Method for cloning tomato late blight resistance gene ltpg1 and application thereof

Abstract

The application provides a cloning method and application of a tomato anti-late blight gene LTPg1, and the cloning method comprises the following steps: taking cDNA of tomato early powder No.2 as a template to perform PCR amplification, connecting the obtained PCR product with a pMD-19T cloning vector, transforming E.coli DH5alpha, picking single colonies to extract plasmids, performing plasmid PCR, and then sending the plasmid for sequencing, and the plasmid consistent with LTPg1 is the correct plasmid connected with the pMD-19T; and the application also provides application of the tomato anti-late blight gene LTPg1 in tomato anti-late blight. The anti-late blight gene LTPg1 can enhance the resistance of tomatoes to late blight after overexpression. In addition, overexpression of LTPg1 can also up-regulate the expression amount of other PR genes, and the application lays a foundation for revealing the molecular mechanism of nsLTPs participating in tomato anti-late blight.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the cloning method and application of the tomato late blight resistance gene LTPg1. Background Technology

[0002] Tomatoes are annual or perennial herbaceous plants belonging to the genus *Solanum* of the Solanaceae family. Tomato fruits are rich in nutrients and have a distinctive flavor. Late blight, caused by the pathogenic fungus *Phytophthora infestans* (P. infestans), significantly impacts tomato yield and quality, and spreads rapidly once it occurs. Currently, pesticide spraying is one of the most effective methods for controlling late blight, but the resulting environmental pollution and fungal resistance issues still pose significant challenges to agricultural production. Therefore, researching the molecular mechanisms of tomato disease resistance and utilizing biological methods to improve tomato resistance to late blight has become a crucial issue.

[0003] Nonspecific lipid transfer proteins (nsLTPs) are a class of secretory proteins with a lifespan of 9–10 kDa. These proteins exhibit broad and uncertain lipid transfer activity, meaning they can transport various lipid substances across the membrane, including phospholipids, glycolipids, and fatty acids. The N-terminus of nsLTPs contains a hydrophobic signal peptide, a short peptide chain that guides the transfer of newly synthesized nsLTP proteins into the secretory pathway. Near the C-terminus, nsLTPs possess a calmodulin (CaM) binding site, which regulates the binding of nsLTPs to CaM. 2+ The interaction between nsLTPs and other microbial proteins is a key factor in plant disease resistance. The important role of nsLTPs in plant disease resistance has been widely reported. For example, overexpression of LTPs in European rapeseed can enhance resistance to *Sclerotinia sclerotiorum* by increasing the activity of ROS-scavenging enzymes; overexpression of LTP5 enhances resistance to *Fusarium graminearum* and *Colocynium graminearum* in wheat; and heterologous expression of LTP members CALTPI and CALTPII in tobacco significantly improves the disease resistance of transgenic tobacco.

[0004] LTPg1 (Solyc10g075100) is a member of the nonspecific lipid transfer protein gene family in tomato. Furthermore, the 5th International Symposium on Disease-Related Proteins classified nsLTPs into the PR family of plant disease-related proteins and named it PR-14, indicating that nsLTPs proteins may be involved in plant responses to biotic stresses such as disease resistance and antibacterial activity. Resequencing 30 genes in a Chilean tomato population revealed that LTPg1 responds to salt stress (… KB, Nosenko T, Stephan W. Signatures of natural selection in abiotic stress-responsive genes of Solanum chilense[J]. Royal Society open science, 2018, 5(1): 171-198.); After pathogenic and non-pathogenic Fusarium wilt strains infected commercial tomato 1 (CT1), the expression level of LTPg1 was upregulated (López WR, Garcia-Jaramillo DJ, Ceballos-Aguirre N, et al. Transcriptional responses to Fusarium oxysporum f.sp.lycopersici (Sacc.) Snyder & Hansen infection in three Colombian tomato cultivars[J]. BMC Plant Biology, 2021, 21: 1-14.); In the xylem sap of tomatoes infected with Fusarium oxysporum after knocking out effector Six5, the protein abundance of LTPg1 changed specifically (Gawehns F, Ma L, Bruning O, et al. The effector repertoire of Fusarium oxysporum determines the tomato xylem proteome composition following infection [J]. Frontiers in Plant Science, 2015, 6: 967.).

