Agaricus bisporus strains and methods for culturing the same, fruiting bodies and methods for culturing the same

CN116656508BActive Publication Date: 2026-08-11CHONGQING ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-30
Publication Date
2026-08-11

AI Technical Summary

Technical Problem

目前国内外主栽双孢蘑菇品种为白色,其子实体易褐变而导致商品质量下降,降低生产效益

Benefits of technology

[0067] The button mushroom strain provided in this application has a brown cap on its fruiting body, and the product quality will not decline due to browning; it can be cultivated without soil covering, which can simplify cultivation techniques, increase yield, and have good economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116656508B_ABST
    Figure CN116656508B_ABST
Patent Text Reader

Abstract

This invention provides a *Agaricus bisporus* strain and its cultivar, as well as the fruiting body and its cultivar cultivation method. The *Agaricus bisporus* strain has the preservation number CGMCC No. 40369. The fruiting body is obtained by cultivating the *Agaricus bisporus* strain. The cultivar cultivation method of the *Agaricus bisporus* strain includes: mixing potato dextrose agar medium to obtain a mother culture medium, sterilizing it, inoculating it with the *Agaricus bisporus* strain, and culturing in the dark to obtain the mother culture; inoculating the mother culture into a primary culture medium and culturing in the dark to obtain the primary culture; and inoculating the primary culture into a cultivar cultivation medium and culturing in the dark to obtain the cultivar. The fruiting body cultivation method involves inoculating the cultivar of the *Agaricus bisporus* strain onto the fruiting body culture medium, and after germination, culturing with or without soil covering. The *Agaricus bisporus* strain provided in this application has a brown cap and can be cultured without soil covering.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of edible fungi, and more particularly to a strain of Agaricus bisporus and its cultivation method, as well as the fruiting body and its cultivation method. Background Technology

[0002] Button mushrooms, classified under the order Agaricales, family Agaricales, and genus Agaricus, are also known as button mushrooms. They are currently the most widely cultivated edible mushroom species in the world and one of the main cultivated varieties in my country. The most commonly cultivated button mushroom varieties both domestically and internationally are white, but their fruiting bodies are prone to browning, leading to a decline in market quality and reduced production efficiency. Casing is a crucial step in button mushroom cultivation; this step is complex and has a significant impact on yield, thus limiting the improvement of button mushroom production and the integration of simplified cultivation techniques.

[0003] In view of the above, this application is hereby submitted. Summary of the Invention

[0004] The purpose of this invention is to provide a method for cultivating a strain of Agaricus bisporus and its cultivars, as well as a method for cultivating the fruiting body therein, in order to solve the above-mentioned problems.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A strain of Agaricus bisporus has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 40369.

[0007] This application presents a mutant Agaricus bisporus strain, named JJHM, collected from an Agaricus bisporus cultivation site. This strain exhibits a change in cap morphology from the original strain's white to brown, and can form brown fruiting bodies without covering the substrate. No similar reports have been found domestically or internationally to date. The discovery of this strain will reduce the impact of soil covering on Agaricus bisporus cultivation, enabling simplified cultivation, reducing production inputs, and achieving, for the first time, a soil-free cultivation method for Agaricus bisporus. It also overcomes the problem of browning in white varieties. Therefore, this strain possesses significant germplasm innovation and great potential for application and development.

[0008] A fruiting body obtained by cultivating the aforementioned Agaricus bisporus strain.

[0009] A method for cultivating a cultivar of the aforementioned Agaricus bisporus strain, comprising:

[0010] The raw materials of potato dextrose agar medium were mixed to obtain the mother culture medium. After sterilization, the Agaricus bisporus strain was inoculated and cultured in the dark to obtain the mother culture. The mother culture was then inoculated into the original culture medium and cultured in the dark to obtain the original culture.

[0011] The original strain was inoculated into the culture medium for the cultivated strain and cultured statically in the dark to obtain the cultivated strain.

[0012] Preferably, the temperature for each of the static, light-protected incubation sessions is 23-27°C.

[0013] Optionally, the temperature for static, light-protected incubation can be any value between 23°C, 24°C, 25°C, 26°C, 27°C, and 23-27°C.

[0014] Preferably, the raw materials for the primary culture medium and the cultivated culture medium, calculated by weight percentage, each independently comprise:

[0015] Waste bedding material 45-48%, rice straw 45-48%, gypsum 2%-4%, and lime 1%-2%;

[0016] The waste bedding material includes one or more of the following: waste pigsty bedding, waste sheepsty bedding, waste cattlesty bedding, waste chickensty bedding, waste ducksty bedding, and waste geesety bedding.

[0017] Optionally, in the raw materials of the original culture medium and the cultivated culture medium, the amount of waste bedding can be any value between 45%, 46%, 47%, 48% and 45-48%, the amount of rice straw can be any value between 45%, 46%, 47%, 48% and 45-48%, the amount of gypsum can be any value between 2%, 3%, 4% and 2%-4%, and the amount of lime can be any value between 1%, 2%, and 1%-2%.

[0018] Preferably, the preparation method of the original culture medium and the cultivated culture medium includes: mixing the raw materials and then adding water for fermentation;

[0019] Preferably, the mixing includes: pre-wetting the waste bedding material and the straw, and then adding the gypsum and the lime;

[0020] Preferably, after adding water, the water content of the mixture is 58-65 wt%.

[0021] Optionally, the water content of the mixture after adding water can be any value between 58wt%, 59wt%, 60wt%, 61wt%, 62wt%, 63wt%, 64wt%, 65wt%, and 58-65wt%.

[0022] Preferably, the mother culture medium is sterilized at 120-125℃ for 20-30 min before use, and the original culture medium and the cultivated culture medium are sterilized at 120-125℃ for 2-3 h before use;

[0023] Preferably, 20-30g of the original seed is inoculated into every 0.9-1.1kg of the culture medium containing the cultivated seed.

[0024] Optionally, the sterilization temperature of the mother culture medium before use can be any value between 120℃, 121℃, 122℃, 123℃, 124℃, 125℃ and 120-125℃, and the sterilization time can be any value between 20min, 25min, 30min and 20-30min.

[0025] The sterilization temperature of the original culture medium and the cultivated culture medium before use can be any value between 120℃, 121℃, 122℃, 123℃, 124℃, 125℃ and 120-125℃, and the sterilization time can be any value between 2h, 2.5h, 3h and 2-3h.

[0026] A method for cultivating the aforementioned sub-entity, comprising:

[0027] The cultivar of Agaricus bisporus is inoculated onto a fruiting body culture medium. After the mycelium has fully grown on the fruiting body culture medium, the fruiting bodies are obtained by either covering the culture medium with soil or by culture without covering the culture medium.

