4 belong to the mitogen-activated protein kinase family; knockdown or deletion of this gene prevents mature pollen formation (Chen et al., 2018; Wang et al., 2022).

[0004] However, the application of male sterility in tomato seed production has progressed slowly. A key limiting factor is the difficulty in propagating sterile lines. Typically, male sterility propagation requires hybridization using a sterile female parent and a maintainer line as the male parent. Because the hybrid offspring contain 50% sterile lines and 50% maintainer lines, the maintainer lines need to be screened out, which consumes a significant amount of labor. Using seedling morphological markers for sterile line screening and propagation is an effective method. Liu et al. (2021) used CRISPR-Cas9 technology to simultaneously knock out the sterile gene Ms10 and the closely linked morphological marker (green stem) gene GSTAA to obtain a green-stemmed sterile mutant. In the hybrid offspring of the green-stemmed sterile line and the purple-stemmed maintainer line, the two lines can rapidly separate based on the difference in hypocotyl color (Liu et al., 2021). For specific propagation systems, see [link to propagation system]. Figure 1 Our research group created the ms10 gstaa and ms15drf green-stemmed male sterile mutants using the core inbred lines TB0993 and TB0249 as chassis materials through gene editing. We then developed a mature strategy for male sterility line breeding based on morphological markers in large-scale hybrid seed production. Furthermore, we linked the fertility restoration gene and anthocyanin synthesis gene into the same vector and transferred them into the str1 male sterile line, proposing a strategy for male sterility line screening and breeding based on genetic engineering technology (Du et al., 2020). However, the strategy of using morphological markers for assisted screening of male sterile lines still has two problems: 1) hybridization is still required in the male sterility line breeding process; 2) recombination exchange occurs between morphological markers and male sterility genes, and further removal of fertile plants that have undergone recombination exchange is still necessary when using morphological markers to screen male sterile lines. Therefore, it is essential to develop a more convenient method that overcomes the shortcomings of existing male sterility line breeding methods.

[0005] References:

[0006] 1.Atanassova,B.,1999.Functional male sterility ps-2in tomato(Lycopesicon esculentum Mill.)

[0007] and its application in breeding and hybrid seed production.Euphytica107,13-21.

[0008] 2.Cao,X.,Liu,X.Y.,Liu,X.L.,Yang,M.X.,Giang,T.W.,Wang,J.,Liu,X.L.,Sun,S.,Wei,K.,Wang,X.X.,Gao,J.C.,Du,Y.C.,Qin,Y.,and Huang,Z.J.(2019).B-classMADS-box TM6 is acandidate gene for tomato male sterile-15 26 .Theor.Appl.Genet.132,2125-2135.

[0009] 3.Du,M.M.Zhou,K.,Liu,Y.Y.,Deng,L.,Zhang,X.Y.,Lin,L.H.,Zhou,M.,Zhao,W.,Wen,C.L.,Xing,J.Y.,Li,C.B.,and Li,C.Y.(2020).A biotechnology-based male-sterility system for hybrid seed production in tomato.Plant J.102,1090-1100.

[0010] 4.Gorguet,B.,Schipper,D.,van Lammeren,A.,Visser,R.G.F.and vanHeusden,A.W.(2009).ps-2,the gene responsible for functional sterility intomato,due to non-dehiscent anthers,is the result of a mutation in a novelpolygalacturonase gene.Theor.Appl.Genet.118,1199-1209.

[0011] 5.Jeong,H.J.,Kang,J.H.,Zhao,M.,Kwon,J.K.,Choi,H.S.,Bae,J.H.,Lee,H.A.,Joung,Y.H.,Choi,D.,and Kang,B.C.(2014).Tomato male sterile 1035is essentialfor pollen development and meiosis in anthers.J.Exp.Bot.65,6693-6709.

[0012] 6.Liu,J.W.,Wang,S.F.,Wang,H.,Luo,B.,Cai,Y.Y.,Li,X.D.,Zhang,Y.F.,andWang,X.F.(2021).Rapid generation of tomato male-sterile lines with a markeruse for hybrid seed production by CRISPR / Cas9 system.Mol.Breed.41,25.

