Molecular markers for identifying chicken feed utilization traits and use thereof

Abstract

The application provides a molecular marker for identifying chicken feed utilization traits and application, and belongs to the technical field of molecular markers. The application provides a molecular marker for identifying chicken feed utilization traits, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1. The application provides a molecular marker for identifying chicken feed utilization traits based on a CKMT2 gene, wherein the mutation of the CKMT2 gene is detected by using an enzyme digestion typing method, the chicken feed utilization traits can be identified according to the genotypes, and further, the breeding of excellent properties can be realized. The application establishes a breeding method for early selection of feed utilization rate of poultry, and the method is simple, rapid, low-cost, does not need special instruments, and is suitable for the needs of experiments.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a molecular marker for identifying traits of chicken feed utilization and its application. Background Technology

[0002] Feed utilization efficiency (FGE) is an important indicator used to measure the efficiency of an animal's use of ingested feed. FGE is closely related to livestock and poultry production levels and economic benefits. FGE is a relatively complex trait; differences in an animal's basal metabolic rate are a contributing factor, as are factors related to the feed itself, the rearing environment, and the feeding method. FGE and residual feed intake are commonly used to assess feed utilization in livestock and poultry. While FGE and residual feed intake are valuable indicators for evaluating feed utilization in the breeding of livestock and poultry with high feed utilization, they are not ideal breeding indicators. Molecular marker-assisted identification of feed utilization is an effective method, but relatively few molecular markers are available for feed utilization in chickens.

[0003] The Wannan Sanhuang Chicken is a superior local poultry breed in Anhui Province, highly favored by consumers for its excellent meat quality and flavor. However, Wannan Sanhuang chickens are generally characterized by a long growth cycle and low feed conversion ratio. Therefore, establishing rapid and effective live breeding techniques is of great significance to improve feed conversion ratio, reduce breeding costs, and increase income in the poultry industry.

[0004] Creatine kinase 2 (CKMT2) is an important member of the creatine kinase (CK) family and a key enzyme involved in energy metabolism in cells. It mainly exists in the form of dimers and octamers. Cassar et al.'s study on the molecular regulation of high muscle mass in bovine fetuses found that differentially expressed genes are related to skeletal muscle development and residual feed intake, among which the CKMT2 gene was upregulated in muscle tissue (Cassar-Malek I, Boby C, Picard B, et al. Molecular regulation of high muscle mass in developing Blonde d'Aquitaine cattle foetuses[J]. Biol Open, 2017, 6(10): 1483-1492.). Santos et al. found that the expression of the energy metabolism gene CKMT2 was affected in lambs through restricted feeding (Santos A, Giraldez FJ, Frutos J, et al. Liver transcriptomic and proteomic profiles of preweaning lambs are modified by milk replacer restriction[J]. J Dairy Sci, 2019, 102(2): 1194-1204.). Reed et al. found that the CKMT2 gene affects feed intake in pregnant sheep through metabolism (Reed SA, Balsbaugh J, Li X, et al. Poor maternal diet during gestation alters offspring muscle proteome in sheep[J]. J Anim Sci, 2022, 100(8): 1529-1542.). The effect of the CKMT2 gene on feed utilization in chickens has not yet been reported. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide a molecular marker for identifying feed utilization characteristics in chickens, specifically SNP molecular markers for candidate genes associated with feed utilization traits, thereby enabling early identification of feed utilization traits.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] This invention provides a molecular marker for identifying chicken feed utilization traits, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] This invention provides a primer set for detecting the molecular marker described in the above technical solution. The nucleotide sequence of the forward primer of the primer set is shown in SEQ ID NO.2; the nucleotide sequence of the reverse primer of the primer set is shown in SEQ ID NO.3.

[0009] This invention provides the application of the molecular markers or primer sets described in the above-mentioned technical solutions in identifying chicken feed utilization traits.

[0010] This invention provides a reagent or kit for identifying traits of chicken feed utilization, wherein the reagent or kit includes the primer set described in the above technical solution.

[0011] This invention provides a method for identifying chicken feed utilization traits, comprising the following steps:

[0012] The primer set described in the above technical solution was used to perform PCR amplification on the genomic DNA of chicken samples to obtain amplification products;

[0013] The amplified product was digested with Tsp45I enzyme, and the feed utilization rate of chickens was determined based on the digestion results.