[0028] Preferably, the raw materials for the fruiting body culture medium, calculated by mass percentage, include:

[0029] Waste bedding material 20%-50%, edible fungus residue 30%-60%, bamboo shavings 4%-5%, and auxiliary materials 12%-25%;

[0030] Based on the total mass of the raw materials as 100%, the auxiliary materials include 3%-6% oil filter cake, 3%-6% corn flour, 1%-2% superphosphate, 1%-3% light calcium carbonate, 2%-4% gypsum and 1%-2% lime;

[0031] Optionally, in the raw materials of the fruiting body culture medium, the amount of waste bedding material can be any value between 20%, 30%, 40%, 50%, and 20%-50%; the amount of edible mushroom residue can be any value between 30%, 40%, 50%, 60%, and 30%-60%; the amount of bamboo shavings can be any value between 4%, 4.5%, 5%, and 4%-5%; and the amount of auxiliary materials can be 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, and 12%-25%. The amount of oil filter cake used in the auxiliary materials can be any value between 3%, 4%, 5%, 6%, and 3%-6%; the amount of corn flour can be any value between 3%, 4%, 5%, 6%, and 3%-6%; the amount of superphosphate can be any value between 1%, 1.5%, 2%, and 1%-2%; the amount of light calcium carbonate can be any value between 1%, 2%, 3%, and 1%-3%; the amount of gypsum can be any value between 2%, 3%, 4%, and 2%-4%; and the amount of lime can be any value between 1%, 2%, and 1%-2%.

[0032] Preferably, the waste bedding material includes one or more of the following: waste pigsty bedding, waste sheepsty bedding, waste cattlesty bedding, waste chickensty bedding, waste ducksty bedding, and waste geesety bedding.

[0033] The waste bedding material is generally made from waste materials after 10-20 months of use, and by weight percentage includes 60%-70% sawdust, 10%-15% microbial agent, and 15%-30% poultry manure.

[0034] Preferably, the edible mushroom residue includes one or more of the following: king oyster mushroom residue, enoki mushroom residue, shiitake mushroom residue, and enoki mushroom residue.

[0035] Bamboo shavings are waste products from paper mills.

[0036] Preferably, the method for preparing the fruiting body culture medium includes:

[0037] The raw materials of the fruiting body culture medium are mixed with water to obtain a mixture, and then fermented to obtain the fruiting body culture medium;

[0038] Preferably, the water content of the mixture is 50wt%-60wt%;

[0039] Optionally, the water content of the mixture can be any value between 50wt%, 51wt%, 52wt%, 53wt%, 54wt%, 55wt%, 56wt%, 57wt%, 58wt%, 59wt%, 60wt%, and 50wt%-60wt%.

[0040] Preferably, the mixing process includes: pre-wetting the waste bedding material, the edible fungus residue, and the bamboo shavings with water, then adding the auxiliary materials and mixing them evenly, and then adjusting the moisture content of the mixture;

[0041] Preferably, the fermentation includes: covering the mixture with a film and letting it sit for 1-2 days, then building a pile and covering it with a film, turning the pile over during the process;

[0042] Preferably, the turning of the pile includes: after the pile is heated to 65℃-70℃, it is kept at 1-2 days for the first turning, and then the pile is turned once every 5-7 days, for a total of 3-5 turnings;

[0043] Preferably, the water content of the fruiting body culture medium obtained by fermentation is 60wt%-65wt%, and the pH is 7.0-7.5.

[0044] Optionally, the control point for the temperature rise of the compost pile can be any value between 65℃, 66℃, 67℃, 68℃, 69℃, 70℃ and 65℃-70℃; the time interval for turning the pile can be any value between 5 days, 6 days, 7 days and 5-7 days; the number of times the pile is turned can be 3 times, 4 times or 5 times; the water content of the fruiting body culture medium obtained by fermentation can be any value between 60wt%, 61wt%, 62wt%, 63wt%, 64wt%, 65wt% and 60wt%-65wt%, and the pH can be any value between 7.0, 7.1, 7.2, 7.3, 7.4, 7.5 and 7.0-7.5.

[0045] Preferably, the soil covering cultivation includes:

[0046] When the mycelium penetrates to a depth of 5 cm or more into the fruiting body culture medium, cover with soil, then apply insecticide, and control the temperature and humidity in the first stage after covering with soil. After the mycelium penetrates 2 cm-4 cm into the soil, control the temperature and humidity in the second stage after covering with soil until the harvest stage.

[0047] Preferably, the mycelium is covered with soil when it penetrates 5-10 cm into the fruiting body culture medium;

[0048] Preferably, the thickness of the soil covering is 3cm-5cm;

[0049] Optionally, the timing of casing can be any value between 5cm, 6cm, 7cm, 8cm, 9cm, 10cm and 5cm-10cm when the mycelium penetrates the fruiting body culture medium; the thickness of the casing can be any value between 3cm, 4cm, 5cm and 3cm-5cm.

[0050] Preferably, the ambient temperature in the first stage after covering with soil is 20℃-25℃ and the humidity is 80%-85%;

[0051] Preferably, the ambient temperature in the second stage after covering with soil is 14℃-18℃ and the humidity is 90%-95%.

[0052] Optionally, the ambient temperature in the first stage after covering with soil can be any value between 20℃, 21℃, 22℃, 23℃, 24℃, 25℃ and 20℃-25℃, and the humidity can be any value between 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80% and 70%-80%; the ambient temperature in the second stage after covering with soil can be any value between 14℃, 15℃, 16℃, 17℃, 18℃ and 14℃-18℃, and the humidity can be any value between 90%, 91%, 92%, 93%, 94%, 95% and 90-95%.

[0053] Preferably, ventilation is performed in the second stage after the soil covering;

[0054] Preferably, the second stage after covering with soil involves spraying water onto the cultivation system;

[0055] Preferably, the soil-free cultivation includes: after the mycelium germinates, the temperature and humidity of the first and second stages of soil-free cultivation are controlled sequentially until the harvest stage;

[0056] Preferably, the ambient temperature during the first stage without soil covering is 20℃-25℃ and the humidity is 70%-80%.

[0057] Preferably, the ambient temperature during the second stage without soil covering is 14℃-18℃ and the humidity is 90%-95%.

[0058] Preferably, the second stage without soil cover involves ventilation treatment;

[0059] Preferably, the second stage without soil covering involves spraying water into the space of the cultivation system.

[0060] Optionally, the ambient temperature of the first stage without soil covering can be any value between 20℃, 21℃, 22℃, 23℃, 24℃, 25℃ and 20℃-25℃, and the humidity can be any value between 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80% and 70%-80%; the ambient temperature of the second stage without soil covering can be any value between 14℃, 15℃, 16℃, 17℃, 18℃ and 14℃-18℃, and the humidity can be any value between 90%, 91%, 92%, 93%, 94%, 95% and 90%-95%.

[0061] Preferably, the ambient temperature during the germination stage is 20℃-25℃ and the humidity is 70%-80%.

