Nucleic acid synthesis chip and its application, nucleic acid synthesis method
By designing a stepped-hole structure for the nucleic acid synthesis chip and using inkjet printing technology, the problems of low synthesis throughput and reagent waste in existing column synthesizers have been solved, achieving efficient and low-cost nucleic acid synthesis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ACADEMY OF MILITARY MEDICAL SCIENCES
- Filing Date
- 2023-06-05
- Publication Date
- 2026-06-02
AI Technical Summary
Existing column-based oligonucleotide synthesizers have low throughput, require manual loading of synthesis carriers, are time-consuming, and result in significant waste of synthesis reagents, leading to environmental pollution.
Design a nucleic acid synthesis chip with multiple stepped wells, including coarse and fine wells, use inkjet printing technology to deliver reagents, and load the synthesis carrier by vibration or solvent method to achieve batch loading and micro-addition.
This approach increases synthesis throughput, saves carrier materials, reduces synthesis costs, and minimizes reagent waste, thus achieving highly efficient nucleic acid synthesis.
Smart Images

Figure CN116651350B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a nucleic acid synthesis chip and its application, as well as a nucleic acid synthesis method. Background Technology
[0002] Currently, the most widely used oligonucleotide synthesizers on the market are column-based oligonucleotide synthesizers based on phosphoramide chemical synthesis. These column-based synthesizers utilize the dense packing of controlled-pore glass (CPG) particles within the synthesis column to obtain a large effective reaction surface area, and then complete multiple cycles of synthesis reactions, including deprotection, coupling, capping, and oxidation, through the synthesizer's liquid addition device.
[0003] However, existing column synthesis methods have the following drawbacks:
[0004] The synthesis throughput is low, with a throughput of 96,1536 oligonucleotides.
[0005] The synthetic carriers need to be manually filled one by one, which is time-consuming.
[0006] The synthesis column is large and the synthesis carrier is redundant, which leads to a lot of waste of synthesis reagents and materials during the synthesis process. These reagents also cause environmental pollution.
[0007] In view of this, the present invention is hereby proposed. Summary of the Invention
[0008] The first objective of this invention is to provide a nucleic acid synthesis chip to solve at least one of the above-mentioned problems.
[0009] The second objective of this invention is to provide the application of the above-mentioned nucleic acid synthesis chip in nucleic acid synthesis.
[0010] A third objective of this invention is to provide a method for nucleic acid synthesis.
[0011] In a first aspect, the present invention provides a nucleic acid synthesis chip, wherein the nucleic acid synthesis chip is provided with a plurality of stepped holes; the stepped holes include coarse holes and fine holes, the coarse hole end is located on the upper surface of the nucleic acid synthesis chip, and the fine hole end is located on the lower surface of the nucleic acid synthesis chip;
[0012] The diameter of the coarse pore is 160-240μm, and the depth is 320-480μm;
[0013] The diameter of the pores is 40-60 μm and the depth is 80-120 μm.
[0014] As a further technical solution, the diameter of the coarse hole is 200μm and the depth is 400μm;
[0015] The diameter of the pore is 50 μm and the depth is 100 μm.
[0016] As a further technical solution, each stepped hole includes 1-4 fine holes.
[0017] As a further technical solution, the density of stepped wells on the nucleic acid synthesis chip is 1000-1500 per cm². 2 .
[0018] As a further technical solution, the nucleic acid synthesis chip is equipped with markers for alignment of the synthesis instrument.
[0019] Secondly, the present invention provides the application of the above-mentioned nucleic acid synthesis chip in nucleic acid synthesis.
[0020] Thirdly, the present invention provides a nucleic acid synthesis method, comprising the following steps: using the nucleic acid synthesis chip as a reaction container, loading a synthesis carrier into the nucleic acid synthesis chip, and then synthesizing nucleic acid on the synthesis carrier;
[0021] The reagents used in nucleic acid synthesis are added from the coarse end of the step pore and discharged from the fine end.