[0014] Preferably, the method for determining the molecular marker includes electrophoresis or sequencing.

[0015] Preferably, when determining molecular markers by electrophoresis, if the enzyme digestion product:

[0016] I. If it contains one band, it is of the TT type, and the feed utilization rate of this chicken is relatively poor;

[0017] II. If it contains two bands, it is of type CC, and this chicken feed has the best utilization rate.

[0018] III. If it contains 3 bands, it is of the TC type, and the feed utilization rate of this chicken is moderate.

[0019] Preferably, the PCR amplification reaction system is as follows: 25.0 μL of PCR amplification reaction system, 12.5 μL Mix, 0.5 μL each of upstream and downstream primers, 1.0 μL of DNA template and the remaining ddH2O.

[0020] Preferably, the PCR reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 45 s, 58℃ annealing for 45 s, 72℃ extension for 30 s, 31 cycles; 72℃ extension for 10 min.

[0021] The present invention also provides the application of the molecular marker CKMT2 described in the above-mentioned technical solution, the primer set described in the above-mentioned technical solution, the reagent or kit described in the above-mentioned technical solution, or the method described in the above-mentioned technical solution in molecular-assisted breeding.

[0022] The beneficial effects of this invention are:

[0023] This invention provides a molecular marker for identifying chicken feed utilization traits, the nucleotide sequence of which is shown in SEQ ID NO.1. This invention provides a molecular marker for identifying chicken feed utilization traits based on the CKMT2 gene. Mutations in the CKMT2 gene are detected using enzyme digestion and genotyping methods, allowing for the identification of chicken feed utilization traits based on genotype, and further enabling the selection of superior traits. This invention establishes a breeding method for early selection of poultry feed utilization; this method is simple, rapid, low-cost, requires no special equipment, and is suitable for experimental needs. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 This is a graph showing the electrophoresis results of PCR amplification products;

[0026] Figure 2 This is a graph showing the electrophoresis results of the enzyme digestion products;

[0027] Figure 3 The image shows the sequencing results of the enzyme digestion products. Detailed Implementation

[0028] This invention provides a molecular marker for identifying chicken feed utilization traits, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0029] SEQ ID NO.1:

[0030] 5’-GAGTGTCTCAGCAGAGACTTGATGGTGTTTAGTACACTTCCAAAGC TCATCAAGATCTATTTCATGGTTGCCCCAGGTAGCAGAAAGCTGCAATTGTATGTGCAGTTATTCATCTGTGCACAGTTTGGGGCATTTTGAGTGACCTGAATGTTCCTCCCCTCCTAAATATTTGGTCCAGGGTATAAACAGAGAACTAATCGTACTTTCAAATCATGCAGTATACTTCATATGTCATTATCCCTTTAATAGTTCTGTGAACTAGCAAAGATCACTGTTCAAAGTTACAGTGTTAATTGCTTGGGATGTTATTTGTCTTCAGCGCAGACTACCCAGATCTTCGCAAGCACAACAACTGCATGGCTGAGTGTCTCACCCCAGCCATTTATGCTAAGCTGAGGGACAAGCTGACTCCCAATGGCTACAGCCTGGACCAGTGCATCCAGACTGGGGTGGACAATCCTGGCCATCCTTTCATTAAAACTGTCGGCATGGTTGCAGGTGATGAAGAATCCTATGAGGTAAAATGCTTTCATAAAATTATTGTGTTTGTTGCTGTTTTATGGTCATTAGTTGAACAGTGCTTCCTGGCAGAGTACGCGCTCCTAAGATAAATAATATTCCAGAGAGTACATGAGAGGCAGGCCATGTTTATAAAGACAGTGTATTCTCTACTCTTCCACATTAGAAAATGCACAAACATGAGGCATTGCTACAGGTAACATCTCTGCTGCAGTCAAAGCTAATTAAGTACAGCTGCTTTAGAGCAATATTCTACCTGCCTCCAGCAGCTGCCCTTCTTCCTACAACTAAACTTAGTTTATGGCAAAACTATGCTACCCTGAGATACACAAGATGAAGGTAATGTGAAAATTGTACTGCGGAACACCTAAGGCAGAAATGAAATGAAAATGTCTTCTGGGAACTGCCAGACACCTTTAAGCTACAGCTATTGGATCATGA-3’。