[0005] Currently, most functional studies of nsLTPs are limited to abiotic stress, with insufficient research on biotic stress. Besides, nsLTPs have been studied in other Solanaceae plants, but research on tomatoes is limited and mostly focuses on bacteria and fungi; there are currently no reports on oomycetes. Summary of the Invention

[0006] This invention provides a method for cloning and applying the tomato late blight resistance gene LTPg1.

[0007] The technical solution is as follows:

[0008] A method for cloning the tomato late blight resistance gene LTPg1 includes the following steps:

[0009] S1 used the cDNA of Tomato Early Powder No. 2 as a template and performed PCR amplification using specific primers;

[0010] The specific primers are as follows:

[0011] LTPg1-FP: GCGGATCCATGGAAATGGTTAACAAGATTGCA

[0012] LTPg1-RP: CGGAGCTCTTACTGAACTTTAGAGCAGTCA

[0013] S2 ligates the obtained PCR product with the pMD-19T cloning vector to obtain the ligation product pMD-19T-LTPg1;

[0014] S3 transformed the ligation product pMD-19T-LTPg1 into Escherichia coli DH5α and plated it on LB solid medium containing ampicillin. Single colonies were picked, and after shaking, plasmids were extracted. Plasmid PCR was performed, and the plasmids were sent for sequencing. The plasmid that matched LTPg1 was the correct plasmid for ligating pMD-19T and was recorded as pMD-19T-LTPg1 plasmid.

[0015] The screening method for the tomato late blight resistance gene LTPg1 includes the following steps:

[0016] Preliminary screening of S1 target nsLTPs

[0017] 1) Bioinformatics predictive analysis identified members of the nsLTP gene family and compared them with the transcriptome library of tomatoes infected by Late Blight pathogens constructed in the laboratory in the early stage, and preliminarily screened out nsLTPs that can respond to Late Blight pathogen infection;

[0018] 2) Bioinformatics predictive analysis for tissue specificity: From the nsLTPs obtained in the previous step, further screening was conducted to identify nsLTPs that could be specifically expressed in leaves;

[0019] 3) Promoter cis-acting element analysis to screen for genes that theoretically have stress resistance functions, and further screen for nsLTPs that may be responsive to stresses such as hormones, low temperature, and trauma from the nsLTPs obtained in the previous step;

[0020] S2 late blight fungus treatment tomato plants

[0021] The bacterial solution inoculated with Late Blight was evenly sprayed onto tomato plants at the five-leaf stage. The plants were first cultured overnight in the dark, and then cultured under 16h light / 8h dark conditions. Tomato leaves were taken at different time points of 0h, 3h, 6h, 12h, 24h, 48h, and 72h and quickly frozen in liquid nitrogen.

[0022] S3 RNA extraction and reverse transcription

[0023] After grinding the sample described in S2 with liquid nitrogen, it was placed in RNAiso Plus to extract RNA and then reverse transcribed into cDNA.

[0024] Initial determination of S4 LTPg1

[0025] Using the cDNA described in S3 as a template, primers specifically for nsLTPs were designed and preliminarily screened. The gene expression levels of the target nsLTPs at different time points were detected by real-time quantitative PCR. Finally, Solyc10g075100, which can respond to infection by Late Pulmonaria, was identified and denoted as LTPg1.

[0026] The acquisition of tomato plants and the cultivation of late blight pathogens in S2 include the following steps:

[0027] 1) Soak the seeds of Early Pink No. 2 tomato in water overnight for cultivation. Then, germinate them on a culture plate with moist filter paper at 28℃. After germination, sow them in soil and cultivate them at 28℃ with 16 hours of light and 8 hours of darkness. When they grow to the five-leaf stage, they can be used for subsequent experiments.

[0028] 2) Inoculation of Late Blight Pathogen: Inoculate Late Blight Pathogen onto oat medium and incubate at 20°C for about one month. Scrape the mycelium and place it in a 4°C refrigerator to promote the release of zoospores. Collect the filtrate using three layers of filter cloth and count the number of spores under a microscope using a hemocytometer. Dilute with sterile water to a concentration of 1×10⁻⁶. 6 Spores / mL.

[0029] This invention also provides the application of the tomato late blight resistance gene LTPg1 in tomato resistance to late blight.