[0062] Preferably, the fruiting bodies are harvested when the cap diameter is 2cm-4cm;

[0063] Preferably, the humidity is controlled at 70%-80% after harvesting;

[0064] Preferably, the time interval between two harvests is 7 to 15 days.

[0065] Optionally, the temperature during the germination stage can be any value between 20℃, 21℃, 22℃, 23℃, 24℃, 25℃, and 20℃-25℃; the humidity can be any value between 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, and 70%-80%; the fruiting body cap diameter can be any value between 2cm, 3cm, 4cm, and 2cm-4cm when harvesting; the humidity after harvesting can be any value between 80%, 81%, 82%, 83%, 84%, 85%, and 80%-85%; the time interval between two harvests can be any value between 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, and 7 days-15 days.

[0066] Compared with the prior art, the beneficial effects of the present invention include:

[0067] The button mushroom strain provided in this application has a brown cap on its fruiting body, and the product quality will not decline due to browning; it can be cultivated without soil covering, which can simplify cultivation techniques, increase yield, and have good economic benefits.

[0068] The cultivation method for the cultivar provided in this application is simple to operate and has high production efficiency;

[0069] The cultivation method for fruiting bodies provided in this application can achieve both soil-covered and soil-free cultivation. In the soil-free cultivation mode, the influence of soil covering on the cultivation of button mushrooms can be eliminated, realizing simplified cultivation, reducing production input, and having high application development potential. Attached Figure Description

[0070] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope of the present invention.

[0071] Figure 1 A photograph of the mother culture of the Agaricus bisporus strain obtained in Example 1;

[0072] Figure 2 A photograph of the fruiting body of the Agaricus bisporus strain obtained in Example 1;

[0073] Figure 3 This is a photograph of the fruiting body of the Agaricus bisporus strain obtained in Example 4;

[0074] Figure 4 This is a magnified photograph of a portion of the fruiting body of the Agaricus bisporus strain obtained in Example 4;

[0075] Figure 5 Photographs showing the 1.5% agarose test results for seven strains of Agaricus bisporus;

[0076] Figure 6 Photographs of the 40% polyacrylamide gel electrophoresis results for seven strains of Agaricus bisporus. Detailed Implementation

[0077] As used in this article:

[0078] "Prepared from" is synonymous with "comprising". The terms "comprising", "including", "having", "containing", or any other variations thereof as used herein are intended to cover non-exclusive inclusion. For example, a composition, step, method, article, or apparatus that includes the listed elements is not necessarily limited to those elements, but may include other elements not expressly listed or elements inherent to such composition, step, method, article, or apparatus.

[0079] The conjunction "composed of..." excludes any unspecified elements, steps, or components. If used in a claim, this phrase makes the claim closed, excluding materials other than those described, except for associated conventional impurities. When the phrase "composed of..." appears in a clause of the body of a claim rather than immediately following it, it limits only the elements described in that clause; other elements are not excluded from the claim as a whole.

[0080] When a quantity, concentration, or other value or parameter is expressed as a range, a preferred range, or a range defined by a series of upper and lower preferred values, this should be understood as specifically disclosing all ranges formed by any pair of any upper or preferred value with any lower or preferred value, regardless of whether the range is disclosed individually. For example, when the range “1–5” is disclosed, the described range should be interpreted as including ranges “1–4”, “1–3”, “1–2”, “1–2 and 4–5”, “1–3 and 5”, etc. When numerical ranges are described herein, unless otherwise stated, the range is intended to include its endpoints and all integers and fractions within that range.

[0081] In these embodiments, unless otherwise specified, the portions and percentages are all by weight.

[0082] "Parts by mass" refers to the basic unit of measurement that expresses the mass ratio of multiple components. One part can represent any unit mass, such as 1g or 2.689g. If we say that component A has "a" parts by mass and component B has "b" parts by mass, it means the ratio of the mass of component A to the mass of component B is a:b. Alternatively, it can mean that the mass of component A is aK and the mass of component B is bK (K is any number representing a multiplier). It is important to understand that, unlike the number of parts by mass, the sum of the mass parts of all components is not limited to 100 parts.

[0083] "And / or" is used to indicate that one or both of the described situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0084] The embodiments of the present invention will be described in detail below with reference to specific examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0085] Example 1

[0086] This embodiment provides a *Agaricus bisporus* strain, named JJHM. *Agaricus bisporus* taxonomically belongs to the kingdom Fungi, phylum Eumycota, subphylum Basidiomycotina, class Basidiomycetes, order Agaricales, family Agaricaceae, and genus *Agaricus*. This mutant strain was collected from a *Agaricus bisporus* cultivation site. Its mycelium is white and robust, with dense aerial hyphae, and the fruiting body has a brown cap. This strain was isolated from Xiaoyuan Village, Ciyun Town, Jiangjin District, Chongqing, and is deposited at the China General Microbiological Culture Collection Center (CGMCC), address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 40369, deposited on December 26, 2022; the identification result is viable.

[0087] This embodiment also provides a method for cultivating a cultivar of Agaricus bisporus, specifically including:

[0088] Mother culture: Mix the raw materials of potato dextrose agar medium to obtain the mother culture medium, sterilize at 121℃ for 20 min, and prepare it into plates or test tube slants; then inoculate with approximately 0.3 cm of the culture medium. 2 The inoculum blocks of the Agaricus bisporus strain were incubated in the dark at 23°C until the plates (tubes) were filled. The resulting mother culture was as follows: Figure 1 As shown.

[0089] Primary culture: Prepare 45kg of waste bedding material, 48kg of rice straw, 4kg of gypsum, and 3kg of lime; pre-moisten the waste bedding material and rice straw, then add gypsum and lime, adjust the moisture content to 65wt%, pile them up for natural fermentation, and then pack them into 750mL plastic or glass bottles, sterilize at 121℃ for 1.5h; then inoculate 4 pieces of approximately 1.0cm... 2 The mother culture block was incubated in the dark at 25°C until the bottle was full.

[0090] Cultivation of the spawn: Prepare 45kg of waste bedding material, 48kg of rice straw, 4kg of gypsum and 3kg of lime; pre-moisten the waste bedding material and rice straw, then add gypsum and lime to adjust the moisture content to 65wt%, pile them up for natural fermentation, and then pack them into polypropylene bags, with each bag containing about 0.9kg of material. Sterilize at 120℃ for 3 hours; then inoculate with 20g of the original spawn and incubate in the dark at 23℃ until the bag is full to obtain the spawn.

[0091] Waste bedding is generally made from waste materials after 10-20 months of use. The waste bedding used in this application, by weight percentage, generally includes 60%-70% sawdust, 10%-15% microbial agent (EM bacteria), and 15%-30% poultry manure (the composition may vary depending on the batch and source).

