SgRNA, crisper / cas9 vector for targeting knockout of cswrky41 gene and application

Abstract

The application belongs to the technical field of plant genetic engineering, and relates to sgRNA, a CRISPR / Cas9 carrier, a method and application for targeted knockout of a CsWRKY41 gene. The application provides application of the CsWRKY41 gene in regulation of citrus phloem structure. The CsWRKY41 gene is related to change of the citrus phloem structure, and targeted knockout of the CsWRKY41 gene can increase the thickness of the citrus phloem.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a targeted knockout method. CsWRKY41 sgRNA, CRISPR / Cas9 vectors, methods, and applications of genes. Background Technology

[0002] Citrus is the most important fruit tree in southern my country, and my country ranks first in the world in both planting area and output. At the same time, citrus is also a vital economic pillar industry in southern Jiangxi Province. Gannan navel oranges have been listed by the Ministry of Agriculture and Rural Affairs as one of the nine national advantageous agricultural products, making significant contributions to the economic development, agricultural restructuring, and ecological environment improvement of the entire southern Jiangxi region. WRKY transcription factors are a family of transcription factors unique to plants, but research on the function of WRKY transcription factors in fruit trees is currently limited. Summary of the Invention

[0003] The purpose of this invention is to provide a targeted knockout CsWRKY41 sgRNA, CRISPR / Cas9 vectors, methods, and applications of genes. CsWRKY41 Genes associated with changes in the structure of citrus phloem can be targeted and knocked out. CsWRKY41 Genes can increase the thickness of the phloem in citrus fruits.

[0004] This invention provides CsWRKY41 Application of genes in regulating the structure of citrus phloem.

[0005] This invention also provides targeted knockout or reduction. CsWRKY41 Genes or reduction CsWRKY41 Application of gene expression reagents in increasing the thickness of citrus phloem.

[0006] Preferably, the targeted knockout CsWRKY41 Gene-related reagents include targeted knockout. CsWRKY41 CRISPR / Cas9 vector for the gene; the vector contains a targeted knockout gene. CsWRKY41 The sgRNA sequence of the gene.

[0007] This invention also provides a targeted knockout CsWRKY41 The sgRNA sequence of the gene, the sgRNA sequence including CsWRKY41 sgRNA1 and CsWRKY41 sgRNA2; the CsWRKY41 The nucleotide sequence of sgRNA1 is shown in SEQ ID NO.1. CsWRKY41 The nucleotide sequence of sgRNA2 is shown in SEQ ID NO.2.

[0008] This invention also provides a targeted knockoutCsWRKY41 A CRISPR / Cas9 vector containing the targeted knockout gene described in the above technical solution. CsWRKY41 The sgRNA sequence of the gene.

[0009] This invention also provides a CRISPR / Cas9-mediated... CsWRKY41 A method for modifying the microstructure of citrus phloem through targeted editing includes the following steps: Using CRISPR / Cas9 editing methods to precisely knock out citrus fruits CsWRKY41 Genes that result in altered phloem microstructure in citrus fruits.

[0010] Preferably, the vector used in the CRISPR / Cas9 editing method includes targeted knockout. CsWRKY41 CRISPR / Cas9 vector for the gene; the vector contains a targeted knockout gene. CsWRKY41 The sgRNA sequence of the gene; the sgRNA sequence includes CsWRKY41 sgRNA1 and CsWRKY41 sgRNA2; the CsWRKY41 The nucleotide sequence of sgRNA1 is shown in SEQ ID NO.1. CsWRKY41 The nucleotide sequence of sgRNA2 is shown in SEQ ID NO.2.

[0011] Preferably, the method includes the following steps: Based on the targeted knockout CsWRKY41 sgRNA sequence of gene, construct targeted knockout CsWRKY41 The gene was transformed into citrus using a CRISPR / Cas9 vector and Agrobacterium-mediated transformation.

[0012] Preferably, the transformation includes transforming the epicotyl of the citrus fruit.

[0013] Preferably, the citrus fruit includes Hamlin orange.