[0013] 7.Liu,X.Y.,Liu,X.L.,Wei,K.,Cao,X.,Wang,X.T.,Wang,X.Y.,Guo,Y.M.,Du,Y.C.,Li,J.M.,Liu,L.,Shu,J.S.,Qin,Y.,and Huang,Z.J.(2019).A putative bHLHtranscription factor is a candidate gene for male sterile 32,a locusaffecting pollen and tapetum development in tomato.Hortic.Res.6,88.

[0014] 8.Pucci,A.,Picarella,M.E.and Mazzucato,A.(2017).Phenotypic,geneticand molecular characterization of 7B-1,a conditional male-sterile mutant intomato.Theor.Appl.Genet.130,2361-2374.

[0015] 9.Brukhin,V.et al.(2003)Flower development schedule in tomatoLycopersicon esculentum cv.sweet cherry.Sex.Plant Reprod.15,311–320. Summary of the Invention

[0016] To address the shortcomings of existing technologies, this invention aims to provide a method for creating a controllable male-sterile tomato line using the SlIDI2 protein, as well as a method for propagating this male-sterile line. The inventors, through extensive analysis, discovered that the SlIDI2 gene has the function of controlling tomato fertility, and based on this, proposed this invention. The male-sterile line cultivated using this method achieves self-pollination through fertility conversion regulated by exogenous substances, overcoming the problems of traditional nuclear male-sterile line propagation requiring artificial hybridization and screening out 50% of fertile plants, thus achieving rapid and simple propagation.

[0017] To achieve the above objectives, the present invention adopts the following technical solution:

[0018] The first aspect of this invention provides the application of SlIDI2 protein-related biomaterials in the creation of tomato controllable male sterility lines or in tomato breeding; the SlIDI2 protein-related biomaterials are selected from the following (a) or (b):

[0019] (a) Substances used to silence or inhibit the expression of the gene encoding the SlIDI2 protein in tomatoes or to knock out the gene encoding the SlIDI2 protein.

[0020] (b) Substances used to reduce or inhibit the activity and / or content of SlIDI2 protein in tomatoes;

[0021] The amino acid sequence of the SlIDI2 protein is selected from either (1) or (2):

[0022] (1) As shown in SEQ ID NO.1;

[0023] (2) Derived from tomatoes and having more than 98% identity with the sequence described in (1) and having the same fertility function as the sequence described in (1).

[0024] In the application of the first aspect of the present invention, the relevant biological material can be any material that achieves the function described in (a) or (b). Considering efficiency and operation, as a preferred embodiment, the relevant biological material is a tomato CRISPR / Cas9 genome editing system, comprising: an expression vector, the expression vector including a Cas9 expression cassette and an sgRNA expression cassette, the Cas9 expression cassette expressing Cas9, the sgRNA expression cassette expressing sgRNA, and the target gene of the sgRNA being the gene encoding the SlIDI2 protein in tomato.

[0025] In the application of the first aspect of the present invention, as a preferred embodiment, the target sequence of the sgRNA is as shown in SEQ ID NO.3 (i.e., CTCTACCGAGAGTCTGAGCT), which is located at position 2057-2076 of the tomato gene SlIDI2 as shown in SEQ ID NO.2, or the target sequence of the sgRNA is the reverse complementary sequence of the sequence shown in SEQ ID NO.3 (i.e., AGCTCAGACTCTCGGTAGAG, as shown in SEQ ID NO.4 in the sequence listing).

[0026] The second aspect of the present invention provides a method for creating a tomato line with regulated male sterility, the method comprising: inhibiting or reducing the activity and / or content of the SlIDI2 protein in the tomato genome, or silencing or inhibiting the expression of the gene encoding the SlIDI2 protein in tomato or knocking out the gene encoding the SlIDI2 protein, thereby obtaining a tomato line with regulated male sterility.