[0092] It should be noted that the physicochemical parameters of the poultry manure used in this embodiment are shown in Table 1 below:

[0093] Table 1 Physicochemical parameters of poultry manure

[0094] Organic matter (%) 68 nitrogen(%) 3.04 Phosphorus pentoxide (%) 5.2 Potassium oxide (%) 1.09 Total cadmium (mg / kg) <0.1 Total mercury (mg / kg) <0.5 Total lead (mg / kg) 6.07 Total chromium (mg / kg) 17.32 Total arsenic (mg / kg) <2.7

[0095] This embodiment also provides a method for cultivating the fruiting bodies of the above-mentioned Agaricus bisporus strain by covering with soil, specifically including:

[0096] Prepare the fruiting body culture medium: 25 kg of waste bedding material, 55 kg of edible mushroom residue, 4 kg of bamboo shavings, 3 kg of oil press filter cake, 3 kg of corn flour, 1 kg of superphosphate, 1 kg of light calcium carbonate, 4 kg of gypsum, and 4 kg of lime (all dry weight); the waste bedding material is selected from discarded pigsty bedding material; the edible mushroom residue is a mixture of king oyster mushroom residue, enoki mushroom residue, shiitake mushroom residue, and shiitake mushroom residue (mixed in equal proportions); the bamboo shavings are waste bamboo fragments from a paper mill. After pre-wetting the above waste bedding material, edible mushroom residue, and bamboo shavings, add the above auxiliary materials and mix well, adjusting the moisture content to 60%, then cover with a film and let it sit for 2 days; construct the pre-piled material and cover the pile with a film for heat and moisture retention; when the temperature of the pile reaches 68℃, maintain this temperature for 1 day and then turn the pile for the first time. Turn the pile once every 6 days, for a total of 4 turns, to end fermentation. After the fermentation of the substrate is completed, a large number of white actinomycete mycelia can be observed on the surface and inside. The substrate turns brown in color, has a loose, soft and elastic texture, is evenly mixed with manure and straw, has a moisture content of 60%, a pH of 7.3, and is free of pests, diseases, manure lumps, and odors.

[0097] Spread the fermented substrate into a bed 90cm wide and 20cm thick. Before sowing, loosen the surface of the substrate and add water to 65% moisture. Evenly scatter the spawn on the surface, gently patting it to secure it. The spawn should cover the entire surface. Maintain an ambient temperature of around 20℃ and humidity of around 70% until germination. When the mycelium has penetrated 5cm into the substrate, cover with 5cm of soil. The optimal pH for the soil covering is 7.0, with a moisture content of 20% (it should be able to be flattened and rolled into a round shape without a white center). Spray with a 1000-fold dilution of deltamethrin on the same day after covering, adjusting the moisture content according to mycelial growth. Maintain a temperature of 20℃ and a relative humidity of 80%. When the mycelium has penetrated 3 / 4 of the substrate, increase ventilation, maintain a temperature of 14℃ and a relative humidity of around 90%, and begin heavy watering to stimulate mushroom growth. Harvest when the mushroom cap diameter reaches 3cm; do not spray water before harvesting. After the peak harvest of each flush of mushrooms, the humidity can be reduced to 80%. Generally, there should be a 7-day interval between harvesting each flush of mushrooms before harvesting the next flush.

[0098] The sub-entity obtained in this embodiment is as follows: Figure 2 As shown.

[0099] Example 2

[0100] The Agaricus bisporus strain used in this embodiment is the same as that in Example 1.

[0101] This embodiment also provides a method for cultivating a cultivar of Agaricus bisporus, specifically including:

[0102] Mother culture: Sterilize potato dextrose agar (PDA) medium at 122°C for 25 min, and prepare agar plates or test tube slants; then inoculate with approximately 1.0 cm of the agar. 2The inoculum blocks of the Agaricus bisporus strain were cultured in the dark at 27°C until the plate (tube) was full.

[0103] Primary culture: Prepare 48kg of waste bedding material, 45kg of rice straw, 3kg of gypsum, and 4kg of lime; pre-moisten the waste bedding material and rice straw, then add gypsum and lime, adjust the moisture content to 64%, pile them up for natural fermentation, and then pack them into 750mL plastic or glass bottles, sterilize at 123℃ for 2 hours; then inoculate 5 pieces of approximately 1.0cm... 2 The mother culture block was incubated in the dark at 24°C until the bottle was full.

[0104] Cultivation of the spawn: Prepare 48kg of waste bedding material, 45kg of rice straw, 3kg of gypsum and 4kg of lime; pre-moisten the waste bedding material and rice straw, then add gypsum and lime to adjust the moisture content to 64%, pile them up for natural fermentation, and then pack them into polypropylene bags, each bag containing about 1.1kg of material, and sterilize them at 125℃ for 3 hours; then inoculate 30g of the original spawn, and incubate them in the dark at 27℃ until the bag is full to obtain the spawn.

[0105] It should be noted that the poultry manure used in this embodiment is the same as that in Embodiment 1.

[0106] This embodiment also provides a method for cultivating the fruiting bodies of the above-mentioned Agaricus bisporus strain by covering with soil, specifically including:

[0107] Prepare the fruiting body culture medium: 40 kg of waste bedding material, 39 kg of edible fungus residue, 5 kg of bamboo shavings, 5 kg of oil press filter cake, 5 kg of corn flour, 1 kg of superphosphate, 1 kg of light calcium carbonate, 2 kg of gypsum, and 2 kg of lime (all dry weight); the waste bedding material and edible fungus residue are the same as in Example 1; the bamboo shavings are waste bamboo fragments from a paper mill. After pre-wetting the above-mentioned waste bedding material, edible fungus residue, and bamboo shavings, add the above-mentioned auxiliary materials and mix well, adjusting the moisture content to 60%, then cover with a film and let it sit for 1 day; construct the pre-piled material, and cover the pile with a film for heat preservation and moisture retention; when the temperature of the pile rises to 68℃, maintain this temperature for 1 day, then turn the pile for the first time. Turn the pile once every 5 days, for a total of 5 turns, to end fermentation. After the fermentation of the culture medium is completed, a large number of white actinomycete mycelia can be observed on the surface and inside. The culture medium turns brown in color, has a loose, soft and elastic texture, and is evenly mixed with manure and straw. The moisture content of the medium is 64%, the pH is 7.5, and there are no diseases, insects, manure lumps, or odors.