[0014] This invention provides CsWRKY41 Application of genes in regulating the structure of citrus phloem. Targeted knockout / reduction. CsWRKY41 Genes or reduction CsWRKY41 Gene expression can increase the thickness of the phloem in citrus fruits. Experimental results show that this invention, through the construction of... CsWRKY41 The sgRNA-guided CRISPR / Cas9 editing vector was used to transform the epicotyl of Hamlin sweet orange using Agrobacterium-mediated transformation, resulting in the loss of function of the CsWRKY41 protein. CsWRKY41 Successful gene editing in the citrus genome has yielded significant results. CsWRKY41The mutant transgenic plants showed significantly thickened phloem in cross-sectional analysis of leaf veins. The method provided by this invention has good sgRNA targeting, high efficiency in cleaving the CsWRKY41 gene, and can obtain homozygous edited plants in sweet oranges. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 Sweet orange provided by the present invention CsWRKY41 A diagram showing the results of gene cloning and structural analysis; where A is... CsWRKY41 Gene amplification diagram; B is CsWRKY41 The gene structure diagram; C is the conserved amino acid structure diagram of CsWRKY41; Figure 2 The image shows the subcellular localization results of CsWRKY41 provided by this invention. Figure 3 The figure shows the results of transcriptional activation activity analysis of CsWRKY41 provided by this invention; Figure 4 Provided by the present invention CsWRKY41 A diagram illustrating the genetic transformation process of gene-edited sweet oranges; where A. co-culture; B. selection culture; C. positive shoots; Figure 5 Provided by the present invention CsWRKY41 A graph showing the sequencing results of the edited sites in gene-edited sweet oranges; where WT is the wild-type control; A. CsWRKY41 Phenotypic results of gene-edited sweet oranges and wild-type oranges under normal light and GFP excitation light; B. CsWRKY41 A diagram showing the editing of gene-edited sweet oranges at target site 1; C. CsWRKY41 A diagram showing the editing of the gene-edited sweet orange at target site 2; Figure 6 Provided by the present invention CsWRKY41 Cross-sectional images of the phloem of the leaf veins of gene-edited sweet orange and wild-type control sweet orange; where A. Microscopic image of the phloem cross-section; B. Calculated phloem thickness. Detailed Implementation

[0017] This invention provides CsWRKY41 Application of genes in regulating the structure of citrus phloem. In this invention, the... CsWRKY41CsWRKY41 The study analyzed its characteristics as a typical transcription factor, exhibiting nuclear localization and transcriptional activation activity. The experimental results of this invention demonstrate that... CsWRKY41 Genes are associated with changes in the structure of the phloem in citrus fruits.

[0018] This invention also provides targeted knockout or reduction. CsWRKY41 Genes or reduction CsWRKY41 Application of gene expression reagents in increasing the thickness of citrus phloem. Experimental results show that using CRISPR / Cas9 technology to specifically knock out citrus phloem... CsWRKY41 Genes that cause the protein to lose or decrease function result in a significant increase in the thickness of the phloem in the resulting plant. The sieve tubes of the phloem are the key organs for transporting nutrients in plants, and the thickness of the phloem is directly related to the plant's ability to transport nutrients such as organic matter, and is closely related to all aspects of plant growth and development. The application described in this invention can provide a basis for targeted genetic engineering modification of plant growth and development.

[0019] In this invention, the targeted knockout CsWRKY41 Gene-related reagents include targeted knockout. CsWRKY41 CRISPR / Cas9 vector for the gene; the vector contains a targeted knockout gene. CsWRKY41 The sgRNA sequence of the gene.

[0020] This invention also provides a targeted knockout CsWRKY41 The sgRNA sequence of the gene, the sgRNA sequence including CsWRKY41 sgRNA1 and CsWRKY41 sgRNA2; the CsWRKY41 The nucleotide sequence of sgRNA1 is shown in SEQ ID NO.1 (TGATCAGTGAGCTGACTGAA). CsWRKY41 The nucleotide sequence of sgRNA2 is shown in SEQ ID NO.2 (CCAGAGTCCCCAATATCCAT).

