Toxoplasma attenuated live vaccine with deleted MnmE gene and construction method thereof

Abstract

The application discloses a Toxoplasma gondii live attenuated vaccine with a deleted MnmE gene and a construction method, the vaccine containing a Toxoplasma gondii live attenuated strain with a deleted tRNA modification GTPase MnmE gene, wherein the nucleotide sequence of the tRNA modification GTPase MnmE gene is shown as SEQ ID NO:1, and the Toxoplasma gondii gene deletion strain has a nucleotide sequence shown as SEQ ID NO:2 at the tRNA modification GTPase MnmE site compared with a starting strain, the virulence of the gene deletion strain is significantly reduced, the gene deletion strain can be effectively eliminated by a host and the immunocompetence of an animal to Toxoplasma gondii is improved, and the gene deletion strain has the potential to become a live attenuated vaccine for preventing Toxoplasma gondii disease of animals.

Description

Technical Field

[0001] This invention belongs to the field of biology and genetic engineering, specifically relating to a live attenuated Toxoplasma gondii vaccine lacking the MnmE gene and its construction method. Background Technology

[0002] Toxoplasma gondii is a specific intracellular parasite belonging to the family Sarcocystidiaceae in the subclass Coccidioidea of ​​the phylum Apicocytozoa. It is one of the most widespread parasites in the world, infecting almost all warm-blooded animals and some cold-blooded animals, threatening one-third of the global population. Transmission of Toxoplasma gondii can occur via the fecal-oral route, through consumption of infected meat, and through placental transfer from mother to fetus. Primary infection in adults is mostly asymptomatic, but severe acute toxoplasmosis can occur in immunocompetent individuals when infected with certain isolates. Reactivation of latent infection in immunocompromised individuals can lead to fatal toxoplasmic encephalitis, myocarditis, and pneumonia. Infection acquired during pregnancy can cause serious harm to the fetus, such as long-term disability, stillbirth, or fetal death. In livestock and other animals, infection can easily lead to abortion and stillbirth, causing severe economic losses to the livestock industry. Furthermore, some new research results indicate a relationship between Toxoplasma gondii infection and certain mental illnesses, such as schizophrenia, depression, and suicidal tendencies.

[0003] Once humans and animals are infected with this parasite, Toxoplasma gondii possesses various immune evasion mechanisms, making complete cure extremely difficult. Furthermore, all current treatments have limitations and toxicities. It is noteworthy that more than a century after its discovery, toxoplasmosis remains a neglected parasitic infection. Currently, there are no safe and effective drugs or vaccines to prevent it. Research into anti-Toxoplasma gondii drugs and preventative vaccines is urgently needed. Therefore, developing a Toxoplasma gondii vaccine with good immunogenicity and protective efficacy is of paramount importance for human health and the healthy development of animal husbandry. Summary of the Invention

[0004] The purpose of this invention is to address the shortcomings of the prior art mentioned above by providing a live attenuated Toxoplasma gondii vaccine lacking the MnmE gene. The Toxoplasma gondii basic strain RHΔku80 contains the tRNA-modified GTPase gene: the MnmE gene. The nucleotide sequence of the MnmE gene is shown in SEQ ID NO.1. The Toxoplasma gondii gene-deleted strain has the nucleotide sequence shown in SEQ ID NO:2, which replaces the MnmE gene.

[0005] The aforementioned Toxoplasma gondii attenuated live vaccine lacking the MnmE gene is wherein the Toxoplasma gondii vaccine strain is prepared as a tachyzoite suspension using an injection diluent as a solvent.