[0030] The application includes the following steps:

[0031] S1 The recombinant expression vector containing the tomato late blight resistance gene LTPg1 was introduced into Agrobacterium GV3101 competent cells and plated on YEB solid medium containing kanamycin, streptomycin and rifampin. Single colonies were picked for bacterial PCR verification.

[0032] S2 uses five-leaf stage tomatoes as the treatment object, and injects the prepared positive engineered bacterial solution into the leaves of the five-leaf stage tomatoes to achieve overexpression of the LTPg1 gene.

[0033] The recombinant expression vector containing the tomato late blight resistance gene LTPg1 was obtained by inserting the tomato late blight resistance gene LTPg1 into the pBI121 expression vector.

[0034] The method for constructing the recombinant expression vector containing the tomato late blight resistance gene LTPg1 specifically includes digesting the pMD-19T-LTPg1 plasmid with BamHI and SacI, recovering the target fragment, ligating the target fragment with the pBI121 expression vector with the GUS gene removed, transforming the ligation product into Escherichia coli DH5α and spreading it on LB solid medium containing kanamycin, picking single colonies and shaking them to extract the plasmid, performing plasmid PCR identification, and then sending the plasmid for sequencing. The plasmid with correct sequencing is the recombinant expression vector pBI121-LTPg1.

[0035] The beneficial effects of this invention are as follows:

[0036] 1. There are currently no reports on nsLTPs and tomato late blight. The late blight resistance gene LTPg1 described in this invention, when overexpressed, can enhance the resistance of tomatoes to late blight.

[0037] 2. At the 5th Symposium on Disease-Related Proteins, nsLTPs were also classified as members of the disease-related protein family and named PR-14. In this invention, overexpression of LTPg1 also upregulated the expression levels of other PR genes. This invention lays the foundation for revealing the molecular mechanism by which nsLTPs participate in the resistance of tomatoes to late blight.

[0038] 3. The nsLTP gene family has many members. Bioinformatics prediction is used for preliminary screening to narrow down the research subjects, reducing costs and workload. However, the final determination of the target gene cannot rely solely on bioinformatics analysis; it must be combined with experimental data for a more convincing conclusion. By spraying five-leaf stage tomato seedlings with Phytophthora blight, samples were taken at different time points. RNA was extracted, reverse transcribed into cDNA, and analyzed using real-time quantitative PCR. This allowed us to determine whether the expression level of the target gene changed significantly over time after Phytophthora blight infection of tomato leaves, thus assessing whether the target gene responded to infection by the pathogen. Based on these results, the research subjects were finally determined. Attached Figure Description

[0039] Figure 1 The expression level of the LTPg1 gene at different time points after infection with Phytophthora infestans.

[0040] Figure 2 To assess the expression level of LTPg1 and its disease resistance.

[0041] Figure 3 This represents the expression levels of other PR genes. Detailed Implementation

[0042] Example 1

[0043] A method for screening the tomato late blight resistance gene LTPg1 includes the following steps:

[0044] 1. Preliminary screening of nsLTPs

[0045] 1) Bioinformatics predictive analysis identified members of the nsLTP gene family and compared them with the transcriptome library of tomatoes infected by Late Blight pathogens constructed in the laboratory in the early stage, and preliminarily screened out nsLTPs that can respond to Late Blight pathogen infection;

[0046] 2) Bioinformatics predictive analysis for tissue specificity: From the nsLTPs obtained in the previous step, further screening was conducted to identify nsLTPs that could be specifically expressed in leaves;

[0047] 3) Promoter cis-acting element analysis to screen for genes that theoretically have stress resistance functions, and further screen for nsLTPs that may be responsive to stresses such as hormones, low temperature, and trauma from the nsLTPs obtained in the previous step;

[0048] 2. Obtaining tomato plants and cultivating late blight pathogen

[0049] 1) Soak the seeds of Early Pink No. 2 tomato in water overnight for cultivation. Then, germinate them on a culture plate with moist filter paper at 28℃. After germination, sow them in soil and cultivate them at 28℃ with 16 hours of light and 8 hours of darkness. When they grow to the five-leaf stage, they can be used for subsequent experiments.