[0108] Spread the fermented substrate into a bed 80cm wide and 15cm thick. Before sowing, loosen the surface of the substrate and add water to a moisture content of 65%. Evenly scatter the spawn on the surface, gently patting it to secure it. The spawn should cover the entire surface. Maintain an ambient temperature of around 25℃ and an air humidity of around 80% until germination. When the mycelium has penetrated to a depth of 10cm, cover with 3cm of soil. The optimal pH for the soil covering is 7.5, and the moisture content is 22% (it should be able to be flattened and rolled into a round shape without a white center). Spray with a 1000-fold dilution of deltamethrin on the same day after covering, and adjust the moisture content according to the mycelial growth. Maintain a temperature of 25℃ and a relative humidity of 85%. When the mycelium has penetrated 3 / 4 of the soil, increase ventilation, maintain a temperature of 18℃ and a relative humidity of around 92%, and begin spraying with heavy water to stimulate mushroom growth. Harvest when the mushroom cap diameter reaches 4cm; do not spray water before harvesting. After the peak harvest of each flush of mushrooms, the humidity can be reduced to 85%. Generally, there should be a 15-day interval between harvesting each flush of mushrooms before harvesting the next flush.

[0109] Example 3

[0110] The Agaricus bisporus strain used in this embodiment is the same as that in Example 1.

[0111] This embodiment also provides a method for cultivating a cultivar of Agaricus bisporus, specifically including:

[0112] Mother culture: Sterilize potato dextrose agar (PDA) medium at 123°C for 22 min, and prepare agar plates or test tube slants; then inoculate with approximately 0.8 cm of the agar. 2 The inoculum blocks of the Agaricus bisporus strain were incubated in the dark at 26°C until the plates (tubes) were filled.

[0113] Primary culture: Prepare 46 kg of waste bedding material, 46 kg of rice straw, 4 kg of gypsum, and 4 kg of lime; pre-moisten the waste bedding material and rice straw, then add gypsum and lime, adjust the moisture content to 63%, pile them up for natural fermentation, and then pack them into 750 mL plastic or glass bottles, sterilize at 124℃ for 1 hour; then inoculate with 3 pieces of approximately 1.0 cm... 2 The mother culture block was incubated in the dark at 23°C until the bottle was full.

[0114] Cultivation of the spawn: Prepare 46 kg of waste bedding material, 46 kg of rice straw, 4 kg of gypsum and 4 kg of lime; pre-moisten the waste bedding material and rice straw, then add gypsum and lime to adjust the moisture content to 63%, pile them up for natural fermentation, and then pack them into polypropylene bags, with each bag containing about 1 kg of material. Sterilize at 124℃ for 2.5 hours; then inoculate with 25 g of original spawn and incubate in the dark at 25℃ until the bag is full to obtain the spawn.

[0115] It should be noted that the poultry manure used in this embodiment is the same as that in Embodiment 1.

[0116] This embodiment also provides a method for cultivating the fruiting bodies of the above-mentioned Agaricus bisporus strain by covering with soil, specifically including:

[0117] Prepare the fruiting body culture medium: 34 kg of waste bedding material, 50 kg of edible fungus residue, 4 kg of bamboo shavings, 3 kg of oil press filter cake, 3 kg of corn flour, 1 kg of superphosphate, 1 kg of light calcium carbonate, 2 kg of gypsum, and 2 kg of lime (all dry weight); the waste bedding material and edible fungus residue are the same as in Example 1; the bamboo shavings are waste bamboo fragments from a paper mill. After pre-wetting the above waste bedding material, edible fungus residue, and bamboo shavings, add the above auxiliary materials and mix well, adjusting the moisture content to 57%, then cover with a film and let it sit for 2 days; construct the pre-piled material and cover the pile with a film for heat preservation and moisture retention; when the temperature of the pile reaches 65℃, maintain this temperature for 1 day and then turn the pile for the first time. Turn the pile once every 5 days, for a total of 4 times, to end fermentation. After the fermentation of the culture medium is completed, a large number of white actinomycete mycelia can be observed on the surface and inside. The culture medium turns brown in color, has a loose, soft and elastic texture, and is evenly mixed with manure and straw. The moisture content of the medium is 62%, the pH is 7.4, and there are no diseases, insects, manure lumps, or odors.

[0118] Spread the fermented substrate into a bed 90cm wide and 20cm thick. Before inoculation, loosen the surface of the substrate and add water to 64% moisture. Spread the spawn evenly on the surface, gently patting it to fix the spawn in place. The spawn should cover the entire surface. Maintain an ambient temperature of around 22℃ and an air humidity of around 75% until germination. When the mycelium has penetrated 8cm into the substrate, cover with 4cm of soil, or wait until the mycelium has penetrated the bottom of the substrate before covering with soil. The optimal soil pH for covering is 7.2, and the moisture content is 21% (it should be able to be flattened and rolled into a round ball by hand, without a white center). On the day of covering, spray with a 1000-fold dilution of deltamethrin, and adjust the moisture according to the mycelium growth. Maintain a temperature of 22℃ and a relative humidity of 83%. When the mycelium has penetrated 3 / 4 of the soil, increase ventilation, maintain a temperature of 15℃ and a relative humidity of 95%, and begin spraying with heavy water to stimulate fruiting. Mushrooms can be harvested when their caps are 3cm in diameter. Do not spray water before harvesting. After the peak harvest of each flush of mushrooms, the humidity can be reduced to 85%. Generally, there should be a 10-day interval between harvesting each flush of mushrooms before harvesting the next flush.

[0119] Example 4

[0120] The Agaricus bisporus strain used in this embodiment is the same as that in Example 1.

[0121] This embodiment also provides a method for cultivating a cultivar of Agaricus bisporus, specifically including:

[0122] Mother culture: Sterilize potato dextrose agar (PDA) medium at 123°C for 21 min, and prepare agar plates or test tube slants; then inoculate with approximately 0.7 cm of the agar.2 The inoculum blocks of the Agaricus bisporus strain were incubated in the dark at 25°C until the plate (tube) was full.

[0123] Primary culture: Prepare 47 kg of waste bedding material, 47 kg of rice straw, 3 kg of gypsum, and 3 kg of lime; pre-moisten the waste bedding material and rice straw, then add gypsum and lime, adjust the moisture content to 65%, pile them up for natural fermentation, and then pack them into 750 mL plastic or glass bottles, sterilize at 122℃ for 1.5 h; then inoculate with 4 pieces of approximately 1.0 cm... 2 The mother culture block was incubated in the dark at 26°C until the bottle was full.

[0124] Cultivation of the spawn: Prepare 47 kg of waste bedding material, 47 kg of rice straw, 3 kg of gypsum, and 3 kg of lime; pre-moisten the waste bedding material and rice straw, then add gypsum and lime to adjust the moisture content to 65%, pile them up for natural fermentation, and then pack them into polypropylene bags, with each bag containing about 0.9 kg of material. Sterilize at 122℃ for 2 hours; then inoculate with 20 g of the original spawn and incubate in the dark at 26℃ until the bag is full to obtain the spawn.

[0125] It should be noted that the poultry manure used in this embodiment is the same as that in Embodiment 1.