[0027] The amino acid sequence of the SlIDI2 protein is selected from either (1) or (2):

[0028] (1) As shown in SEQ ID NO.1;

[0029] (2) Derived from tomatoes and having more than 98% identity with the sequence described in (1) and having the same fertility function as the sequence described in (1).

[0030] In a preferred embodiment of the method of the second aspect of the present invention, the method silences or inhibits the expression of the gene encoding the SlIDI2 protein in tomato or knocks out the gene encoding the SlIDI2 protein by mutating the gene encoding the SlIDI2 protein in tomato; preferably, the mutation causes a loss of function in the gene encoding the SlIDI2 protein; the mutation is a homozygous mutation.

[0031] In a preferred embodiment of the method of the second aspect of the present invention, a tomato CRISPR / Cas9 genome editing system is used to induce a mutation in the gene encoding the SlIDI2 protein in tomato, wherein the mutation is a base deletion mutation. The tomato CRISPR / Cas9 genome editing system comprises an expression vector, wherein the expression vector comprises a Cas9 expression cassette and an sgRNA expression cassette, wherein the Cas9 expression cassette expresses Cas9 and the sgRNA expression cassette expresses sgRNA, and the target gene of the sgRNA is the gene encoding the SlIDI2 protein in tomato.

[0032] More preferably, the target sequence of the sgRNA is as shown in SEQ ID NO.3, located at positions 2057-2076 of the tomato gene SlIDI2 as shown in SEQ ID NO.2, or the target sequence of the sgRNA is the reverse complementary sequence of the sequence shown in SEQ ID NO.3.

[0033] In a preferred embodiment of the method of the second aspect of the present invention, the method specifically includes the following steps:

[0034] S1 introduced the tomato CRISPR / Cas9 genome editing system into tomato explants and obtained successfully transformed plants through screening.

[0035] S2 obtains the SlIDI2 gene mutant line from the successfully transformed plants, thereby obtaining a tomato line with regulated male sterility.

[0036] Preferably, the identification involves using the genome of a successfully transformed plant as a template to perform PCR amplification of the SlIDI2 gene fragment, followed by detection by gel electrophoresis or sequencing to obtain a line with a homozygous mutation in the SlIDI2 gene.

[0037] The third aspect of the present invention provides a method for propagating the above-mentioned tomato controllable male sterility line, wherein the flower buds of the above-mentioned tomato controllable male sterility line plant are sprayed with a dimethylpropenyl diphosphate triammonium salt solution to restore the fertility of the tomato controllable male sterility line, and then self-pollination is carried out to achieve the propagation of the tomato controllable male sterility line.

[0038] In the propagation method of the third aspect of the present invention, as a preferred embodiment, the dimethylpropenyl diphosphate triammonium salt solution is an aqueous solution with a concentration of 10-100 ppm (e.g., 20 ppm, 30 ppm, 50 ppm, 70 ppm, 90 ppm); and / or, the spraying is carried out during the budding stage (preferably stage 6 to stage 10) of the tomato male-sterile line; and / or, the spraying is carried out once every 3-5 days, for a total of 3-5 times.

[0039] For the meaning of stages 6 to 10, please refer to the literature Brukhin et al., 2003.

[0040] Compared with the prior art, the present invention has the following beneficial effects:

[0041] This invention obtains a sterile mutant with complete pollen abortion by inhibiting or reducing the activity and / or content of the SlIDI2 protein in the tomato genome, or by silencing or inhibiting the expression of the gene encoding the SlIDI2 protein in tomato, or by knocking out the gene encoding the SlIDI2 protein. This mutant exhibits normal vegetative growth and pistil development, and has potential application value. More importantly, Slidi2 pollen abortion can be effectively restored through exogenous compensation for missing metabolites, thereby establishing a novel "exogenous substance-regulated" sterile line breeding method (see [link to relevant documentation]). Figure 2 This method achieves self-pollination by regulating fertility conversion through exogenous substances. It not only overcomes the problems of artificial hybridization and screening out 50% of fertile plants required for traditional nuclear male-sterile line breeding, thus realizing simple and rapid breeding, but also has the potential to overcome the problem of poor fertility stability in hybrid breeding systems of crops such as rice that rely on light and temperature environmental conditions for fertility restoration. It has good prospects for industrial application. Attached Figure Description

[0042] Figure 1 Diagram of the tomato green hypocotyl sterile line (GHMS) breeding system;

[0043] Figure 2 Diagram of the breeding system for exogenous substance-regulated sterile lines;

[0044] Figure 3 This is a schematic diagram of the CRISPR / Cas9 knockout target Target1 sequence on the SlIDI2 gene of the present invention, and schematic diagrams of the sequences of the four mutants obtained after knockout.