[0021] This invention also provides a targeted knockout CsWRKY41 A CRISPR / Cas9 vector containing the targeted knockout gene described in the above technical solution. CsWRKY41 The sgRNA sequence of the gene. In this invention, the targeted knockout... CsWRKY41 The CRISPR / Cas9 vector for the gene is preferably constructed using the basic vector pBluescript-AtU6-gRNA.

[0022] This invention also provides a CRISPR / Cas9-mediated... CsWRKY41 A method for modifying the microstructure of citrus phloem through targeted editing includes the following steps: Using CRISPR / Cas9 editing methods to precisely knock out citrus fruits CsWRKY41 Genes that result in altered phloem microstructure in citrus fruits.

[0023] In this invention, the vector used in the CRISPR / Cas9 editing method preferably includes targeted knockout. CsWRKY41 CRISPR / Cas9 vector for the gene; the vector contains a targeted knockout gene. CsWRKY41 The sgRNA sequence of the gene; the sgRNA sequence includes CsWRKY41 sgRNA1 and CsWRKY41 sgRNA2; the CsWRKY41 The nucleotide sequence of sgRNA1 is shown in SEQ ID NO. 1. CsWRKY41 The nucleotide sequence of sgRNA2 is shown in SEQ ID NO.2. In this invention, the targeted knockout... CsWRKY41 The CRISPR / Cas9 vector for the gene is preferably constructed using the basic vector pBluescript-AtU6-gRNA.

[0024] In this invention, the method preferably includes the following steps: Based on the targeted knockout CsWRKY41 sgRNA sequence of gene, construct targeted knockout CsWRKY41 A CRISPR / Cas9 vector containing a gene was used to transform citrus fruits using Agrobacterium-mediated transformation. This invention does not impose any particular limitations on the vector construction method or the Agrobacterium-mediated transformation method; conventional vector construction and transformation methods well-known to those skilled in the art can be employed. In this invention, the transformation preferably involves transforming the epicotyl of the citrus fruit. In this invention, the citrus fruit preferably includes Hamlin sweet orange. Mutation CsWRKY41 It will cause changes in the phloem structure of sweet oranges. CsWRKY41 The thickness of the phloem in the veins of the sweet orange leaves after gene knockout was significantly increased compared to the wild type.

[0025] To further illustrate the present invention, a targeted knockout method provided by the present invention will be described below with reference to the accompanying drawings and embodiments. CsWRKY41 The sgRNA of the gene, CRISPR / Cas9 vectors, methods and applications are described in detail, but they should not be construed as limiting the scope of protection of this invention.

[0026] Example 1 CsWRKY41 Acquisition of genes 1. RNA extraction The RNA extraction method used in this experiment followed the instructions for the Easy Plant RNA Extraction Kit from Zhejiang EasyPlant Biotechnology Co., Ltd., and the specific steps are as follows: (1) Take 100 mg of Hamlin sweet orange leaves and grind them into powder in liquid nitrogen. Place them in a 2 mL RNase-free centrifuge tube pre-cooled in liquid nitrogen, add 1 mL Buffer PR1, and vortex for 1 min to lyse the cells. (2) Add 200 μL of nucleic acid extraction solution (24:1 chloroform and isoamyl alcohol), vortex thoroughly, and centrifuge at 13000 g for 5 min at 4℃; (3) Transfer the supernatant to a pre-chilled 2 mL RNase-free centrifuge tube, add an equal volume of anhydrous ethanol, and mix thoroughly by inverting. Transfer the mixture to a Hipure RNA adsorption column and centrifuge at 13000 g for 1 min at 4°C; (4) Discard the waste liquid, add 600 μL Buffer PR2, centrifuge at 13000 g for 1 min at 4℃, discard the waste liquid, and repeat the washing once; (5) Discard the waste liquid and centrifuge at 13000 g for 1 min at 4℃; (6) Transfer the adsorption column to a clean 1.5 mL RNase-free centrifuge tube, slowly and evenly add 30 μL RNA Elution Buffer to the center of the column membrane, place at room temperature for 2-3 min, centrifuge at 13000 g for 1 min at 4℃, and store the eluted RNA in a -80℃ freezer for later use.