[0006] This invention also provides a method for constructing the above-mentioned Toxoplasma gondii strain lacking the MnmE gene, which is achieved through the following steps: (1) Starting strain RHΔku80: The basic strain of Toxoplasma gondii RHΔku80 was selected. The strain is a type I strain of Toxoplasma gondii belonging to the family Toxoplasmidae in the order Coccidioidea. The basic strain of Toxoplasma gondii RHΔku80 contains the tRNA-modified GTPase gene: MnmE gene. The nucleotide sequence of the MnmE gene is shown in SEQ ID NO.1. (2) Construction of pSAG1-Cas9-TgU6-sgMnmE plasmid: Using pSAG1-Cas9-TgU6-sgBbsI plasmid as a template, the plasmid was linearized by BbsI digestion. The upstream and downstream primers were then synthesized into double strands via gradient cooling. The plasmid was ligated using Solution I and transformed into E. coli TOP10 to obtain pSAG1-Cas9-TgU6-sgMnmE plasmid. The upstream and downstream primer sequences (5' to 3' direction) are as follows: gRNA-MnmE-F:ACAGGGAGCCGGTTCTCATG gRNA-MnmE-R: CATGAGAACCGGCTCCCTGT; (3) Preparation of homologous templates of MnmE-5UTR::DHFR::MnmE-3UTR: Using pBlue-DHFR plasmid as a template, upstream and downstream primers containing homologous arms of MnmE-5UTR and MnmE-3UTR were designed. Template sequences containing homologous arms of MnmE-5UTR and MnmE-3UTR were obtained by amplification using KOD high-fidelity enzyme. The primer sequences (5' to 3' direction) for amplifying the homologous template of MnmE-5UTR::DHFR::MnmE-3UTR are as follows: MnmE-5UTR-F: AAGCTACGCGGGTTATTCGTACGCAACCTGAGAACCCGCCTGTCATTCGATTTTCAC CCC MnmE-3UTR-R: AAATGCCTCGCGTAGCGGCGAAAACGCGACGCGTGTGTCTGGATCGATCCCCCCGG GCTG (4) Obtaining the Toxoplasma gondii gene-deleted strain ΔMnmE: The pSAG1-Cas9-TgU6-sgMnmE plasmid used for targeted targeting in step (2) and the MnmE-5UTR::DHFR::MnmE-3UTR homologous template used for homologous substitution of the MnmE gene in step (3) were mixed and electroporated into the starting strain RHΔku80. After screening with 3μM pyrimethamine, PCR identification and single-clone screening, the above-mentioned Toxoplasma gondii strain with the MnmE gene deletion was obtained. The ΔMnmE-deleted strain lacks the nucleotide sequence shown in SEQ ID NO: 1.

[0007] The Toxoplasma gondii attenuated live vaccine provided by this invention is a Toxoplasma gondii attenuated live vaccine that lacks the tRNA-modified GTPase MnmE gene. This invention has found that the Toxoplasma gondii mutant strain with this gene deletion exhibits reduced virulence, lower in vivo reproduction in mice, and provides good immune protection for mice, showing potential as an attenuated live vaccine against toxoplasmosis in animals. For animal inoculation, the tachyzoites of the Toxoplasma gondii attenuated live vaccine can be prepared as a suspension using a diluted injection solution.

[0008] The beneficial effects of this invention are as follows: This invention provides an attenuated live vaccine that can be used to prevent Toxoplasma gondii infection. Compared with the original strain, the MnmE gene deletion vaccine strain has almost no pathogenicity in mice and does not form cysts in the body, thus exhibiting high safety to the host. The MnmE gene deletion strain has good immunogenicity and immune protection, which can improve the animal's immunity to Toxoplasma gondii, especially against the main prevalent type II strain, and has the potential to prepare an attenuated live vaccine for the prevention of toxoplasmosis in animals. Attached Figure Description

[0009] Figure 1 This is a schematic diagram illustrating the strategy for knocking out the MnmE gene in Toxoplasma gondii in a specific embodiment of the present invention.

[0010] Figure 2 This is the PCR identification result of the ΔMnmE monoclonal strain in a specific embodiment of the present invention.

[0011] Figure 3 The results of the toxicity test of the ΔMnmE strain on mice are shown in a specific embodiment of the present invention.

[0012] Figure 4 The results of toxicity tests on mice with different doses of the ΔMnmE strain are shown in a specific embodiment of the present invention.

[0013] Figure 5 The results of the worm load test in mice infected with the ΔMnmE strain are shown in a specific embodiment of the present invention.

[0014] Figure 6The results of the immunoprotective efficacy test of the ΔMnmE strain against mice are shown in a specific embodiment of the present invention. Detailed Implementation

[0015] The present invention will now be described in detail with reference to the accompanying drawings and embodiments. The described embodiments are merely a part, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0016] Example 1: Construction of the Toxoplasma gondii ΔMnmE strain

[0017] (1) The originating strain RHΔku80 The RHΔku80 strain is a Toxoplasma gondii strain possessing the tRNA-modified GTPase MnmE, and can be continuously passaged in HFF cells. The RHΔku80 strain of Toxoplasma gondii is disclosed in (Huynh, MH and Carruthers, VB2009. Tagging of endogenous genes in a Toxoplasma gondii strain lacking Ku80. Eukaryot Cell 8, 530-539.).