[0126] This embodiment also provides a method for cultivating the fruiting bodies of the above-mentioned Agaricus bisporus strain without soil covering, specifically including:

[0127] Prepare the fruiting body culture medium: 30 kg of waste bedding material, 42 kg of edible fungus residue, 4.5 kg of bamboo shavings, 6 kg of oil press filter cake, 6 kg of corn flour, 1.5 kg of superphosphate, 3 kg of light calcium carbonate, 4 kg of gypsum, and 3 kg of lime (all dry weight); the waste bedding material and edible fungus residue are the same as in Example 1; the bamboo shavings are waste bamboo fragments from a paper mill. After pre-wetting the above waste bedding material, edible fungus residue, and bamboo shavings, add the above auxiliary materials and mix well, adjusting the moisture content to 60%, then cover and let it sit for 2 days. Build the pre-piled material and cover the pile with a film for heat and moisture retention. When the temperature of the pile reaches 66℃, maintain this temperature for 2 days and then turn the pile for the first time. Turn the pile once every 7 days, for a total of 3 times, to end fermentation. After the fermentation of the culture medium is completed, a large number of white actinomycete mycelia can be observed on the surface and inside. The culture medium turns brown in color, has a loose, soft and elastic texture, and is evenly mixed with manure and straw. The moisture content of the medium is 65wt%, the pH is 7.3, and there are no diseases, insects, manure lumps, or odors.

[0128] Spread the fermented substrate into a bed 90cm wide and 15cm thick. Before sowing, loosen the surface of the substrate and add water to a moisture content of 65%. Evenly sprinkle the spawn on the surface, gently patting it to secure it. The spawn should cover the entire surface. Maintain an ambient temperature of around 25℃ and an air humidity of around 70% until the spawn germinates. Control the temperature at 20℃ and the relative humidity at 70%. Once the mycelium has covered the bottom of the substrate, increase ventilation, maintain the temperature at 18℃, and spray water into the air to maintain a relative humidity of 95% (do not spray water directly onto the substrate surface) to stimulate fruiting. Harvest when the mushroom caps reach a diameter of 4cm. Do not spray water before harvesting. After the peak harvest of each flush, reduce the humidity to 85%. Generally, wait 7 days between harvests of each flush before harvesting the next flush.

[0129] The sub-entity obtained in this embodiment is as follows: Figure 3 and Figure 4 As shown, Figure 4 This is a magnified view of a portion of the image.

[0130] Example 5

[0131] The Agaricus bisporus strain used in this embodiment is the same as that in Example 1.

[0132] This embodiment also provides a method for cultivating a cultivar of Agaricus bisporus, specifically including:

[0133] Mother culture: Sterilize potato dextrose agar (PDA) medium at 124°C for 26 min, and prepare agar plates or test tube slants; then inoculate with approximately 0.5 cm of the agar. 2 The inoculum blocks of the Agaricus bisporus strain were cultured in the dark at 24°C until the plate (tube) was full.

[0134] Primary culture: Prepare 48 kg of waste bedding material, 48 kg of rice straw, 2 kg of gypsum, and 2 kg of lime; pre-moisten the waste bedding material and rice straw, then add gypsum and lime, adjust the moisture content to 59%, pile them up for natural fermentation, and then pack them into 750 mL plastic or glass bottles, sterilize at 125℃ for 1 hour; then inoculate 5 pieces of approximately 1.0 cm... 2 The mother culture block was incubated in the dark at 27°C until the bottle was full.

[0135] Cultivation of the spawn: Prepare 48 kg of waste bedding material, 48 kg of rice straw, 2 kg of gypsum and 2 kg of lime; pre-moisten the waste bedding material and rice straw, then add gypsum and lime to adjust the moisture content to 60%, pile them up for natural fermentation, and then pack them into polypropylene bags, each bag containing about 1.1 kg of material, and sterilize them at 120℃ for 3 hours; then inoculate 30 g of the original spawn, and incubate them in the dark at 27℃ until the bag is full to obtain the spawn.

[0136] It should be noted that the poultry manure used in this embodiment is the same as that in Embodiment 1.

[0137] This embodiment also provides a method for cultivating the fruiting bodies of the above-mentioned Agaricus bisporus strain without soil covering, specifically including:

[0138] Prepare the fruiting body culture medium: 50kg waste bedding, 30kg edible mushroom residue, 4kg bamboo shavings, 4kg oil filter cake, 4kg corn flour, 1kg superphosphate, 2kg light calcium carbonate, 3kg gypsum, and 2kg lime (all dry weight); the waste bedding is selected from discarded sheep pen bedding; the edible mushroom residue is selected from enoki mushroom residue; and the bamboo shavings are waste bamboo fragments from a paper mill. After pre-wetting the above waste bedding, edible mushroom residue, and bamboo shavings, add the above auxiliary materials and mix well, adjusting the moisture content to 60%. Cover with a film and let it sit for 1 day. Build the pre-piled material and cover the pile with a film for heat and moisture retention. When the temperature of the pile reaches 70℃, maintain this temperature for 1 day before the first turning. Turn the pile once every 7 days, for a total of 3 turnings, to end fermentation. After the fermentation of the culture medium is completed, a large number of white actinomycete mycelia can be observed on the surface and inside. The culture medium turns brown in color, has a loose, soft and elastic texture, and is evenly mixed with manure and straw. The moisture content of the medium is 61%, the pH is 7.5, and there are no diseases, insects, manure lumps, or odors.

[0139] Spread the fermented substrate into a bed 80cm wide and 25cm thick. Before sowing, loosen the surface of the substrate and add water to a moisture content of 65%. Evenly sprinkle the spawn on the surface, gently patting it to secure it. The spawn should cover the entire surface. Maintain an ambient temperature of approximately 23℃ and an air humidity of approximately 76% until the spawn germinates. Control the temperature at 23℃ and the relative humidity at 76%. Once the mycelium has covered the bottom of the substrate, increase ventilation, maintain the temperature at 16℃, and spray water into the air to maintain a relative humidity of 93% (do not spray water directly onto the substrate surface) to stimulate fruiting. Harvest when the mushroom caps reach a diameter of 3cm. Do not spray water before harvesting. After the peak harvest of each flush, reduce the humidity to 82%. Generally, wait 10 days between harvests of each flush before harvesting the next flush.

[0140] Example 6

[0141] The Agaricus bisporus strain used in this embodiment is the same as that in Example 1.

[0142] This embodiment also provides a method for cultivating a cultivar of Agaricus bisporus, specifically including:

[0143] Mother culture: Sterilize potato dextrose agar (PDA) medium at 120°C for 30 min, and prepare agar plates or test tube slants; then inoculate with approximately 0.4 cm of the agar. 2 The inoculum blocks of the Agaricus bisporus strain were incubated in the dark at 25°C until the plate (tube) was full.