[0031] In this invention, the feed utilization rate of chickens is improved when the base at position 503 of the molecular marker is mutated from T to C. In this invention, if the base at position 503 of the molecular marker is mutated from T to C, it can be recognized and cleaved by the restriction endonuclease Tsp45I. This characteristic allows for rapid and accurate screening of chicken feed utilization traits. In this invention, if the base at position 503 of the molecular marker is C, it can be recognized and cleaved by Tsp45I, and two bands can be detected by electrophoresis; if the base at position 503 of the molecular marker is T, it cannot be recognized and cleaved by Tsp45I, and one band can be detected by electrophoresis; if the base at position 503 of the molecular marker includes both T and C, three bands can be detected by electrophoresis.

[0032] This invention provides a primer set for detecting the molecular marker described in the above technical solution. The nucleotide sequence of the forward primer of the primer set is shown in SEQ ID NO.2 (5'-TCTTCAGCGCAGACTACC-3'); the nucleotide sequence of the reverse primer of the primer set is shown in SEQ ID NO.3 (5'-CCATAAAACAGCAACAAAC-3').

[0033] The target fragment amplified by the primer set provided by the present invention is preferably 251 bp in length, and the nucleotide sequence of the target fragment is shown in SEQ ID NO.4.

[0034] SEQ ID NO.4:

[0035] 5'-TCTTCAGCGCAGACTACCCAGATCTTCGCAAGCACAACAACTGCAT GGCTGAGTGTCTCACCCCAGCCATTTATGCTAAGCTGAGGGACAAGCTGACTCCCAATGGCTACAGCCTGGACCAGTGCATCCAGACTGGGGTGGACAATCCTGGCCATCCTTTCATTAAAACTGTCGGCATGGTTGCAGGTGATGAAGAATCCTATGAGGTAAAATGCTTTCATAAAATTATTGTGTTTGTTGCTGTTTTATGG-3'.

[0036] In this invention, the molecular marker site of the target fragment is located at the 191st base.

[0037] This invention determines chicken feed utilization traits by detecting whether the base at position 191 of the target fragment amplified using the above primer set is T or C. Alternatively, this invention determines chicken feed utilization traits by digesting the target fragment amplified using the above primer set with the Tsp45I restriction endonuclease and detecting the number of bands after digestion.

[0038] This invention provides an application of the molecular markers or primer sets described in the above-mentioned technical solutions in identifying feed utilization traits in chickens. This invention, through the molecular markers or primer sets described in the above-mentioned technical solutions, can rapidly and accurately screen for traits with high feed utilization in chickens.

[0039] This invention provides a reagent or kit for identifying traits related to chicken feed utilization, wherein the reagent or kit includes the primer set described in the above-mentioned technical solution. Preferably, the reagent or kit further includes the restriction endonuclease Tsp45I. The restriction endonuclease Tsp45I described in this invention is preferably purchased from Beijing Bio-Labs Technology Co., Ltd.

[0040] The present invention also provides a method for identifying chicken feed utilization traits, comprising the following steps:

[0041] The primer set described in the above technical solution was used to perform PCR amplification on the genomic DNA of chicken samples to obtain amplification products;

[0042] The amplified product was digested with Tsp45I enzyme, and the feed utilization rate of chickens was determined based on the digestion results.

[0043] The present invention utilizes the primer set described in the above technical solution to perform PCR amplification on chicken sample genomic DNA to obtain amplification products.

[0044] This invention preferably extracts genomic DNA from chicken samples by extracting venous blood from chicken wings. The method for extracting genomic DNA is not particularly limited in this invention; any conventional method in the art can be used. This invention preferably uses a blood DNA extraction kit produced by Tiangen Biotech Co., Ltd. to extract genomic DNA from chicken samples. In this invention, the PCR amplification reaction system is preferably as follows: 25.0 μL of PCR amplification reaction system, 12.5 μL of Mix, 0.5 μL each of forward and reverse primers, 1.0 μL of DNA template, and the remaining ddH2O. In this invention, the PCR reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 45 s, 58℃ annealing for 45 s, 72℃ extension for 30 s, 31 cycles; 72℃ extension for 10 min. After the PCR reaction is completed, the PCR product is obtained.