[0018] (2) Construction of pSAG1-Cas9-TgU6-sgMnmE plasmid

[0019] ① Design sgRNA sequences targeting the target gene using the website EuPaGDT (http: / / grna.ctegd.uga.edu / ), and design gRNA primers based on the designed sequences: Upstream primer gRNA-MnmE-F: 5'-ACAGGGAGCCGGTTCTCATG-3' Downstream primer gRNA-MnmE-R: 5'-CATGAGAACCGGCTCCCTGT-3';

[0020] ② Prepare the following reaction system in a sterile PCR tube:

[0021] After mixing the above liquids thoroughly, place them in a PCR instrument for reaction. The reaction procedure is as follows:

[0022] ③ Premix the laboratory-preserved pSAG1-Cas9-TgU6-sgBbsI plasmid with BbsI restriction enzyme according to the following system: pSAG1-Cas9-TgU6-sgBbs I plasmid 8 μL 1 μL of Bbs BB I Enzyme Buffer 1μL

[0023] The plasmid was digested in a 37°C water bath for 2 hours, identified by 1% agarose gel electrophoresis, and the digested plasmid product was recovered by gel cutting.

[0024] ④ Take a new sterile PCR tube and prepare the following reaction system: 3 μL of pSAG1-Cas9-TgU6-sgBbsI digestion product 2 μL of sgRNA annealing product Solution I 2μL Place in a 16℃ connection device for 3 hours.

[0025] ⑤ The ligation product was transformed into 100 μL of E. coli TOP10 competent cells. An appropriate amount was evenly spread onto LB plates containing ampicillin resistance and incubated overnight at 37°C. Single colonies with good growth were picked and expanded, and 500 μL of the bacterial culture was sequenced. If the sequence alignment was completely correct, it indicated that the target plasmid pSAG1-Cas9-TgU6-sgMnmE was successfully constructed. The pSAG1-Cas9-TgU6-sgMnmE plasmid was extracted using the endotoxin-free plasmid extraction kit from Zhejiang EasyBio Biotechnology Co., Ltd., and the concentration was determined for later use.

[0026] (3) Preparation of homologous templates of MnmE-5UTR::DHFR::MnmE-3UTR

[0027] ① Determine the location of the gene to be knocked out on ToxoDB based on the Gene ID, and identify the 5' homologous arm (MnmE-5UTR) and 3' homologous arm (MnmE-3UTR);

[0028] ②According to Figure 1 The MnmE gene knockout strategy shown is used to design amplification primers with the 5' and 3' homologous arms of the TgMnmE gene:

[0029] MnmE-5UTR-F: 5'-AAGCTACGCGGGTTATTCGTACGCAACCTGAGAACCCGCCTGTCATTCGATTTTCACCC-3'

[0030] MnmE-3UTR-R: 5'-AAATGCCTCGCGTAGCGGCGAAAACGCGACGCGTGTGTCTGGATCGATCCCCCCGGGCTG-3';

[0031] The PBlue-DHFR plasmid was amplified by PCR using a high-fidelity enzyme. The amplification system is as follows:

[0032] After mixing the above liquids thoroughly, place them in a PCR instrument for reaction. The reaction procedure is as follows:

[0033] The target fragment MnmE-5UTR::DHFR::MnmE-3UTR containing the sequence shown in SEQ ID NO: 2 was gelled and recovered, and its concentration was determined for later use.

[0034] (4) Obtaining the Toxoplasma gondii gene-deleted strain ΔMnmE

[0035] ① Culture the starting strain RHΔku80 from step (1) until 50% of the parasites have escaped. After scraping off the cells with a sterile cell scraper, aspirate the suspension 3-5 times with a sterile syringe to completely rupture the Toxoplasma gondii inside the cells. Filter and purify the parasites using a sterile 5μm filter. Centrifuge at 800g for 5 min at room temperature and discard the supernatant. Resuspend and wash the parasites with 5mL HBSS, then add 1mL of Cytomix Buffer (120mM KCl, 0.15mM CaCl2, 10mM K2HPO4 / KH2PO4, 25mM HEPES, 2mM EDTA, 5mM MgCl2, pH=7.6) to resuspend the precipitate. Count the precipitate using a hemocytometer.