[0022] As a further technical solution, the loading method of the synthetic carrier includes vibration method and solvent method;
[0023] Preferably, the solvent method includes: placing the nucleic acid synthesis chip in a solvent containing the synthesis carrier, and then drying the solvent to complete the loading of the synthesis carrier.
[0024] As a further technical solution, the synthetic carrier includes a polystyrene carrier and a CPG carrier (porous glass carrier);
[0025] Preferably, the average particle size of the synthetic support is 50-100 μm.
[0026] As a further technical solution, inkjet printing technology is used to deliver reagents used for nucleic acid synthesis into the stepped wells.
[0027] Compared with the prior art, the present invention has the following beneficial effects:
[0028] The nucleic acid synthesis chip provided by this invention has small synthesis wells and high synthesis throughput, which can realize the batch loading of carriers, save carrier materials, and while meeting the synthesis capacity, it can also be used with inkjet printing technology to realize the micro-addition of synthesis monomers and other reagents, which significantly reduces synthesis costs.
[0029] The nucleic acid synthesis method provided by this invention has high throughput and low cost. Attached Figure Description
[0030] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0031] Figure 1 This is a schematic diagram of the structure of the nucleic acid synthesis chip provided by the present invention;
[0032] Figure 2 The stepped hole containing a fine hole is provided by the present invention;
[0033] Figure 3 The stepped hole containing two fine holes provided by the present invention;
[0034] Figure 4 This is a flowchart of the nucleic acid synthesis chip provided in Embodiment 1 of the present invention. Detailed Implementation
[0035] The embodiments and examples of the present invention will be described in detail below. However, those skilled in the art will understand that the following embodiments and examples are for illustrative purposes only and should not be considered as limiting the scope of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Unless otherwise specified, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0036] In a first aspect, the present invention provides a nucleic acid synthesis chip, wherein the nucleic acid synthesis chip is provided with a plurality of stepped holes; the stepped holes include coarse holes and fine holes, the coarse hole end is located on the upper surface of the nucleic acid synthesis chip, and the fine hole end is located on the lower surface of the nucleic acid synthesis chip;
[0037] The diameter of the coarse pores can be, for example, but not limited to, 160μm, 170μm, 180μm, 190μm, 200μm, 210μm, 220μm, 230μm, or 240μm, and the depth of the coarse pores can be, for example, but not limited to, 320μm, 340μm, 360μm, 380μm, 400μm, 420μm, 440μm, 460μm, or 480μm. The stepped pores of this invention have a large coarse pore depth, enabling the loading of more synthetic carriers, unlike the single-particle loading of other chips. This significantly increases the synthetic loading capacity of each synthetic pore. Loading dozens of carrier particles also eliminates the difference in loading capacity caused by variations in carrier particle size, resulting in a more uniform total loading capacity of the synthetic pores. Furthermore, it eliminates the need for screening chips to sieve carrier particle sizes.
[0038] The diameter of the pores can be, for example, but not limited to, 40μm, 43μm, 45μm, 47μm, 50μm, 52μm, 55μm, 57μm or 60μm, and the depth of the pores can be, for example, but not limited to, 80μm, 85μm, 90μm, 95μm, 100μm, 105μm, 110μm, 115μm or 120μm.
[0039] The nucleic acid synthesis chip provided by this invention has small synthesis wells and high synthesis throughput, which can realize the batch loading of carriers, save carrier materials, and while meeting the synthesis capacity, it can also be used with inkjet printing technology to realize the micro-addition of synthesis monomers and other reagents, which significantly reduces synthesis costs.
[0040] In some preferred embodiments, the diameter of the coarse pore is 200 μm and the depth is 400 μm;
[0041] The diameter of the pore is 50 μm and the depth is 100 μm.
[0042] In some preferred embodiments, each stepped hole includes 1, 2, 3 or 4 fine holes.
[0043] Because the pore diameter of the stepped pores is small, blockage or poor drainage may occur after the synthetic carrier is loaded. Therefore, in order to alleviate the above situation, multiple pores can be set for each stepped pore.