[0045] Figure 4 An illustration showing how a mutation in the SlIDI2 gene in tomatoes can cause complete pollen sterility without affecting vegetative growth and pistil development.

[0046] Figure 5 Tissue sections of anther tissue at different developmental stages of wild-type tomato (AC) and Slidi2 gene mutation (Slidi2 / AC) were analyzed.

[0047] Figure 6 The results of DAPI staining analysis of male germ cells at different developmental stages of pollen from wild-type tomato (AC) and Slidi2 gene mutant (Slidi2 / AC);

[0048] Figure 7FDA staining analysis results show that the susceptibility of the Slidi2 / AC mutant can be partially restored through exogenous compensation via DMAPP.

[0049] Figure 8 Images show the self-pollination and seed development of the #1 mutant after DMAPP spraying treatment. (a) is a picture of plant fruiting, and (b) is a picture of seed development. WT is wild-type tomato, and Slidi2 / AC is the #1 mutant. Detailed Implementation

[0050] The technical solution of the present invention will be described in detail below with reference to specific embodiments and examples. The following embodiments and examples are only for better understanding of the present invention and do not constitute a limitation of the present invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0051] The tomato variety used in this invention is AC (Alisa Craig), which is derived from the Tomato Genetic Resource Center of the United States (TGRC, http: / / tgrc.ucdavis.edu / ) and is available to the public through commercial channels.

[0052] Example 1: Discovery of the SlIDI2 gene's control of male sterility in tomatoes

[0053] 1. Introduction to the SlIDI2 gene

[0054] This invention involves the knockout of the tomato gene SlIDI2 (Tomato Genome Website gene ID: Solyc05g055760, NCBI ID: NC_015442.3), which consists of 6 exons. The complete sequence of this gene is shown in Sequence 2 below (i.e., the sequence shown in the sequence listing SEQ ID). NO.2), where positions 1-65 are exon 1, positions 1302-1357 are exon 2, positions 1691-1782 are exon 3, positions 1994-2096 are exon 4, positions 2194-2213 are guide sequence 1, positions 2194-2331 are exon 5, positions 2258-2277 are guide sequence 2, and positions 2624-2877 are exon 6. The mature mRNA coding sequence includes 708 nucleotides, and the encoded SlIDI2 protein includes 235 amino acid residues. For the specific amino acid sequence, please refer to Sequence 1 (i.e., Sequence Listing SEQ ID NO.1).

[0055] The amino acid sequence of sequence 1 is as follows:

[0056]

[0057] The nucleotide sequence of sequence 2 is as follows:

[0058]

[0059]

[0060]

[0061] 2. Functional analysis revealed that the SlIDI2 gene, as shown in SEQ ID NO.2, controls male fertility in tomatoes. When the expression of the SlIDI2 gene is suppressed or it is knocked out, the tomato pollen becomes completely sterile. The mutant line (Slidi2 / AC) exhibits shriveled anthers and inactive pollen. The Slidi2 / AC mutant line shows normal pistil development and can set fruit and produce seeds normally when pollinated with wild-type pollen. Its vegetative growth is also normal, with no significant difference in root, stem, and leaf development compared to the wild type. Further analysis using histological sections and DAPI staining revealed that the vegetative and reproductive nuclei disappear during the binucleate stage of Slidi2 / AC pollen development, thus rendering it inactive.