[0036] ②Based on the counting results, take the one containing 1×10 7 Add 7.5 μg of pSAG1-Cas9-TgU6-sgMnmE plasmid from step (2), 10 μg of MnmE-5UTR::DHFR::MnmE-3UTR homologous template from step (3), 50 μg of glutathione and 300 μg of ATP to the suspension of tachyzoites, add electroporation buffer to a final volume of 300 μL, mix well and transfer all to a 0.2 cm electroporation cuvette. Place the cuvette in a BIO-RAD electroporator and perform electroporation at 1600 V, 25 μF, 200 Ω and 4 ms.

[0037] ③ Aspirate the suspension and inoculate it into HFF cells, place it in a 37℃, 5% CO2 incubator, and change the medium after 24 hours to remove uninvaded parasites.

[0038] ④ Observe the condition of the parasites daily. Once most of the parasites have escaped from the HFF cells after electroporation, rupture the cells to allow the Toxoplasma gondii to escape completely. Take an appropriate amount of the parasite suspension and inoculate it into new HFF cells, then screen using a medium containing 3 μM pyrimethamine.

[0039] ⑤ After 2-3 generations of drug screening, collect tachyzoites, count them, and then transfer them to 96-well plates filled with HFF cells for single-clone screening (connect two 96-well plates), inoculating 1-2 (calculated) tachyzoites per well.

[0040] ⑥ After about 10 days, observe under a microscope whether there are single insect spots. Use a pipette to blow up the insect spots and expand them to a 24-well plate for further culture. After 70% of the insects have escaped, take an appropriate amount of tachyzoites and use DNA extraction reagent to extract DNA to identify monoclonal insect strains.

[0041] ⑦ Perform PCR1, PCR2, and PCR3 on the DNA extracted from the monoclonal strain in the previous step. See the schematic diagram of MnmE gene knockout and the design principle of PCR identification primers for details. Figure 1 If PCR1 and PCR3 show specific bands for the monoclonal strain, but PCR2 shows no target band, then the monoclonal strain is a gene-deleted strain ΔMnmE. The upstream and downstream primers for PCR are as follows:

[0042] Upstream primer PCR1-F: 5'-ACAGGAGGGGTTAAAGCACC-3'

[0043] Downstream primer PCR1-R: 5'-GCATGAAAAGCGTCCTACCAC-3'

[0044] Upstream primer PCR2-F: 5'-TGAAGGGTTTGCACCTCACAG-3'

[0045] Downstream primer PCR2-R: 5'-CGATCGTCCATCTCCACATCTT-3'

[0046] Upstream primer PCR3-F: 5'-TCACCGCCGAGGATTTTGAG-3'

[0047] Downstream primer PCR3-R: 5'-TCCCCGAACGACCCTATCAA-3'

[0048] The reaction system is as follows:

[0049] The reaction conditions are as follows:

[0050] ⑧ PCR Product Identification: After amplification, mix 8 μL of PCR product with 2 μL of 10× Loading Buffer. Verify the size of the amplified fragment using 1% agarose gel electrophoresis. Observe and photograph the results using a gel imaging system. The identification results are as follows: Figure 2 As shown, this indicates that a monoclonal strain of ΔMnmE was successfully obtained.

[0051] ⑨ The insect strains identified as ΔMnmE were transferred to T25 culture flasks for expanded culture and then frozen in liquid nitrogen for long-term preservation.

[0052] Example 2: Use of a live attenuated vaccine containing the Toxoplasma gondii ΔMnmE strain

[0053] 2.1 Diluted injection solution of ΔMnmE for gene-deleted parasite strains

[0054] (1) Diluent Injection Formulation Weigh out 2g of NaCl, 0.0493g of KCl, 0.0605g of KH2PO4, and 0.36g of Na2HPO4·12H2O. Add ddH2O to make up to 250mL and adjust the pH to 7.4.

[0055] (2) Method for preparing diluted injection solution ① Mix thoroughly using a magnetic stirrer; ②0.22μm filter for sterilization.

[0056] 2.2 Virulence experiment of ΔMnmE deletion strain in mice

[0057] (1) Culture Toxoplasma gondii tachyzoites in HFF cells. When 40-50% of the parasites have escaped, discard the culture medium in the culture flask, add PBS to wash, remove the residual culture medium and the escaped parasites, and add dilution injection solution.