[0044] In some preferred embodiments, a stepped aperture containing one fine hole is such as Figure 2 As shown, a stepped aperture containing two fine pores is as follows: Figure 3 As shown.
[0045] In some preferred embodiments, the density of the stepped wells on the nucleic acid synthesis chip can be, for example, but not limited to, 1000 wells / cm². 2 1100 pieces / cm 2 1200 pieces / cm2 1300 pieces / cm 2 1400 pieces / cm 2 Or 1500 pieces / cm 2 .
[0046] In some preferred embodiments, a square chip with a side length of 60mm can contain about 50,000 synthetic vias, with a throughput of up to 50,000.
[0047] In some preferred embodiments, the nucleic acid synthesis chip is fabricated from silicon-based materials.
[0048] Silicon wafers possess physical properties of high temperature and corrosion resistance. The composite holes are fabricated using photolithography and double-sided etching.
[0049] In some preferred embodiments, the nucleic acid synthesis chip is provided with markers for alignment of the synthesis instrument.
[0050] In some preferred embodiments, the structure of the nucleic acid synthesis chip is as follows: Figure 1 As shown.
[0051] In this invention, there are no specific restrictions on the position and shape of the markings, as long as they can be used for the alignment of the synthesis instrument. For example, a cross mark can be made on the lower left corner of the nucleic acid synthesis chip.
[0052] Secondly, the present invention provides the application of the above-mentioned nucleic acid synthesis chip in nucleic acid synthesis.
[0053] The nucleic acid synthesis chip provided by this invention can be used for nucleic acid synthesis.
[0054] Thirdly, the present invention provides a nucleic acid synthesis method, comprising the following steps: using the nucleic acid synthesis chip as a reaction container, loading a synthesis carrier into the nucleic acid synthesis chip, and then synthesizing nucleic acid on the synthesis carrier;
[0055] The reagents used in nucleic acid synthesis are added from the coarse end of the step pore and discharged from the fine end.
[0056] The nucleic acid synthesis method provided by this invention has high throughput and low cost.
[0057] In some preferred embodiments, the method for discharging reagents used in nucleic acid synthesis from the pores includes applying negative pressure to the lower surface of the nucleic acid synthesis chip or applying positive pressure to the upper surface of the nucleic acid synthesis chip.
[0058] In some preferred embodiments, the loading method of the synthetic carrier includes vibration method and solvent method;
[0059] One example of the oscillation method is as follows: The carrier particles are laid flat on the surface of the chip, and vibration is used to shake the carrier into the synthesis hole. Since the upper diameter of the synthesis hole is larger than the carrier used, and the lower diameter is smaller than the carrier used, the carrier particles will be trapped inside the synthesis hole. Excess carrier on the surface can then be removed using a scraper or adhesive plate. If the carrier is too large or too small, it will not be able to enter the synthesis hole and will be removed or fall out from below.
[0060] The solvent method can be, for example, by placing an excess of carrier particles in a solvent to make the carrier evenly distributed in the solvent (e.g., water, methanol, ethanol, acetone, etc.), placing the synthesized chip at the bottom of the solution, using a dryer to evaporate the solvent, and the carrier evenly dispersed in the synthesis holes, and finally removing the excess carrier from the chip surface.
[0061] By controlling the concentration of the carrier in the solvent or the volume of the solvent, solvent loading can achieve controllable carrier filling, making the carrier filling amount in each well basically the same, thus solving the technical problem of poor control of carrier loading amount (too much or too little loading) in the prior art.
[0062] In some preferred embodiments, the synthetic vector includes a polystyrene vector and a cpg vector, and can be a commercially available or self-made DNA solid-phase synthetic vector.
[0063] Preferably, the average particle size of the synthetic support can be, for example, but not limited to, 50 μm, 60 μm, 70 μm, 80 μm, 90 μm or 100 μm.
[0064] In some preferred embodiments, inkjet printing technology is used to deliver reagents for nucleic acid synthesis into the stepped wells.