[0050] 2) Inoculation of Late Blight Pathogen: Inoculate Late Blight Pathogen onto oat medium and incubate at 20°C for about one month. Scrape the mycelium and place it in a 4°C refrigerator to promote the release of zoospores. Collect the filtrate using three layers of filter cloth and count the number of spores under a microscope using a hemocytometer. Dilute with sterile water to a concentration of 1×10⁻⁶. 6 Spores / mL.

[0051] Tomato plants treated with Phytophthora blight for 3 nights

[0052] The bacterial solution inoculated with Late Blight was evenly sprayed onto tomato plants at the five-leaf stage. The plants were first cultured overnight in the dark, and then cultured under 16h light / 8h dark conditions. Tomato leaves were taken at different time points of 0h, 3h, 6h, 12h, 24h, 48h, and 72h and quickly frozen in liquid nitrogen.

[0053] 4. RNA extraction and reverse transcription

[0054] After grinding the sample described in step 3 with liquid nitrogen, place it in RNAiso Plus to extract RNA (see instruction manual and steps for details) and then reverse transcribe it into cDNA;

[0055] Initial determination of 5LTPg1

[0056] Using the cDNA described in section 4 as a template, primers specifically targeting nsLTPs were designed based on preliminary screening. The gene expression levels of the target nsLTPs at different time points were detected by real-time quantitative PCR. Finally, Solyc10g075100, designated as LTPg1, was identified as the nsLTP that responds to infection by *Phytophthora infestans*. Figure 1 As shown.

[0057] Example 2

[0058] A method for cloning the tomato late blight resistance gene LTPg1 includes the following steps:

[0059] 1. Extraction and reverse transcription of RNA from tomatoes

[0060] (1) Grind the tomato leaves into powder in a mortar containing liquid nitrogen, transfer the sample to a 1.5ml RNase-free centrifuge tube, let it stand in 1ml of pre-cooled RNAiso Plus at room temperature for 5min, and centrifuge at 4℃ and 12000rpm for 5min.

[0061] (2) Retain the supernatant, add 200 μL of chloroform, mix by inverting, and centrifuge at 4°C and 12,000 rpm for 10 min.

[0062] (3) Take 300 μL of supernatant and transfer it to a new RNase-free centrifuge tube. Add an equal amount of isopropanol, mix well, let stand at room temperature for 5 min, and centrifuge at 4℃ and 12000 rpm for 10 min.

[0063] (4) Keep the precipitate, add 1 ml of 75% ethanol (prepared fresh) to wash the precipitate, and centrifuge at 4℃ and 12000 rpm for 5 min.

[0064] (5) Discard the supernatant, air dry for 5 minutes, and add 25 μL of enzyme-free ddH2O to dissolve the RNA.

[0065] (6) The RNA obtained above was reverse transcribed into cDNA. The reaction system is as follows:

[0066]

[0067] The reaction conditions were 37℃ for 15 min and 85℃ for 5 s.

[0068] 2. PCR amplification of the LTPg1 gene

[0069] Using the cDNA of Tomato Early Powder No. 2 as a template, specific primers were designed for PCR amplification.

[0070] The specific primers used for cloning are as follows:

[0071] LTPg1-FP: GCGGATCCATGGAAATGGTTAACAAGATTGCA

[0072] LTPg1-RP: CGGAGCTCTTACTGAACTTTAGAGCAGTCA

[0073] The reaction system is as follows:

[0074]

[0075] The reaction conditions are as follows:

[0076]

[0077] 3. Recovery and purification of PCR amplification products

[0078] After detecting the PCR products by 1% agarose gel electrophoresis, the PCR products that meet the target fragment size are recovered using a gel extraction kit (purchased from Takara).

[0079] 4. Ligation of the target fragment with the cloning vector

[0080] The target fragment obtained above was ligated with the cloning vector pMD-19T (purchased from Takara), and the reaction system is as follows:

[0081]

[0082] The ligation product pMD-19T-LTPg1 was obtained by ligation at 16℃ for 8 hours.

[0083] 5. Transformation of ligation products into E. coli

[0084] (1) Add 10 μL of the ligation product reaction solution to 100 μL of Escherichia coli DH5α competent cells, mix gently and place on ice for 30 min, then transfer to a 42℃ constant temperature water bath for 90 s heat shock, and immediately place on ice for 2-3 min after removal.