[0027] 2. cDNA Synthesis The synthesis of cDNA in this experiment was performed using the TaKaRa reverse transcription kit PrimeScript™ RT reagent Kit with gDNA Eraser. The specific steps are as follows: (1) Remove the stored RNA from the -80℃ freezer and thaw it on ice. Prepare reverse transcription reagent 1 according to the reaction system shown in Table 1; Table 1. Preparation of Reverse Transcription Reagent 1

[0028] (2) After preparing all the reagents in Table 1 according to the specified amounts, mix them well and incubate at 42℃ for 2 min; (3) Prepare reverse transcription reagent 2 according to the reaction system shown in Table 2; Table 2 Preparation of Reverse Transcription Reagent 2

[0029] (4) Mix the reverse transcription reagent 1 that has been incubated at 42℃ with the prepared reverse transcription reagent 2, incubate at 37℃ for 15 min, and then incubate at 85℃ for 15 s to obtain sweet orange cDNA.

[0030] (5) Use an ultra-micro nucleic acid protein analyzer to detect the concentration of sweet orange cDNA. The obtained cDNA can be used for cloning of sweet orange genes and subsequent quantitative analysis. Store the obtained cDNA in a -20℃ freezer for later use.

[0031] 3. CsWRKY41 Gene sequence determination (1) PCR amplification According to the Citrus Pangenome Breeding Database (http: / / citrus.hzau.edu.cn / index.php) CsWRKY41 Design amplification primers based on gene sequence information (annotation name: Cs5g02440.1). Forward primer. CsWRKY41 F: 5'-ATGGAGAACGCATGGAGG-3' (SEQ ID NO.5), reverse primer CsWRKY41 R: 5'-TTAGAATGAGAATCCTGCATTG-3' (SEQ ID NO. 6).

[0032] PCR amplification was performed using cDNA from sweet orange leaves as a template. The PCR reaction system is shown in Table 3. Table 3 PCR reaction system

[0033] Perform the PCR amplification procedure according to the conditions listed in Table 4: Table 4 Gene Amplification PCR Procedure

[0034] (2) Connecting carrier The PCR products were purified and recovered using the Axygen DNA gel extraction kit. The purified products were then ligated with the intermediate vector pTOPO-Blunt. The ligation system is shown in Table 5. After incubation at room temperature for 5 min, the ligation products were transformed into competent E. coli DH5α cells.

[0035] Table 5 pTOPO carrier linkage system

[0036] After transformation, *E. coli* cells were cultured overnight at 37°C. Single clones were picked and identified as positive by colony PCR. These clones were then sent to Wuhan Qingke Company for sequencing. The sequencing results were compared to obtain the correct sequence. CsWRKY41 sequence. Figure 1 For sweet oranges CsWRKY41The image shows the results of gene cloning and structural analysis. The ORF region of this gene is 1011 bp in length, encoding 336 amino acids; where A is... CsWRKY41 Gene amplification diagram; B is CsWRKY41 The gene structure diagram; C is the conserved amino acid structure diagram of CsWRKY41.

[0037] Example 2 CsWRKY41 Subcellular localization analysis 1. Construction of subcellular localization vectors The subcellular localization vector was pBI121-EGFP, using sweet orange leaf cDNA as a template, according to... CsWRKY41 Sequence design of positioning vector primers: CsWRKY41 pBI121 F:5'-GAGAACACGGGGGGAC TCTAGA ATGGAGAACGCATGGAGG-3' (SEQ ID NO.7) and CsWRKY41 pBI121 R: 5'-GCTCACCATGGTACC CCCGGG The PCR amplification system for GAATGAGAATCCTGCATTGTC-3' (SEQ ID NO. 8) is shown in Table 3, and the amplification program is shown in Table 4. After recovery, the amplified product was ligated into the vector pBI121-EGFP using Sosoo ligase (product number TSV-S1) from Qingke Biotechnology. Xba I and Xma The ligation system between the two restriction enzyme sites is shown in Table 6. After ligation, the cells were transformed into competent *E. coli* cells. Single clones were selected for identification by colony-linked PCR and then sent to the company for sequencing. Once the sequence was confirmed to be correct, the *E. coli* were obtained. CsWRKY41 -pBI121-EGFP vector.