[0065] Existing technologies use syringe pumps to deliver generic reagents to the chip surface and inkjet printheads to deliver base monomers to the synthesis wells. The inventors discovered that after delivering the generic reagents to the chip surface, before applying negative pressure, residual reagents, such as base monomers, in the synthesis wells can cross over into other synthesis wells, affecting synthesis accuracy. Therefore, this invention uses an inkjet printhead to directly deliver the reagents (generic reagents and base monomers) used for nucleic acid synthesis to the synthesis wells to avoid the aforementioned problems.
[0066] Moreover, inkjet printing technology allows for the use of appropriate amounts of reagents to complete the synthesis reaction, achieving more efficient and lower-cost synthesis and reducing reagent waste.
[0067] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.
[0068] Example 1
[0069] 1. Fabrication of Synthetic Chips
[0070] It is fabricated using 4-inch silicon-based wafers through micro-nano fabrication techniques such as photolithography and etching. Figure 4 As shown ( Figure 4 (In the diagram: 101 represents the silicon wafer; 102 represents the photoresist). First, photoresist is spin-coated onto the front side of the silicon wafer. After pre-baking, exposure, and development, the pattern to be etched on the upper surface of the composite chip is obtained, which is step 103. Deep silicon etching is used to obtain the larger diameter holes in the upper part of the composite chip, which is step 104. The surface photoresist is removed through a photoresist stripping step, which is step 105. Then, photoresist is spin-coated onto the back side of the wafer. After pre-baking, exposure, and development, the pattern to be etched on the lower surface of the composite chip is obtained, which is step 106. Deep silicon etching is used to obtain the smaller diameter holes in the lower part of the composite chip, which is step 107. The surface photoresist is removed through a photoresist stripping step, which is step 108. Finally, laser cutting technology is used to cut the wafer to the corresponding dimensions to obtain the composite chip, and a cross alignment mark is engraved on the lower left corner of the chip. The fabrication of the composite chip is complete.
[0071] The prepared nucleic acid synthesis chip has step-like pores. Figure 2 As shown, the coarse pores have a diameter of 200 μm and a depth of 400 μm; the fine pores have a diameter of 50 μm and a depth of 100 μm.
[0072] 2. Loading of the carrier
[0073] Solvent method: Place excess carrier particles in a solvent to make the carrier evenly distributed in the solvent. Place the synthesized chip at the bottom of this solution and use a dryer to evaporate the solvent. The carrier is evenly dispersed in the synthesis holes. Finally, remove the excess carrier from the chip surface.
[0074] The carrier was cross-linked polystyrene particles with an average particle size of 75 μm.
[0075] 3. Loading of the synthesis chip containing the synthesis carrier:
[0076] The synthesis chip, containing the synthesis carrier, is placed in the chip slot of the synthesis instrument and secured with clamps. An inkjet printhead and a microscope lens are positioned above the chip slot, while the space below is a cavity that allows for the removal of reaction reagents during the synthesis process by applying positive or negative pressure above or below the chip. The chip is situated in a tightly sealed environment, facilitating the control of the anhydrous and oxygen-free environment required for the synthesis process.
[0077] 4. Synthesis of single oligonucleotide sequences:
[0078] The oligonucleotide synthesis strategy is the general phosphoramide synthesis method, which includes four steps in each cycle: deprotection, coupling, capping, and oxidation. After multiple cycles, the final oligonucleotide product is obtained. The oligonucleotide sequence to be synthesized in this embodiment is AATTTCGTAGTCCTG (SEQ ID NO.1), with a DMT protecting group retained at the 5' end for easy product collection and verification.
[0079] The main operating steps are as follows:
[0080] A. Place the synthesis chip, loaded with the synthesis carrier, into the chip slot of the synthesis instrument and secure it with a clamp. Use a microscope lens to identify the crosshair positioning mark on the lower left corner of the chip. After identification and alignment, align the lens with the target synthesis hole according to the inherent coordinates of the crosshair mark and the synthesis hole. Then, based on the relative position of the lens and the inkjet printhead, align the inkjet printhead with the target synthesis hole to complete the inkjet head alignment.