[0085] (2) Add 900 μL of antibiotic-free LB liquid medium at 37℃, mix thoroughly, and incubate at 37℃ and 180 rpm for 1-1.5 h with shaking.

[0086] (3) Centrifuge at 4000 rpm for 5 min at room temperature, discard the supernatant, suspend the remaining liquid and spread it on LB solid medium plates (containing 50 mg / L ampicillin), let the liquid dry and place it in a 37℃ incubator for 14-16 h.

[0087] (4) Pick a single white colony and inoculate it into LB liquid medium containing 50 mg / L ampicillin. Incubate overnight at 37°C with shaking at 180 rpm.

[0088] 6. Extraction of pMD-19T-LTPg1 plasmid

[0089] Following the instructions of the plasmid miniprep kit (purchased from TIANGEN), the pMD-19T-LTPg1 plasmid was extracted from the bacterial culture. A 3 μL sample of the plasmid was then analyzed by 1% agarose gel electrophoresis.

[0090] 7. Plasmid PCR detection

[0091] Using the extracted pMD-19T-LTPg1 plasmid as a template, PCR was performed using LTPg1-FP and LTPg1-RP primers. The reaction conditions and reaction system were the same as in "Example 2, 2".

[0092] 8. Sequencing

[0093] The obtained plasmids were sent to BGI Genomics (Beijing) Co., Ltd. for sequencing. The sequencing results were analyzed, and the plasmids that matched LTPg1 were the correct ones for linking pMD-19T.

[0094] Example 3

[0095] Construction of a recombinant expression vector for the tomato late blight resistance gene SlLTPg1

[0096] 1. Enzyme digestion of pMD-19T-LTPg1 plasmid

[0097] The pMD-19T-LTPg1 plasmid was double-digested with BamHI and SacI (purchased from Takara), and the target fragment, i.e., the small fragment, was recovered. The enzyme digestion reaction system and method are as follows:

[0098]

[0099] The enzyme was digested at 37℃ for 2 hours, and the digestion products were detected by 1% agarose gel electrophoresis.

[0100] 2. Double digestion of pBI121 vector plasmid

[0101] The pBI121 plasmid was double-digested with BamHI and SacI to remove the GUS gene, and the pBI121 fragment (the larger fragment) was recovered. The reaction system is as follows:

[0102]

[0103] The enzyme was digested at 37℃ for 2 hours, and the digestion products were detected by 1% agarose gel electrophoresis.

[0104] 3. Connection

[0105]

[0106] Ligation was performed at 16℃ for 4 hours. The ligation product was then transformed into *E. coli* DH5α competent cells, plated on LB medium (containing 50 mg / L kanamycin), air-dried, and incubated at 37℃ for 14-16 hours. Single colonies were picked and shaken to extract plasmids. Plasmid PCR was performed, and the plasmids were sequenced. The plasmids with correct sequencing results were the recombinant expression vector pBI121-LTPg1.

[0107] Example 3: Application of the tomato late blight resistance gene LTPg1

[0108] 1. Preparation of pBI121-LTPg1 Agrobacterium engineered strain

[0109] (1) Add 2 μL of pBI121-LTPg1 plasmid to 100 μL of Agrobacterium GV3101 competent cells, mix thoroughly by pipetting, freeze in liquid nitrogen for 2 min, and heat in a water bath at 37°C for 5 min.

[0110] (2) Add 1 ml of sterile YEB medium and incubate at 28°C and 180 rpm for 3 h with shaking.

[0111] (3) Centrifuge at 12,000 rpm at room temperature, discard the supernatant, suspend the remaining cells and spread them onto YEB solid medium (containing 100 mg / L streptomycin, 100 mg / L rifampin and 50 mg / L kanamycin), and incubate in an inverted incubator at 28°C for 48 h.

[0112] 2. Identification of Agrobacterium-derived engineered strains

[0113] (1) Pick single colonies obtained from the above bacterial plates after antibiotic screening and transfer them to 1 ml of YEB liquid medium (containing 100 mg / L streptomycin, 100 mg / L rifampin and 50 mg / L kanamycin) and culture at 28°C and 180 rpm for 14-16 h with shaking.