[0144] Primary culture: Prepare 47.5 kg of poultry manure, 47.5 kg of rice straw, 2.5 kg of gypsum, and 2.5 kg of lime; pre-moisten the poultry manure and rice straw, then add gypsum and lime, adjust the moisture content to 58%, pile them for natural fermentation, and then pack them into 750 mL plastic or glass bottles, sterilize at 121℃ for 1 hour; then inoculate with 3 pieces of approximately 1.0 cm... 2 The mother culture block was incubated in the dark at 25°C until the bottle was full.

[0145] Cultivation of the spawn: Prepare 47.5 kg of poultry manure, 47.5 kg of rice straw, 2.5 kg of gypsum, and 2.5 kg of lime; pre-moisten the poultry manure and rice straw, then add gypsum and lime to adjust the moisture content to 59%, pile them up for natural fermentation, and then pack them into polypropylene bags, with each bag containing about 1 kg of material. Sterilize at 124℃ for 2.5 hours; then inoculate with 25 g of the original spawn and incubate in the dark at 25℃ until the bag is full to obtain the spawn.

[0146] It should be noted that the poultry manure used in this embodiment is the same as that in Embodiment 1.

[0147] This embodiment also provides a method for cultivating the fruiting bodies of the above-mentioned Agaricus bisporus strain without soil covering, specifically including:

[0148] Prepare the fruiting body culture medium: 20kg waste bedding, 60kg edible mushroom residue, 5kg bamboo shavings, 3kg oil filter cake, 3kg corn flour, 2kg superphosphate, 1kg light calcium carbonate, 2kg gypsum, and 4kg lime (all dry weight); the waste bedding is selected from abandoned pigsty bedding; the edible mushroom residue is selected from king oyster mushroom residue; the bamboo shavings are waste bamboo fragments from a paper mill. After pre-wetting the above waste bedding, edible mushroom residue, and bamboo shavings, add the above auxiliary materials and mix well, adjusting the moisture content to 60%. Cover with a film and let it sit for 2 days. Build the pre-piled material and cover the pile with a film for heat and moisture retention. When the temperature of the pile reaches 65℃, maintain this temperature for 2 days before the first turning. Turn the pile once every 5 days, for a total of 5 turnings, to end fermentation. After the fermentation of the culture medium is completed, a large number of white actinomycete mycelia can be observed on the surface and inside. The culture medium turns brown in color, has a loose, soft and elastic texture, and is evenly mixed with manure and straw. The moisture content of the medium is 60%, the pH is 7.0, and there are no diseases, insects, manure lumps, or odors.

[0149] Spread the fermented substrate into a bed 70cm wide and 30cm thick. Before sowing, loosen the surface of the substrate and add water to a moisture content of 65wt%. Evenly sprinkle the spawn on the surface, gently patting it to secure it. The spawn should cover the entire surface. Maintain an ambient temperature of around 20℃ and an air humidity of around 80% until the spawn germinates. Control the temperature at 25℃ and the relative humidity at 80%. Once the mycelium has covered the bottom of the substrate, increase ventilation, maintain the temperature at 14℃, and spray water into the air to maintain a relative humidity of around 90% (do not spray water directly onto the substrate surface) to stimulate fruiting. Harvest when the mushroom caps reach a diameter of 2cm. Do not spray water before harvesting. After the peak harvest of each flush, reduce the humidity to 80%. Generally, wait 15 days between harvests of each flush before harvesting the next flush.

[0150] Comparative Example 1

[0151] The Agaricus bisporus strain used in this comparative example is W2000, which is currently a commercially cultivated variety. The mother culture, original culture, cultivar, and fruiting body culture methods are all the same as in Example 1.

[0152] Comparative Example 2

[0153] The Agaricus bisporus strain used in this comparative example is As2796, which is currently a commercially cultivated variety. The mother culture, original culture, cultivar, and fruiting body culture methods are all the same as in Example 1.

[0154] Comparative Example 3

[0155] The Agaricus bisporus strain used in this comparative example is W2000, which is currently a commercially cultivated variety. The mother culture, original culture, cultivar, and fruiting body culture methods are the same as in Example 4.

[0156] Comparative Example 4

[0157] The Agaricus bisporus strain used in this comparative example is As2796, which is currently a commercially cultivated variety. The mother culture, original culture, cultivar, and fruiting body culture methods are all the same as in Example 4.

[0158] The process parameters and product parameters of Examples 1-6 and Comparative Examples 1-4 were tested, as shown in Table 2 below:

[0159] Table 2 Detection Results

[0160]

[0161]

[0162] As shown in Table 1 above, the comparison between Examples 1-3 and Comparative Examples 1-2 shows that the mycelial growth rate and bioconversion rate of the strain provided in this application are higher than those of existing strains, and the culture efficiency and yield are also higher. The comparison between Examples 4-6 and Comparative Examples 3-4 shows that the strain provided in this application can achieve soil-free culture, while the strains of Comparative Examples 4 and 5 cannot achieve soil-free culture (bioconversion rate is 0). The comparison between Examples 1-6 and Comparative Examples 1-2 shows that the total sugar content of the fruiting bodies obtained in this application is comparable to that of the comparative examples. In terms of protein, the protein content of the fruiting bodies obtained by soil-covered culture in this application is comparable to that of the comparative examples, while the protein content of the fruiting bodies obtained by soil-free culture is significantly higher than that of Comparative Examples 1 and 2. In terms of fat and ash, the fat and ash content of the fruiting bodies obtained in this application is significantly lower than that of Comparative Examples 1 and 2, while the fat content of the fruiting bodies obtained by soil-free culture in this application is even lower.

[0163] To demonstrate the difference between the Agaricus bisporus strain provided in this application and existing strains, five existing white Agaricus strains, W2000, were specifically selected. Figure 5 and Figure 6 Corresponding numbers 1 and 8), W38 ( Figure 5 and Figure 6 Corresponding numbers 2 and 9), W192 Figure 5 and Figure 6 Corresponding numbers 4 and 11), As2796 ( Figure 5 and Figure 6 Corresponding numbers 5, 12), 6# Figure 5 and Figure 6 Corresponding to numbers 6 and 13) and brown strain 441 ( Figure 5 and Figure 6 Corresponding to numbers 7 and 14), and the JJHM provided in this application ( Figure 5 and Figure 6 The corresponding molecular markers (numbered 3 and 10) were used for control. Among them, As2796, W2000, 441, and W38 were introduced from the Fujian Provincial Mushroom Strains Research and Extension Station, W192 was introduced from the Sichuan Academy of Agricultural Sciences, and #6 was introduced from the Institute of Microbiology, Chinese Academy of Sciences.

[0164] Two pairs of primers were used, both of which are SSR primers. The specific sequence information is as follows:

[0165] Primer XG01: Upstream sequence ACTATCCCTCCGAGAATGC

[0166] Downstream sequence TGTAAACGGGGTTGTGAAT

[0167] Product size 220-257bp

[0168] Primer XG02: Upstream primer ACAAGAAGGGGAGGATTGAG

[0169] Downstream primer ATAGTCGCGTAACCCCTCTT

[0170] Product size 157-163bp

[0171] The PCR program for the two primer pairs is as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, cycle 35; total extension at 72℃ for 5 min; store at 16℃.