[0081] B introduces an appropriate amount of high-purity argon gas into a sealed environment, monitors the oxygen and water vapor content in the sealed environment, and monitors the gas pressure in the sealed environment until the system stabilizes.
[0082] C uses an inkjet printhead to deliver the deprotection reagent to the target synthesis well, and reacts for 40 seconds. Negative pressure is then used to completely remove the reagent from the synthesis well.
[0083] D uses an inkjet printhead to deliver cleaning agent to the target synthesis hole, and uses negative pressure to completely empty the reagent in the target synthesis hole. This step is repeated three times.
[0084] E uses an inkjet printhead to deliver the required nucleoside monomer G into the target synthesis well, followed by the delivery of an activating reagent into the well. The reaction proceeds for 30 seconds. Negative pressure is then used to completely evacuate the reagent from the synthesis well.
[0085] F uses an inkjet printhead to deliver cleaning agent to the target synthesis hole, and uses negative pressure to completely empty the reagent in the target synthesis hole. This step is repeated three times.
[0086] G uses an inkjet printhead to deliver equal volumes of CapA and CapB reagents to the target synthesis wells, respectively, and reacts for 20 seconds. Negative pressure is then used to completely evacuate the reagents from the synthesis wells.
[0087] H uses an inkjet printhead to deliver cleaning agent to the target synthesis hole, and uses negative pressure to completely empty the reagent in the target synthesis hole. This step is repeated three times.
[0088] I. I use an inkjet printhead to deliver iodine oxidant to the target synthesis well, and react for 20 seconds. Negative pressure is then used to completely evacuate the reagent from the synthesis well.
[0089] J uses an inkjet printhead to deliver cleaning agent to the target synthesis hole, and uses negative pressure to completely empty the reagent in the target synthesis hole. This step is repeated three times.
[0090] K represents a synthetic cycle of CJ, which is repeated according to the synthetic sequence. The nucleoside monomers added in each cycle are T, C, C, T, G, A, T, G, C, T, T, A, A.
[0091] After L synthesis was complete, the synthesized chip was removed and placed in a gas-phase ammonolysis apparatus for 2 hours to cleave the oligonucleotide chains from the carrier. A small amount of water was added to dissolve the oligonucleotides, yielding an oligonucleotide solution.
[0092] The final product obtained in this embodiment, as determined by mass spectrometry, has a molecular weight of 4315.8, which is consistent with the molecular weight of the target sequence.
[0093] Example 2
[0094] To verify the effectiveness of the nucleic acid synthesis chip designed in this invention for high-throughput oligonucleotide synthesis, the synthesis strategy was the same as in Example 1, namely the phosphoramide synthesis method. For ease of product verification, two oligonucleotide sequences of different lengths were selected in this example:
[0095] ATCATCTCCATCCGCTC(SEQ ID NO.2),17nt;
[0096] GATCGTCGTCGACTGCTAGCTGATCGATCGTAGCTACGTGTCGAT (SEQ ID NO. 3), 45 nt.
[0097] Two 10x10 synthesis aperture arrays were selected on the synthesis chip as target synthesis aperture arrays. These two 10x10 synthesis aperture arrays were used to synthesize the two target sequences mentioned above, respectively. When collecting the synthesis products, the products were collected separately for verification, using the two arrays as units.
[0098] The main operating steps are as follows:
[0099] A. Place the synthesis chip, loaded with the synthesis carrier, into the chip slot of the synthesis instrument and secure it with a clamp. Use a microscope lens to identify the crosshair positioning mark on the lower left corner of the chip. After identification and alignment, align the lens with the target synthesis hole according to the inherent coordinates of the crosshair mark and the synthesis hole. Then, based on the relative position of the lens and the inkjet printhead, align the inkjet printhead with the target synthesis hole to complete the inkjet head alignment.
[0100] B introduces an appropriate amount of high-purity argon gas into a sealed environment, monitors the oxygen and water vapor content in the sealed environment, and monitors the gas pressure in the sealed environment until the system stabilizes.