[0062] Example 2: Creating a male-sterile tomato line using the SlIDI2 gene or SlIDI2 protein

[0063] The basic vector is the CRISPR / Cas9 dual-vector system PTX041, donated by the laboratory of Chuanyou Li at the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and is available to the public from the laboratory of Chuanyou Li at the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. It expresses sgRNA using the tomato U6 promoter and Cas9 with maize codon-optimized expression using the 2×CaMV 35S promoter. For specific characteristics of the vector system, please refer to Deng et al. (Deng L, Wang H, Sun C et al. Efficient generation of pink-fruited tomatoes using CRISPR / Cas9 system. J GenetGenomics. 2018; 45:51–54).

[0064] I. Target selection and construction of PTX-Target1 knockout vector

[0065] Based on the overall efficiency of the target sites and off-target effects, knockout target sequences were selected. The location and sequence of the target sequence on the SlIDI2 gene sequence shown in SEQ ID NO.2 are described in [reference needed]. Figure 3 Specifically, a target site is selected in the fourth exon of the SlIDI2 gene, see Target1 (sequence shown in SEQ ID NO.4): AGCTCAGACTCTCGGTAGAG;

[0066] Primers are formed by adding a linker (containing a BSaI restriction site) before and after Target1 and its reverse complementary sequence (i.e., the sequence shown in SEQ ID NO.3, located at positions 2057-2076 of the tomato gene SlIDI2 as shown in SEQ ID NO.2):

[0067] Guide2F atatatggtctcgtttgAGCTCAGACTCTCGGTAGAGttttagagctagaaatagc (ie SEQ ID NO.5)

[0068] Guide2R: attattggtctcgaaaCTCTACCGAGAGTCTGAGCTccaaactacactgttagattc (ie SEQ ID NO. 6).

[0069] Primers Guide2F and Guide2R were used as templates for amplification using a 2×Taq PCR StarMix PCR amplification kit with plasmid pCBC-DT1T2_tomatoU6 (provided by the laboratory of Li Chuanyou, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and available to the public). The amplification program was: 94℃ for 5 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 45 s, 35 cycles; 72℃ for 10 min. The amplified product was 603 bp, and the specific sequence (i.e., SEQ ID NO. 10 in the sequence listing) is as follows, where the black italicized text represents the Target1 target site:

[0070]

[0071] The amplified product and the PTX041 vector were simultaneously digested with BSaI and ligated with T4 ligase to form the ligation product PTX-Target1. PTX-Target1 was transformed into *E. coli* DH 5α competent cells, and single colonies were picked and cultured overnight at 37°C with shaking at 200 rpm in liquid LB medium containing 50 mg / L kanamycin (Kan). Positive clones were verified by sequencing using primer TST1: CACACAGGAAACAGCTATGACC (SEQ ID NO. 7), and the positive plasmid was extracted, thus obtaining the tomato CRISPR / Cas9 genome editing system, i.e., the PTX-Target1 knockout vector.

[0072] In addition to obtaining the PTX-Target1 knockout vector of the present invention using the methods described above, it can also be accomplished using commercially available CRISPR / Cas9 system construction services.

[0073] II. Genetic Transformation of Tomato

[0074] 1. Agrobacterium infection

[0075] The positive plasmid was transformed into Agrobacterium GVA3101, and the cotyledons of common tomato were infected by Agrobacterium GVA3101 using the "leaf disc method". Then, the samples were cultured in the dark at 25°C in medium (MS medium: 4.3 g / L, sucrose 30 g / L, zeatin 1 mg / L, 200 mg / L termethin, 0.33% agar) for 2 days.

[0076] 2. Regeneration and Screening

[0077] The cultured explants were transferred to regeneration medium containing 50 mg / L kanamycin (MS medium 4.3 g / L, sucrose 30 g / L, zeatin 2 mg / L, inositol 100 mg / L, termethin 200 mg / L, 0.33% agar) to obtain resistant shoot lines transformed with the PTX-Target1 knockout vector.

[0078] 3. Rooting

[0079] The resistant shoots were transferred to rooting medium (MS medium 4.3 g / L, sucrose 30 g / L, 200 mg / L termethin, 0.5 mg / L IBA, 0.33% agar). After about 20 days, the rooted seedlings were transplanted into seedling pots to obtain the corresponding transformed plants.