[0045] After obtaining the PCR product, the present invention digests the amplified product with Tsp45I enzyme, and judges the chicken feed utilization trait based on the digestion results.

[0046] In this invention, the method for determining the molecular marker preferably includes electrophoresis or sequencing, more preferably electrophoresis. When determining the molecular marker by electrophoresis, if the enzyme digestion product contains one band, it is of the TT type, indicating poor feed utilization in chickens; if the enzyme digestion product contains two bands, it is of the CC type, indicating the best feed utilization in chickens; if the enzyme digestion product contains three bands, it is of the TC type, indicating moderate feed utilization in chickens. When determining the molecular marker by sequencing, if the base at position 191 of the amplified product is C, the feed utilization in chickens is the best; if the base at position 191 of the amplified product is both T and C, the feed utilization in chickens is moderate; if the base at position 191 of the amplified product is T, the feed utilization in chickens is poor. This invention further verifies the accuracy of the electrophoresis results through sequencing.

[0047] The present invention also provides the application of the molecular markers, primer sets, reagents or kits, or methods described in the above technical solutions in molecular-assisted breeding.

[0048] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0049] Example 1

[0050] 1. Primer design

[0051] The DNA sequence corresponding to the gene CKMT2 shown in SEQ ID NO.1 was found in the chicken genome database. Using the CKMT2 gene DNA sequence as a template, a specific amplification primer set was designed. The nucleotide sequence of the forward primer is shown in SEQ ID NO.2 (5'-TCTTCAGCGCAGACTACC-3'), and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3 (5'-CCATAAAACAGCAACAAAC-3'). The amplifiable region of this primer set is 251 bp in length, containing a T / C mutation molecular marker site. The mutation molecular marker site is the 191st base of the amplification product.

[0052] 2. Extract total DNA from blood

[0053] Forty-eight local roosters were selected, and blood was collected from their wing veins. Total DNA was extracted from the blood. The total DNA was extracted from the chicken wing vein blood samples using a blood DNA extraction kit produced by Tiangen Biotech Co., Ltd. The extraction steps were performed according to the kit instructions.

[0054] 3. PCR amplification

[0055] Using Mix produced by Shanghai Yisheng Biotechnology Co., Ltd., the target fragment of the CKMT2 gene was amplified by PCR using the sequencing-specific primers designed and synthesized in step 1. The PCR amplification system is shown in Table 1.

[0056] Table 1 PCR amplification system

[0057] DNA template 1.0μL Forwardprimer 0.5μL Reveresprimer 0.5μL Mix 12.5μL <![CDATA[ddH2O]]> 10.5μL total 25.0μL

[0058] The PCR reaction conditions were as follows: 95℃ pre-denaturation for 5 min; first step denaturation at 95℃ for 45 s; second step annealing at 58℃ for 45 s; third step extension at 72℃ for 30 s, with the second and third steps repeated 31 times for a total of 32 cycles; and the extension at 72℃ for 10 min.

[0059] 4. Detection and sequencing of PCR amplification products

[0060] PCR amplification products were detected using 2% agarose gel electrophoresis, such as... Figure 1 As shown, after imaging with a gel imaging system, a band of approximately 250 bp in length was obtained, consistent with the predicted length, indicating that the target fragment was obtained. The PCR product was sent to Beijing Qingke Biotechnology Co., Ltd. (Nanjing), and the result was consistent with the prediction.

[0061] 5. Enzyme digestion typing

[0062] The PCR amplification products were digested with the Tsp45I restriction endonuclease from Beijing BioLabs Technology Co., Ltd. The specific steps are as follows:

[0063] (1) The preparation of the enzyme digestion system is shown in Table 2.

[0064] Table 2 Enzyme digestion system

[0065] PCR amplification products 2.0μL Tsp45I 1.0μL buffer 1.0μL <![CDATA[ddH2O]]> 6.0μL total 10.0μL

[0066] Enzyme digestion conditions: 65℃ water bath for 2 hours.

[0067] (2) Electrophoresis was performed using a 2% agarose gel under low voltage conditions. The results are as follows: Figure 2 The results are shown in the image (partial).

[0068] Among them, if the enzyme digestion product contains 1 band, it is of the TT type; contains 2 bands, it is of the CC type; and contains 3 bands, it is of the TC type.