[0101] C uses an inkjet printhead to deliver the deprotection reagent to the target synthesis well, and reacts for 40 seconds. Negative pressure is then used to completely remove the reagent from the synthesis well.
[0102] D uses an inkjet printhead to deliver cleaning agent to the target synthesis hole, and uses negative pressure to completely empty the reagent in the target synthesis hole. This step is repeated three times.
[0103] E uses an inkjet printhead to deliver the required nucleoside monomer into the target synthesis well, followed by the delivery of an activating reagent into the well, and reacts for 30 seconds. Negative pressure is then used to completely evacuate the reagent from the synthesis well.
[0104] F uses an inkjet printhead to deliver cleaning agent to the target synthesis hole, and uses negative pressure to completely empty the reagent in the target synthesis hole. This step is repeated three times.
[0105] G uses an inkjet printhead to deliver equal volumes of CapA and CapB reagents to the target synthesis wells, respectively, and reacts for 20 seconds. Negative pressure is then used to completely evacuate the reagents from the synthesis wells.
[0106] H uses an inkjet printhead to deliver cleaning agent to the target synthesis hole, and uses negative pressure to completely empty the reagent in the target synthesis hole. This step is repeated three times.
[0107] I. I use an inkjet printhead to deliver iodine oxidant to the target synthesis well, and react for 20 seconds. Negative pressure is then used to completely evacuate the reagent from the synthesis well.
[0108] J uses an inkjet printhead to deliver cleaning agent to the target synthesis hole, and uses negative pressure to completely empty the reagent in the target synthesis hole. This step is repeated three times.
[0109] K represents a synthesis cycle, where the CJ cycle is repeated according to the synthesis sequence until all target synthesis wells have completed the predetermined sequence synthesis.
[0110] After L synthesis was completed, the synthesis chip was removed and placed in a gas phase ammonolysis apparatus for 2 hours to cut the oligonucleotide chains from the carrier. The products of the two synthesis arrays were cut into two containers, and a small amount of water was added to dissolve them to obtain two oligonucleotide solutions.
[0111] The final products obtained in this embodiment, as determined by mass spectrometry, have molecular weights of 5103.28 and 13920.99, which are consistent with the target sequence molecular weights.
[0112] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A method for synthesizing nucleic acids, characterized in that, Includes the following steps: Using a nucleic acid synthesis chip as a reaction vessel, a synthesis carrier is loaded into the nucleic acid synthesis chip, and then nucleic acids are synthesized on the synthesis carrier; Reagents used in nucleic acid synthesis are added from the coarse end of the step pore and discharged from the fine end; The nucleic acid synthesis chip is provided with multiple stepped holes; the stepped holes include coarse holes and fine holes, with the coarse hole end located on the upper surface of the nucleic acid synthesis chip and the fine hole end located on the lower surface of the nucleic acid synthesis chip; The diameter of the coarse pore is 160-240μm, and the depth is 320-480μm; The diameter of the pores is 40-60 μm and the depth is 80-120 μm; The loading method for the synthetic carrier is the solvent method; The solvent method includes: placing the nucleic acid synthesis chip in a solvent containing the synthesis carrier, and then drying the solvent to complete the loading of the synthesis carrier; The synthetic carriers include polystyrene carriers and CPG carriers; The average particle size of the synthetic support is 50-100 μm.
2. The nucleic acid synthesis method according to claim 1, characterized in that, The diameter of the coarse pore is 200 μm and the depth is 400 μm; The diameter of the pore is 50 μm and the depth is 100 μm.
3. The nucleic acid synthesis method according to claim 1, characterized in that, Each stepped hole includes 1-4 fine holes.
4. The nucleic acid synthesis method according to claim 1, characterized in that, The density of the stepped wells on the nucleic acid synthesis chip is 1000-1500 per cm³. 2 .
5. The nucleic acid synthesis method according to claim 1, characterized in that, The nucleic acid synthesis chip is equipped with markers for alignment of the synthesis instrument.
6. The nucleic acid synthesis method according to claim 1, characterized in that, Reagents used in nucleic acid synthesis are delivered into stepped wells using inkjet printing technology.