[0038] Table 6 Sosoo enzyme ligation system

[0039] 2. Transient transformation and fluorescence observation of tobacco Use positive CsWRKY41 The pBI121-EGFP plasmid was extracted from *E. coli* and transformed into *Agrobacterium* competent cells GV3101. Simultaneously, the pBI121-EGFP plasmid was transformed as an empty vector control. A VirD2NLS plasmid fused with mCherry was used as a nuclear localization marker in GV3101 cells. Positive *Agrobacterium* strains were obtained after identification. The pBI121-EGFP plasmid... CsWRKY41Agrobacterium monoclonal activation culture of pBI121-EGFP and mCherry-VirD2NLS with shaking overnight was performed. The cells were collected by centrifugation at 4000 g for 5 min, and the cells were resuspended in invasion staining buffer (10 mmol / L MES, 10 mmol / L MgCl2, 200 μmol / L AS) and the OD was adjusted. 600 The value is 0.6~0.8. Mix in a 5:3 ratio. CsWRKY41 Resuspension of pBI121-EGFP and mCherry-VirD2NLS bacterial cultures was prepared, and a control was prepared by mixing pBI121-EGFP and mCherry-VirD2NLS bacterial cultures in equal proportions. The control and experimental bacterial cultures were injected into the abaxial surface of *Nicotiana benthamiana* leaves using a small syringe (1 mL). After 3 days of dark incubation, green fluorescence (GFP) and red fluorescence (mCherry) were observed using a confocal laser scanning microscope (Leica TCS SP8, Germany). The results are as follows: Figure 2 (As shown in the subcellular localization results of CsWRKY41), the green fluorescence of the control cell filled the entire epidermal cell, including the cytoplasm, cell membrane, and nucleus, while the transformed cell... CsWRKY41 The green fluorescence of -pBI121-EGFP is concentrated only in the cell nucleus and can overlap with the mCherry signal of nuclear localization genes, indicating that CsWRKY41 is located in the cell nucleus, which is consistent with the characteristics of transcription factors.

[0040] Example 3 CsWRKY41 transcriptional activation activity analysis Based on the amino acid sequence and conserved domains of CsWRKY41, its full-length and three truncated fragments (N, W, and C) were amplified, and then... EcoR I and BamH The I restriction site was inserted into the vector pGBKT7, and the primer sequences used are shown in Table 7. The recombinant plasmid was transformed into Y2HGold yeast cells according to the Matchmaker® Gold Yeast Two-Hybrid Library Screening System (Takara) instructions. Transformed yeast cells were cultured in SD / -Trp medium. Positive yeast transformants were spotted onto SD / -Trp (SDO) or SD / -Trp / -His / -Ade (TDO) medium supplemented with the chromogenic substrate X-α-gal (Sigma-Aldrich, USA), and cultured at 30 °C for 3–5 days. The growth of the transformed yeast cells was then assessed. Results are as follows: Figure 3(Figure showing the results of transcriptional activation activity analysis of CsWRKY41) As shown, all recombinant plasmids could display visible white colonies on SD / -Trp medium; however, only yeast cells containing full-length or N-terminal transformations were able to grow and turn blue on X-α-gal-added medium (TDO+X-α-gal). This result indicates that the CsWRKY41 protein possesses transcriptional activation activity, and its transcriptional activation domain is located at the N-terminus.