[0069] 6. Enzyme digestion and sequencing verification

[0070] Statistical analysis of the gene genotyping gel images yielded three genotypes: TT, TC, and CC. One individual was selected for each of these three genotypes for sequencing alignment. The sequencing alignment graph is shown below. Figure 3 As shown in the sequencing results, T mutated to C, and the arrows indicate the mutation locations, which is consistent with the enzyme digestion typing results.

[0071] Example 2

[0072] 1. Using 468 Wannan Sanhuang chickens aged 56–98 days as experimental materials, the feed intake (ADFI), average daily weight gain (ADG), and metabolite body weight gain (MBW) of Wannan Sanhuang chickens were statistically analyzed. 0.75 ), feed conversion ratio (FCR), and residual feed intake (RFI).

[0073] Using the genotyping method described in Example 1, genotyping was performed on 468 Anhui Sanhuang chickens, and the results are shown in Table 3.

[0074] Table 3. Genotype detection results for individuals with different phenotypes

[0075]

[0076] Chi-square test results showed that the experimental chicken population was in Hardy-Weinberg equilibrium (P>0.05).

[0077] 2. Statistical Analysis

[0078] The association between the three genotypes and the chicken feed utilization trait was analyzed using the least squares method in SAS 9.4 software. The association analysis results between different genotypes and each trait are shown in Table 4.

[0079] Table 4. Association analysis between chicken CKMT2 genotype and chicken feed utilization rate trait

[0080]

[0081] Note: Different lowercase letters in the same row indicate significant differences (P < 0.05).

[0082] Table 4 shows that, through comparison of feed efficiency traits among individuals with different genotypes, CC individuals were significantly lower than TT and TC individuals in terms of RFI, FCR, and ADFI (P < 0.05). It can be concluded that CC genotype individuals had the best feed utilization trait, TC genotype individuals had a moderate feed utilization trait, and TT genotype individuals had a poor feed utilization trait.

[0083] In summary, the molecular markers for identifying chicken feed utilization traits provided by this invention can be used to identify the feed utilization properties of chickens based on their genotypes, and further enable the selection and breeding of superior traits.

[0084] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of reagents or kits for detecting molecular markers in identifying feed utilization traits in chickens, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; when the base at position 503 of the molecular marker is TT, the feed utilization trait of the chicken is poor; when the base at position 503 of the molecular marker is TC, the feed utilization trait of the chicken is moderate; when the base at position 503 of the molecular marker is CC, the feed utilization trait of the chicken is best. The chicken in question is the Anhui Sanhuang Chicken.

2. The application according to claim 1, characterized in that, The reagent includes a primer set for detecting the molecular marker, wherein the nucleotide sequence of the forward primer of the primer set is shown in SEQ ID NO.2; and the nucleotide sequence of the reverse primer of the primer set is shown in SEQ ID NO.

3.

3. The application according to claim 1, characterized in that, The kit includes a primer set for detecting the molecular marker, the nucleotide sequence of the forward primer of the primer set being shown in SEQ ID NO.2; and the nucleotide sequence of the reverse primer of the primer set being shown in SEQ ID NO.

3.

4. A method for identifying chicken feed utilization traits using the molecular markers described in claim 1, characterized in that, Includes the following steps: Using the primer set described in claim 2, PCR amplification was performed on the genomic DNA of a chicken sample to obtain the amplification product; The amplified product was digested with Tsp45I enzyme, and the chicken feed utilization trait was determined based on the digestion results. The methods for determining the molecular markers include electrophoresis or sequencing; When determining molecular markers via electrophoresis, if the enzyme digestion products: I. If it contains one band, it is of the TT type, and the feed utilization rate of this chicken is relatively poor; II. If it contains two bands, it is of type CC, and this chicken feed has the best utilization rate. III. If it contains 3 bands, it is of the TC type, and the feed utilization rate of this chicken is moderate. The chicken in question is the Anhui Sanhuang Chicken.

5. The method according to claim 4, characterized in that, The PCR amplification reaction system consisted of 25.0 μL of 12.5 μL Mix, 0.5 μL each of forward and reverse primers, 1.0 μL of DNA template, and the remaining ddH2O.

6. The method according to claim 4, characterized in that, The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 45 s, 58℃ annealing for 45 s, 72℃ extension for 30 s, for 31 cycles; 72℃ extension for 10 min.

Images