[0114] (2) Bacterial PCR

[0115] The cultured bacterial solution was then verified by PCR. The reaction system is as follows:

[0116]

[0117] After detecting the PCR products by 1% agarose gel electrophoresis, the bacterial solution with the correct band size was mixed with an equal volume of 50% glycerol and stored at -20°C.

[0118] 2. Establishment and related detection of transient infection system

[0119] (1) Add 2-3 ml of sterile water to the plate containing *Phytophthora infestans*, gently scrape off the mycelia and spores from the surface of the culture medium, filter with sterile gauze, and transfer the obtained bacterial solution to a 50 ml Erlenmeyer flask. Adjust the final concentration of the bacterial solution to 1 × 10⁻⁶. 6 Spores / mL, and place in a 4℃ refrigerator for about 3 hours to allow the spores to fully release and move;

[0120] (2) Agrobacterium tumefaciens containing pBI121 empty vector (EV) and pBI121-LTPg1 was inoculated into 5 ml YEB liquid medium (containing 100 mg / L streptomycin, 100 mg / L rifampin and 50 mg / L kanamycin) and cultured at 28°C with shaking at 180 rpm for 12-16 h.

[0121] (3) Transfer 1 ml of the above bacterial culture to 50 ml of YEB liquid medium (containing 100 mg / L streptomycin, 100 mg / L rifampin, 50 mg / L kanamycin, 20 μmol / L acetylsalicylic acid, 2 mmol / L magnesium sulfate, and 10 mmol / L morpholine ethanesulfonic acid monohydrate), shake and culture for 20 h, centrifuge at 4000 rpm for 15 min at 4℃, discard the supernatant and collect the bacterial cells;

[0122] (4) Resuspend the bacterial cells and adjust the OD with infection medium MMA (containing 10 mmol / L morpholine ethanesulfonic acid monohydrate, 20 μmol / L acetylsalicylic acid and 10 mmol / L magnesium chloride, pH=5.6). 600 Incubate at 1.0°C, 28°C, and 180 rpm for 3-4 hours with shaking to activate Agrobacterium.

[0123] (5) Select several tomato plants with uniform growth at the five-leaf stage, place them under weak light for 1-2 hours, use fine sandpaper to polish and remove the needle of a disposable syringe, inject 200 μL of the above-mentioned activated Agrobacterium tumefaciens containing pBI121-LTPg1 (positive engineered bacterial solution) and empty Agrobacterium tumefaciens solution, and culture the treated tomato plants in the dark for 12 hours, followed by 16 hours of light / 8 hours of dark culture for 3 days.

[0124] (6) Collect the treated EV and LTPg1 tomato leaves, grind them in a mortar with liquid nitrogen, add them to an RNase-free centrifuge tube containing 1 ml of RNAisoPlus, extract RNA, reverse transcribe it into cDNA, and detect the expression level of LTPg1 by real-time quantitative PCR to ensure successful transfer of the target gene. Figure 2 As shown, the expression level of LTPg1 (OE-LTPg1) is almost 4.2 times that of transient expression of the empty vector (EV) PBI121 in tomato leaves.

[0125] (7) Add 20 μL of pathogenic Phytophthora spore suspension to the wounds on the briefly treated tomato leaves, place on a plate with moistened filter paper, seal with plastic wrap, and incubate at 20°C in the dark for 5 days, observing the disease development. Figure 2 and 3 As shown, compared with the control, tomato leaves overexpressing LTPg1 showed smaller lesions after inoculation with Late Blight and upregulated expression of other PR genes.