[0041] Table 7 Primers for transcription activation vectors

[0042] Example 4 CsWRKY41 Construction of gene editing vectors (1) Design and synthesis of sgRNA according to CsWRKY41 The sequence was used to design sgRNAs using the online software CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / ). To ensure editing efficiency, it was decided to... CsWRKY41 The sequence was edited by selecting two targets. 5'-TGATCAGTGAGCTGACTGAA (PAM sequence: GGG)-3' and 5'-(PAM sequence: CCG)CCAGAGTCCCCAATATCCAT-3', which had higher overall software scores, were selected as target 1 and target 2 (target 1: CsWRKY41 The nucleotide sequence of sgRNA1 is shown in SEQ ID NO.1: TGATCAGTGAGCTGACTGAA; Target 2: CsWRKY41 The nucleotide sequence of sgRNA2 is shown in SEQ ID NO.2: CCAGAGTCCCCAATATCCAT). Synthesize the complementary target sequence with the adapter. CsWRKY41 sgRNA1 F: 5'-ATTGTGATCAGTGAGCTGACTGAA-3' (SEQ ID NO.17), CsWRKY41 sgRNA1 R: 5'-AAACTTCAGTCAGCTCACTGATCA-3' (SEQ ID NO. 18), CsWRKY41 sgRNA2 F: 5'-ATTGATGGATATTGGGGACTCTGG-3' (SEQ ID NO. 19) and CsWRKY41 sgRNA2 R: 5'-AAACCCAGAGTCCCCAATATCCAT-3' (SEQ ID NO.20). It was then annealed (98°C, 10 min) and allowed to cool naturally to room temperature to form a double strand.

[0043] (2) Construction of gene editing vectors use Bsa I (NEB, USA) digested and recovered the vector pBluescript-AtU6-gRNA (Miaoling Biotechnology, catalog number P1410) with a single enzyme, and then used T4 ligase (NEB, USA) to ligate it to the annealed double strands at target sites 1 and 2, respectively. The ligation system is shown in Table 8: Table 8. T4 ligase ligation system

[0044] After mixing all components thoroughly, the mixture was incubated overnight at 16°C for ligation and transformation into competent E. coli DH5α cells. After confirmation of correct sequencing, the positive plasmid was extracted and subjected to restriction endonuclease restriction enzyme assays. Spe I and Nhe The positive plasmid was double-digested with enzyme I (NEB, USA) to obtain sgRNA1 / 2 cassette (AtU6:sgRNA1 / 2-gRNA scaffold). The sgRNA1 cassette was then ligated into pCAMBIA1300- pYAO Cas9 (Protech Biotechnology, catalog number ZT5237) vector ( Spe Linearization was performed and the bacteria were transformed into E. coli. After correct sequencing, restriction endonucleases were used. Spe I and Nhe The plasmid (NEB, USA) was double-digested with enzyme I, ligated with sgRNA2cassette using T4 ligase, and then transformed into competent E. coli DH5α cells. After confirmation and sequencing, the construction was complete. CsWRKY41 Dual-target gene editing vector ( CsWRKY41 -sgRNA1 / 2-pCAMBIA1300- pYAO :Cas9), extract positive plasmids, transform Agrobacterium tumefaciens competent GV3101 for later use.

[0045] Example 5 CsWRKY41 Gene-edited sweet oranges obtained (1) Epicotyl culture.

[0046] The receptor material is wild-type Hamlin sweet orange ( Citrus sinensis Osbeck cv. Hamlin) epicotyl. Fresh sweet orange seeds were removed intact from the fruit, soaked in 1 mol / L NaOH solution for 15 min to remove pectin, and then sterilized in a clean bench with 2% NaClO for 15-20 min, followed by rinsing with sterile water 3-5 times. The inner and outer seed coats were then removed with tweezers, and the seeds were sown in MT solid medium. The culture was carried out in the dark for about 30 days before genetic transformation. One week before transformation, the epicotyl was exposed to light until it showed green color.

[0047] (2) Preparation of Agrobacterium tumefaciens inoculum.

[0048] Four days before transformation, use an inoculation loop to collect Agrobacterium tumefaciens bacterial suspension (obtained in Example 4). CsWRKY41 Dual-target gene editing vector ( CsWRKY41 -sgRNA1 / 2-pCAMBIA1300- pYAO Agrobacterium tumefaciens GV3101 (Cas9) was activated by streaking on LB agar containing 50 mg / L kanamycin and incubated at 28°C for 2 days. Single colonies were then picked and streaked onto fresh LB plates and incubated at 28°C for 2–3 days. After colony growth, bacterial cells were scraped off with a sterile scalpel and placed in 50 mL of MT liquid medium containing 100 μM AS, and incubated at 28°C with shaking at 200 rpm for 2 h. After the cells were thoroughly mixed, their OD values ​​were measured using a spectrophotometer. 600 The value can be adjusted to the range of 0.6 to 0.8 for conversion.