[0058] (2) Scrape off the cells with a cell scraper, aspirate the suspension 3-5 times with a 5mL sterile syringe to rupture the cells and allow the Toxoplasma gondii to escape completely. Filter the suspension with a sterile 5μm pore size filter to remove host cell debris, and count and dilute the parasite suspension with a hemocytometer.

[0059] (3) Seven-week-old female ICR mice were intraperitoneally inoculated with the ΔMnmE strain at a dose of 100 tachyzoites per mouse. Simultaneously, a control group was inoculated with RHΔku80 at a dose of 100 tachyzoites per mouse, with six mice in each group. Both groups of mice were housed in the same environment, and their survival was recorded daily for 30 days. Results are as follows: Figure 3 As shown, all mice inoculated with the ΔMnmE strain survived within 30 days, with a survival rate of 100%; all mice inoculated with the RHΔku80 strain died within 8 days, with a survival rate of 0%.

[0060] 2.3 Toxicity experiments of different doses of the ΔMnmE deletion strain on mice The ΔMnmE strain was collected according to method 2.2 and intraperitoneally inoculated into 7-week-old female ICR mice at a dose of 1×10⁻⁶. 3 1×10 4 and 1×10 5 Each mouse received 100 tachyzoites per mouse, and simultaneously received RHΔku80 as a control group, with 6 mice in each group. The four groups of mice were housed in the same environment, and the survival status of the mice was recorded daily for 30 days. Results are as follows: Figure 4 As shown, all mice inoculated with each dose of the ΔMnmE strain survived within 30 days, with a survival rate of 100%; all mice inoculated with the RHΔku80 strain died within 8 days, with a survival rate of 0%.

[0061] 2.4 Experiment on the amount of ΔMnmE parasites in mouse ascites

[0062] (1) Different groups of 7-week-old female ICR mice were injected with 1×10 5 Three mice were intraperitoneally inoculated with the ΔMnmE strain at a dose of tachyzoites / mouse, while the control group was inoculated with an equal dose of the wild-type RHΔku80 strain. Five days after infection, the mice were euthanized, and 5 mL of physiological saline was injected intraperitoneally. The mixture was then collected, and genomic DNA was extracted from 1 / 20 of the mixed ascites fluid. The genomic DNA extraction method was performed according to the instructions of the genomic DNA extraction kit.

[0063] (2) Inject 5 mL of physiological saline into blank ICR mice, then remove them to form a negative control solution. Add 10 mL of saline solution to the blank ICR mice. 2 10 3 10 4 10 5 10 6 10 7 Each Toxoplasma gondii RHΔku80 tachyzoite was mixed with 2 mL of negative control solution, and 100 μL of the mixture was taken to extract genomic DNA. The genomic DNA extraction method was performed in accordance with the instructions of the genomic DNA extraction kit.

[0064] (3) Perform qPCR experiments on insect load using the following primer sequences: RT-tubulin-F: 5'-CACTGGTACACGGGGTGAAGGT-3' RT-tubulin-R: 5'-ATTCTCCCTCTTCCTCTGCG-3'

[0065] The reaction system is as follows:

[0066] The reaction procedure is as follows:

[0067] (4) qPCR results are as follows Figure 5 As shown, the amount of *Toxoplasma gondii* in mice inoculated with the ΔMnmE knockout strain was significantly lower than that in mice inoculated with the control group RHΔku80, indicating that the reproductive capacity of *Toxoplasma gondii* ΔMnmE in mice is significantly reduced and it can be effectively eliminated by the host.

[0068] 2.5 Protective efficacy of the ΔMnmE deletion strain against mice

[0069] (1) Different groups of 7-week-old female ICR mice were injected with 1×10 4 Mice were intraperitoneally inoculated with the ΔMnmE strain at a dose of tachyzoites / mouse, with 6 mice in each group. Simultaneously, 6 mice in each group were injected with PBS as a control. All mice in each group were fed under the same conditions for 30 days.

[0070] (2) Thirty days after immunization, mice in each group that were immunized or not immunized were challenged with different strains of Toxoplasma gondii. The challenge results are shown in Table 1 below.