Claims

1. A tomato late blight resistance gene LTPg1 Its application in the resistance of tomato late blight is characterized by: The tomato late blight resistance gene LTPg1 The cDNA of Tomato Early Powder No. 2 was obtained by PCR amplification using specific primers; The specific primers are as follows: LTPg1 -FP:GCGGATCCATGGAAATGGTTAACAAGATTGCA LTPg1 -RP:CGGAGCTCTTACTGAACTTTAGAGCAGTCA。 2. A tomato late blight resistance gene as described in claim 1 LTPg1 Its application in the resistance of tomato late blight is characterized by: The tomato late blight resistance gene LTPg1 The cloning method includes the following steps: S1 used the cDNA of Tomato Early Powder No. 2 as a template and performed PCR amplification using specific primers; The specific primers are as follows: LTPg1 -FP:GCGGATCCATGGAAATGGTTAACAAGATTGCA LTPg1 -RP:CGGAGCTCTTACTGAACTTTAGAGCAGTCA S2 ligates the obtained PCR product with the pMD-19T cloning vector to obtain the ligation product pMD-19T- LTPg1 ; S3 will connect the product pMD-19T- LTPg1 Transformed *E. coli* DH5α and plated on LB agar containing ampicillin. Single colonies were picked, cultured, and plasmids were extracted. Plasmid PCR was performed, and the plasmids were then sequenced. LTPg1 The plasmid that matches is the correct one for linking pMD-19T, denoted as pMD-19T-. LTPg1 Plasmid.

3. A tomato late blight resistance gene as described in claim 2 LTPg1 Its application in the resistance of tomato late blight is characterized by: The tomato late blight resistance gene LTPg1 The screening method includes the following steps: Preliminary screening of S1 target nsLTPs 1) Bioinformatics predictive analysis identified members of the nsLTP gene family and compared them with the transcriptome library of tomatoes infected by Late Blight pathogens constructed in the laboratory in the early stage, and preliminarily screened out nsLTPs that can respond to Late Blight pathogen infection. 2) Bioinformatics predictive analysis for tissue specificity: From the nsLTPs obtained in 1), further screening was conducted to identify nsLTPs that could be specifically expressed in leaves; 3) Promoter cis-acting element analysis: From the nsLTPs obtained in 2), further screen for nsLTPs that respond to hormones, low temperature or trauma stress; S2 late blight fungus treatment tomato plants The bacterial solution inoculated with Late Blight was evenly sprayed onto tomato plants at the five-leaf stage. The plants were first cultured overnight in darkness, and then cultured under 16 h light / 8 h darkness conditions. Tomato leaves were taken at different time points of 0 h, 3 h, 6 h, 12 h, 24 h, 48 h, and 72 h and quickly frozen in liquid nitrogen. S3 RNA extraction and reverse transcription After grinding the S2 sample in liquid nitrogen, it was placed in RNAiso Plus to extract RNA and then reverse transcribed into cDNA. S4 LTPg1 The initial determination Using the cDNA described in S3 as a template, primers specifically targeting nsLTPs were designed based on preliminary screening. The gene expression levels of the target nsLTPs at different time points were detected by real-time quantitative PCR. Finally, Solyc10g075100, which responds to infection by *Phytophthora infestans*, was identified and designated as [missing information]. LTPg1 .

4. The tomato late blight resistance gene as described in claim 1 LTPg1 Its application in the resistance of tomato late blight is characterized by: Includes the following steps: S1 will contain genes that resist late blight in tomatoes. LTPg1 The recombinant expression vector was introduced into Agrobacterium GV3101 competent cells and plated on YEB solid medium containing kanamycin, streptomycin and rifampin. Single colonies were picked for bacterial PCR verification. S2. Using five-leaf stage tomatoes as the treatment target, the prepared positive-positive engineered bacterial solution is injected into the leaves of the five-leaf stage tomatoes to achieve gene expression. LTPg1 Overexpression.

5. The tomato late blight resistance gene as described in claim 4 LTPg1 Its application in the resistance of tomato late blight is characterized by: The gene containing tomato resistance to late blight LTPg1 The recombinant expression vector contains the tomato late blight resistance gene. LTPg1 The pBI121 expression vector was inserted to obtain the result.

6. The tomato late blight resistance gene as described in claim 5 LTPg1 Its application in the resistance of tomato late blight is characterized by: The gene containing tomato resistance to late blight LTPg1 The method for constructing the recombinant expression vector specifically includes using the pMD-19T- vector described in claim 2. LTPg1 plasmids Bam HI and Sac The target fragment was recovered by double enzyme digestion. This fragment was then ligated into the pBI121 expression vector (with the GUS gene removed). The ligation product was transformed into *E. coli* DH5α and plated on LB agar containing kanamycin. Single colonies were picked and cultured, and plasmids were extracted. Plasmid PCR identification was performed, and the plasmids were sequenced. Those with correct sequencing were identified as the recombinant expression vector pBI121-. LTPg1 .

Images