[0049] (3) Infection transformation and cultivation.

[0050] Take the hypocotyls of robust sweet oranges and cut them into approximately 1 cm segments using a scalpel on a clean bench. Immerse the segments in the prepared Agrobacterium tumefaciens inoculum solution for 20 minutes, shaking the segments several times during the process to ensure thorough inoculation. Afterward, blot off any remaining bacterial solution from the stem segments with sterile absorbent paper and transfer them to co-culture medium (MT + 1.0 mg / L BA + 100 μM AS) for 3 days in the dark. Subsequently, transfer the stem segments to selection medium (MT + 400 mg / L Cef + 50 mg / L Kan) for approximately one month. Regenerated shoots will then appear, at which point the segments can be transferred to light conditions for further cultivation. Figure 4 for CsWRKY41 The results of the genetic transformation process of gene-edited sweet oranges are shown in the diagram; where A. co-culture; B. selection culture; C. positive shoots.

[0051] (4) Selection and grafting of regenerated buds Regenerated buds were observed using a portable fluorescent protein excitation light source (Luyor-3415RG, Shanghai) to confirm positive regenerated buds with green fluorescence. Figure 4 (C) When it grows to about 0.5 cm, cut it off and transfer it to a budding medium (MT + 0.5g malt extract + 400 mg / L Cef + 50 mg / L Kan) to continue growing. When the regenerated bud grows to 2-3 cm in size, it can be grafted onto a 1-year-old trifoliate orange rootstock for cultivation.

[0052] Example 6 CsWRKY41 Identification of the effects of gene editing on sweet oranges For testing CsWRKY41 Whether gene editing of sweet oranges is successful depends on designing identification primers near the target site. CsWRKY41 crispr F: 5'-GAAAATGGAGAACGCATGGAGG-3' (SEQ ID NO. 21) and CsWRKY41 crisprR: 5'-CAAAATCCTCACTTCGAGGGC-3' (SEQ ID NO.22). Regenerated plants exhibiting green fluorescence were selected, and leaf DNA was extracted using the CTAB method. Amplification was performed using the high-fidelity enzyme PrimeSTAR Max Premix (Takara), and a portion of the amplified products were sequenced. If the sequencing result showed a pure peak, it indicated that the plant had not undergone editing, or that all peaks were of the same editing type, and the editing site was homozygous. If the sequencing result showed heterogeneous peaks at the target site, it indicated that multiple editing types existed at that site, indicating heterozygosity. Further amplification products were collected, recombined into the pTOPO-Blunt vector, transformed into E. coli, and sequenced (at least 20 positive clones were selected from each plant for sequencing) to further confirm the editing type at that site.

[0053] See sequencing results Figure 5 ( CsWRKY41 A graph showing the sequencing results of the edited sites in gene-edited sweet oranges; where WT is the wild-type control; A. CsWRKY41 Phenotypic differences between gene-edited and wild-type sweet oranges under normal and GFP excitation light; B. CsWRKY41 Editing status of gene-edited sweet oranges at target site 1; C. CsWRKY41 (The editing status of gene-edited sweet oranges at target site 2), such as... Figure 5 As shown, wild-type sweet oranges do not exhibit a green fluorescent phenotype under GFP excitation light, while the obtained... CsWRKY42 The entire plant of the gene-edited sweet orange exhibited very strong green fluorescence. Figure 5 A in the text indicates that CsWRKY42 The gene-editing vector was successfully transformed into sweet orange plants. This experiment successfully transformed... CsWRKY41 -sgRNA1 / 2-pCAMBIA1300- pYAOFive plants were obtained using the Cas9 vector, three of which achieved gene editing. Mutations 41-2 and 41-4 were homozygous mutations. 41-2 had an insertion of one "T" base at target site 1 and an insertion of one "A" base at target site 2; 41-4 had a large deletion of 52 bases at target site 1 and a deletion of 2 bases at target site 2. Mutation 41-5 was heterozygous, exhibiting two editing forms at target site 1: an insertion of one "T" base and a deletion of 52 bases. At target site 2, it contained multiple mutation forms, including: ① an insertion of one "T" base and one "C" base; ② an insertion of one "C" base; ③ an insertion of one "A" base; ④ a deletion of one "G" base and an insertion of one "C" base; ⑤ The deletion of 2 bases resulted in a mutation rate of 18 / 19 = 94.7% (at least 20 positive clones were selected from each plant for sequencing, of which 19 clones were successfully sequenced, and 18 of these clones exhibited this mutation). Figure 5 B and Figure 5 The deletion or insertion of the above bases will cause the CsWRKY42 protein to undergo frameshift during translation, thus failing to acquire a functional protein, indicating that CsWRKY42 has been successfully edited.