[0080] III. Verification of Transformed Plants

[0081] Using the genomic DNA of the transformed plants as a template, PCR verification was performed using the following primers. The primers for detecting the SlIDI2 gene mutation in the fourth exon knockout plants are as follows:

[0082] Upstream primer Pu: TCAAATGAGCTGTAGTTGAG (i.e., SEQ ID NO.8)

[0083] Downstream primer Pd: GTTTGAAAAGTATTTTTGCC (i.e., SEQ ID NO.9)

[0084] Genomic DNA was extracted from the plants using a DNA extraction kit (High-efficiency plant genomic DNA extraction kit from Tiangen Biotech (Beijing) Co., Ltd., catalog number: DP350-03).

[0085] Genomic DNA was amplified by PCR using Takara PrimerSTAR Max DNA polymerase from Takara Corporation and primers Pu and Pd. The reaction conditions were 98℃ for 30 s; 98℃ for 30 s, 52℃ for 30 s, 72℃ for 30 s, for 30 cycles; followed by 72℃ for 5 min.

[0086] The PCR products were sequenced (the sequencing was performed by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.).

[0087] Ultimately, 12 mutant strains were obtained, of which #1, #2, #3, and #4 were homozygous mutants. The sequences after mutation are shown below. Figure 3 .

[0088] Further hybridization with wild-type plants, screening for exogenous Cas9 genes, and sequencing identification were conducted to ultimately obtain 10 homozygous mutant lines.

[0089] IV. Characterization of homozygous knockout mutant plants

[0090] The #1 mutant strain exhibited the following phenotypic changes:

[0091] The mutant line (Slidi2 / AC) has shriveled anthers, while the wild-type AC has normally growing anthers (see [link]). Figure 4 A). Further through in vivo germination (see...) Figure 4 B) FDA (Fluorescein diacetate) staining (see...) Figure 4 C) In vitro germination (see...) Figure 4 D) The experiment confirmed that the mutant line (Slidi2 / AC) had complete pollen abortion, making it a male-sterile mutant (see [link]). Figure 4 F and G), while wild-type strains produce normal fruit (see F and G). Figure 4 E). The mutant line (Slidi2 / AC) showed normal vegetative growth (see...). Figure 4 F, K, and L). Pollination with wild-type pollen allows for normal fruit setting and seed production (see [reference]). Figure 4 The presence of H, I, and J indicates that the pistil development is also normal.

[0092] Histological sections were prepared from anther tissues at different developmental stages of Slidi2 / AC and AC and stained with toluidine blue. The results are shown in [reference needed]. Figure 5 It was found that the tapetum and mesophyll tissues developed normally, but the male germ cells showed obvious shrinkage and degeneration during the binucleate stage.

[0093] DAPI staining analysis revealed that the male germ cells of the Slidi2 / AC mutant had normal chromosomes during the tetrad and mononuclear pollen stages, but both the vegetative and reproductive nuclei disappeared during the binucleate stage. (See [link to article]). Figure 6 .

[0094] Example 3: Propagation of the #1 mutant strain

[0095] When the Slidi2 / AC mutant flowers were in the bud stage (between stages 6 and 10), they were treated with a 10 ppm (ppm represents parts per million of solute) aqueous solution of dimethylpropenyl diammonium phosphate (+DMAPP), sprayed once every 3 days for a total of 3 times. Then, during the flowering period, pollen viability was tested using the FDA staining method. It was found that pollen quantity and viability significantly increased, and fertility was partially restored. See details... Figure 7 It can self-pollinate and produce fruit; images of the plant with fruit are shown below. Figure 8 See image (a) for seed development. Figure 8 (b)

Claims

1. Application of SlIDI2 protein-related biomaterials in the creation of tomato lines with regulated male sterility; the SlIDI2 protein-related biomaterials are selected from the following (a) or (b): (a) Substances used to silence or inhibit the expression of the gene encoding the SlIDI2 protein in tomatoes or to knock out the gene encoding the SlIDI2 protein; (b) Substances used to reduce or inhibit the activity and / or content of SlIDI2 protein in tomatoes; The amino acid sequence of the SlIDI2 protein is shown in SEQ ID NO.