[0071] Table 1 RH <![CDATA[1×10 4 ]]> 6 Intraperitoneal injection RH <![CDATA[1×10 5 ]]> 6 Intraperitoneal injection ME49 <![CDATA[1×10 5 ]]> 6 Intraperitoneal injection Pru <![CDATA[1×10 5 ]]> 6 Intraperitoneal injection VEG <![CDATA[1×10 5 ]]> 6 Intraperitoneal injection

[0072] (3) The results of the mouse challenge experiment 30 days after immunization are as follows: Figure 6 As shown. The results showed that the control group mice were inoculated with 1×10 4 Or 1×10 5 Mice inoculated with the RH worm died within 8 days, while mice immunized with the ΔMnmE strain died within 13 and 11 days, respectively, with some mice showing prolonged survival. Control group mice were inoculated with 1×10⁻⁶ RH worms. 5 All mice immunized with the type II strain ME49 and Pru, as well as the type III strain VEG, died within 15 days of the acute phase, with a survival rate of 0%; while all mice immunized with the ΔMnmE strain survived within 30 days, with a survival rate of 100%.

[0073] This invention provides a live attenuated vaccine for the prevention of toxoplasmosis in animals. The immunization formulation, immunization procedure and dosage were established through animal experiments. It was found that it has a good immunoprotective effect against toxoplasmosis infection and has the potential to prepare an anti-toxoplasmosis live attenuated vaccine.

Claims

1. A live attenuated Toxoplasma gondii vaccine lacking the MnmE gene, characterized in that, The Toxoplasma gondii basic strain is RHΔku80, which contains the tRNA-modified GTPase gene: MnmE gene. The nucleotide sequence of the MnmE gene is shown in SEQ ID NO.

1. The Toxoplasma gondii gene deletion strain has the nucleotide sequence shown in SEQ ID NO:2 at the MnmE site.

2. The Toxoplasma gondii attenuated live vaccine according to claim 1, characterized in that, The gene-deleted vaccine is prepared as a suspension of tachyzoites of the Toxoplasma gondii vaccine strain using a diluted injection solution as a solvent.

3. The Toxoplasma gondii attenuated live vaccine lacking the MnmE gene as described in claim 1, characterized in that, The method for constructing the Toxoplasma gondii strain lacking the MnmE gene is achieved through the following steps: (1) Starting strain RHΔku80: The basic strain of Toxoplasma gondii RHΔku80 was selected. The strain is a type I strain of Toxoplasma gondii belonging to the family Toxoplasmidae in the order Coccidioidea. The basic strain of Toxoplasma gondii RHΔku80 contains the tRNA-modified GTPase gene: MnmE gene. The nucleotide sequence of the MnmE gene is shown in SEQ ID NO.

1. The Toxoplasma gondii gene deletion strain has the nucleotide sequence shown in SEQ ID NO:2 at the MnmE site. (2) Construction of pSAG1-Cas9-TgU6-sgMnmE plasmid: Using pSAG1-Cas9-TgU6-sgBbsI plasmid as a template, the plasmid was digested with BbsI enzyme, and the upstream and downstream primers were synthesized into double strands by gradient cooling. The plasmid was then ligated using Solution I and transformed into E. coli TOP10 to obtain pSAG1-Cas9-TgU6-sgMnmE plasmid. The upstream and downstream primer sequences are as follows: gRNA-MnmE-F: 5'-ACAGGGAGCCGGTTCTCATG-3' gRNA-MnmE-R: 5'-CATGAGAACCGGCTCCCTGT-3'; (3) Preparation of homologous templates for MnmE-5UTR::DHFR::MnmE-3UTR: Using pBlue-DHFR plasmid as a template, primers were designed to amplify template sequences containing homologous arms of MnmE-5UTR and MnmE-3UTR. The primer sequences for amplifying the homologous template of MnmE-5UTR::DHFR::MnmE-3UTR were as follows: MnmE-5UTR-F: 5'-AAGCTACGCGGGTTATTCGTACGCAACCTGAGAACCCGCCTGTCATTCGATTTTCACCC-3' MnmE-3UTR-R: 5'-AAATGCCTCGCGTAGCGGCGAAAACGCGACGCGTGTGTCTGGATCGATCCCCCCGGGCTG-3'; (4) Obtaining the Toxoplasma gondii gene-deleted strain ΔMnmE: The homologous templates pSAG1-Cas9-TgU6-sgMnmE from step (2) and MnmE-5UTR::DHFR::MnmE-3UTR from step (3) were co-electrotransferred to the starting strain described in step (1), screened by 3 μM pyrimethamine, and identified by PCR to obtain the tRNA-modified GTPase MnmE gene-deleted strain ΔMnmE. The ΔMnmE-deleted strain lacks the nucleotide sequence shown in SEQ ID NO: 1.

Images