[0054] Example 7 CsWRKY41 Morphological analysis of the midrib phloem in gene-edited sweet orange and control leaves Midribs of leaves from homozygous mutant line 41-4 and wild-type sweet orange were collected, and cross-sectional samples were prepared using conventional paraffin sectioning techniques. The morphology and structure of the phloem were observed using an optical microscope (Leica). The results are shown in Table 9 and... Figure 6 ( CsWRKY41 Cross-sectional structures of the phloem in the leaf veins of gene-edited sweet orange and wild-type control sweet orange; where A. Microscopic structure of the phloem cross-section; B. Calculated phloem thickness. CsWRKY41 The phloem thickness in the veins of the edited sweet orange leaves was significantly increased compared to the wild type, indicating a mutation. CsWRKY41 It can cause changes in the structure of the phloem of sweet oranges.

[0055] Table 9 Calculation results of phloem thickness

[0056] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Targeted knockout CsWRKY41 The application of gene-based reagents in increasing the thickness of the phloem in Hamlin sweet oranges, the CsWRKY41 The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

2. The application according to claim 1, characterized in that, The targeted knockout CsWRKY41 Gene-related reagents include targeted knockout. CsWRKY41 CRISPR / Cas9 vector for the gene; the vector contains a targeted knockout gene. CsWRKY41 The sgRNA sequence of the gene.

3. The application according to claim 2, characterized in that, The targeted knockout CsWRKY41 The sgRNA sequence of the gene includes CsWRKY41 sgRNA1 and CsWRKY41 sgRNA2; the CsWRKY41 The nucleotide sequence of sgRNA1 is shown in SEQ ID NO.

1. CsWRKY41 The nucleotide sequence of sgRNA2 is shown in SEQ ID NO.

2.

4. A CRISPR / Cas9-mediated... CsWRKY41 The method for targeted knockout to increase the thickness of the phloem in Hamlin sweet oranges is characterized by, Includes the following steps: Using CRISPR / Cas9 editing methods to precisely knock out citrus fruits CsWRKY41 Genes were used to obtain the Hamlin sweet orange citrus with increased phloem thickness; CsWRKY41 The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

5. The method according to claim 4, characterized in that, The CRISPR / Cas9 editing method uses vectors that include targeted knockout. CsWRKY41 CRISPR / Cas9 vector for the gene; the vector contains a targeted knockout gene. CsWRKY41 The sgRNA sequence of the gene; the sgRNA sequence includes CsWRKY41 sgRNA1 and CsWRKY41 sgRNA2; the CsWRKY41 The nucleotide sequence of sgRNA1 is shown in SEQ ID NO.

1. CsWRKY41 The nucleotide sequence of sgRNA2 is shown in SEQ ID NO.

2.

6. The method according to claim 5, characterized in that, The method includes the following steps: Based on the targeted knockout CsWRKY41 sgRNA sequence of gene, construct targeted knockout CsWRKY41 The gene was transformed into Hamlin sweet orange using the CRISPR / Cas9 vector via Agrobacterium-mediated transformation.

7. The method according to claim 6, characterized in that, The transformation includes the transformation of the epicotyl of Hamlin sweet orange.

Images