1.

2. The application as described in claim 1, characterized in that, The relevant biological material is a tomato CRISPR / Cas9 genome editing system, comprising: an expression vector, the expression vector including a Cas9 expression cassette and an sgRNA expression cassette, the Cas9 expression cassette expressing Cas9, the sgRNA expression cassette expressing sgRNA, and the target gene of the sgRNA being the gene encoding the SlIDI2 protein in tomato.

3. The application according to claim 1, characterized in that, The target sequence of the sgRNA is shown in SEQ ID NO.3, and it is located in the tomato gene shown in SEQ ID NO.

2. SlIDI2 The 2057th to 2076th positions, or the target sequence of the sgRNA is the reverse complementary sequence of the sequence shown in SEQ ID NO.

3.

4. A method for creating a tomato line with regulated male sterility, characterized in that, The method includes: obtaining a tomato regulated male sterile line by inhibiting or reducing the activity and / or content of SlIDI2 protein in the tomato genome, or by silencing or inhibiting the expression of the gene encoding SlIDI2 protein in tomato or knocking out the gene encoding SlIDI2 protein. The amino acid sequence of the SlIDI2 protein is shown in SEQ ID NO.

1.

5. The method according to claim 4, characterized in that, The method silences or inhibits the expression of the gene encoding the SlIDI2 protein in tomatoes by mutating the gene encoding the SlIDI2 protein in tomatoes, or knocks out the gene encoding the SlIDI2 protein.

6. The method according to claim 5, characterized in that, The mutation causes a loss of function in the gene encoding the SlIDI2 protein; the mutation is a homozygous mutation.

7. The method according to claim 5, characterized in that, The tomato CRISPR / Cas9 genome editing system was used to induce a mutation in the gene encoding the SlIDI2 protein in tomato. The mutation was a base deletion mutation. The tomato CRISPR / Cas9 genome editing system includes: The expression vector includes a Cas9 expression cassette and an sgRNA expression cassette, wherein the Cas9 expression cassette expresses Cas9 and the sgRNA expression cassette expresses sgRNA, and the target gene of the sgRNA is the gene encoding the SlIDI2 protein in tomato.

8. The method according to claim 7, characterized in that, The target sequence of the sgRNA is shown in SEQ ID NO.3, and it is located in the tomato gene shown in SEQ ID NO.

2. SlIDI2 The 2057th to 2076th positions, or the target sequence of the sgRNA is the reverse complementary sequence of the sequence shown in SEQ ID NO.

3.

9. The method according to claim 7 or 8, characterized in that, The method specifically includes the following steps: S1 The tomato CRISPR / Cas9 genome editing system was introduced into tomato explants, and successfully transformed plants were obtained through screening. S2 is obtained by identifying the successfully transformed plants. SlIDI2 Gene-mutated lines were used to obtain tomato lines with regulated male sterility.

10. The method according to claim 9, characterized in that, The identification was performed using the genome of successfully transformed plants as a template. SlIDI2 Gene fragments are amplified by PCR and then detected by gel electrophoresis or sequencing. SlIDI2 A strain with a homozygous gene mutation.

11. A method for propagating the tomato controllable male-sterile line obtained by any one of claims 4-10, characterized in that, Spraying tomato plants with a dimethylpropenyl diphosphate triammonium salt solution can regulate the flower buds of male-sterile lines, thereby restoring the fertility of the tomato male-sterile lines. Then, through self-pollination, the tomato male-sterile lines can be propagated.

12. The propagation method according to claim 11, characterized in that, The dimethylpropenyl triammonium diphosphate solution is an aqueous solution with a concentration of 10-100 ppm; And / or, the spraying is carried out during the bud stage of the tomato line with adjustable male sterility; And / or, the spraying is carried out once every 3-5 days, for a total of 3-5 sprays.

Images