[0172] First, the PCR products were analyzed using 1.5% agarose gel, and the results are as follows. Figure 5 As shown. Figure 5 The results showed that the amplification product of primer XG02 was approximately 160 bp in the 7 bacterial species, and there was no difference in the amplification bands among them; the amplification product of primer XG01 was between 220 bp and 257 bp in the 7 bacterial species, and the amplification band in species 441 (lane 7) was significantly different from that in the remaining 6 bacterial species.

[0173] Then, the PCR products were also detected using a 40% polyacrylamide gel electrophoresis, and the results were as follows. Figure 6 .Depend on Figure 6 It is known that the results of 40% polyacrylamide gel electrophoresis are consistent with those of 1.5% agarose gel electrophoresis, that is, primer XG02 showed no difference among the 7 bacterial species, while the amplification band of primer XG01 in 441 bacterial species (7 lanes) showed significant differences from the remaining 6 bacterial species.

[0174] This indicates that the strain provided in this application is genetically identical to existing white strains, but significantly different from existing brown strains. This application provides a specific Agaricus bisporus strain, whose most valuable and differentiating trait compared to existing varieties is its ability to produce fruiting mushrooms without soil covering.

[0175] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

[0176] Furthermore, those skilled in the art will understand that although some embodiments herein include certain features included in other embodiments but not others, combinations of features from different embodiments are meant to be within the scope of the invention and form different embodiments. For example, in the foregoing claims, any of the claimed embodiments can be used in any combination. The information disclosed in this background section is intended only to enhance the understanding of the general background of the invention and should not be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

Claims

1. A strain of Agaricus bisporus, characterized in that, The Agaricus strain is Agaricus bisporus ( Agaricus bisporus The sample was deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 40369 on December 26, 2022.

2. A fruiting body obtained by cultivating the Agaricus bisporus strain according to claim 1.

3. A method for cultivating a cultivar of the Agaricus bisporus strain according to claim 1, characterized in that, include: The raw materials of potato dextrose agar medium were mixed to obtain the mother culture medium. After sterilization, the Agaricus bisporus strain was inoculated and cultured in the dark to obtain the mother culture. The mother culture was inoculated into the original culture medium and cultured statically in the dark to obtain the original culture. The original strain was inoculated into the culture medium for the cultivated strain and cultured statically in the dark to obtain the cultivated strain.

4. The cultivation method according to claim 3, characterized in that, The temperature for each of the static, light-protected cultures is 23-27℃.

5. The cultivation method according to claim 3, characterized in that, The raw materials for the primary culture medium and the cultivated culture medium, calculated as a percentage by weight, each independently comprise: Waste bedding material 45-48%, straw 45-48%, gypsum 2%-4%, and lime 1%-2%.

6. The cultivation method according to claim 5, characterized in that, The preparation methods of the original culture medium and the cultivated culture medium include: mixing the raw materials and then adding water for fermentation.

7. The cultivation method according to claim 6, characterized in that, The mixing process includes: pre-wetting the waste bedding material and the straw, and then adding the gypsum and the lime.

8. The cultivation method according to claim 6, characterized in that, After adding water, the water content of the mixture is 58-65 wt%.

9. The cultivation method according to claim 3, characterized in that, The mother culture medium is sterilized at 120-125℃ for 20-30 minutes before use; the original culture medium and the cultivated culture medium are sterilized at 120-125℃ for 2-3 hours before use.

10. The cultivation method according to claim 3, characterized in that, For every 0.9-1.1 kg of the culture medium, inoculate 20-30 g of the original seed.

11. A method for cultivating a fruiting body as described in claim 2, characterized in that, include: The cultivar of Agaricus bisporus is inoculated onto a fruiting body culture medium. After the mycelium has fully grown on the fruiting body culture medium, the fruiting bodies are obtained by either covering the culture medium with soil or by culture without soil covering.

12. The cultivation method according to claim 11, characterized in that, The raw materials for the fruiting body culture medium, calculated as a percentage by mass, include: Waste bedding material 20%-50%, edible fungus residue 30%-60%, bamboo shavings 4%-5%, and auxiliary materials 12%-25%; Based on the total mass of the raw materials as 100%, the auxiliary materials include 3%-6% oil filter cake, 3%-6% corn flour, 1%-2% superphosphate, 1%-3% light calcium carbonate, 2%-4% gypsum and 1%-2% lime.

13. The cultivation method according to claim 12, characterized in that, The waste bedding material includes one or more of the following: waste pigsty bedding, waste sheepsty bedding, waste cattlesty bedding, waste chickensty bedding, waste ducksty bedding, and waste geesety bedding.

14. The cultivation method according to claim 12, characterized in that, The edible mushroom residue includes one or more of the following: king oyster mushroom residue, enoki mushroom residue, oyster mushroom residue, and shiitake mushroom residue.

15. The cultivation method according to claim 12, characterized in that, The method for preparing the fruiting body culture medium includes: The raw materials of the fruiting body culture medium are mixed with water to obtain a mixture, which is then fermented to obtain the fruiting body culture medium.

16. The cultivation method according to claim 15, characterized in that, The water content of the mixture is 60wt%-65wt%.

17. The cultivation method according to claim 15, characterized in that, The mixing process includes: pre-wetting the waste bedding material, the edible fungus residue, and the bamboo shavings with water, then adding the auxiliary materials and mixing them evenly, and then adjusting the moisture content of the mixture.

18. The cultivation method according to claim 15, characterized in that, The fermentation process includes: covering the mixture with a film and letting it sit for 1-2 days, then building the pile and covering it with a film, turning the pile over during the process.

19. The cultivation method according to claim 18, characterized in that, The turning process includes: after the pile is heated to 65-70℃, it is kept at that temperature for 1-2 days before the first turning, and then the pile is turned once every 5-7 days, for a total of 3-5 turnings.

20. The cultivation method according to claim 15, characterized in that, The water content of the fruiting body culture medium obtained by fermentation is 60-65 wt%, and the pH is 7.0-7.

5.

21. The cultivation method according to claim 11, characterized in that, The soil covering cultivation includes: When the mycelium penetrates to a depth of 5 cm or more into the fruiting body culture medium, cover it with soil, then apply an insecticide, and control the temperature and humidity in the first stage after covering with soil. After the mycelium penetrates 2 cm-4 cm into the soil, control the temperature and humidity in the second stage after covering with soil until the harvest stage.

22. The cultivation method according to claim 21, characterized in that, Cover with soil when the mycelium penetrates 5-10 cm into the fruiting body culture medium.

23. The cultivation method according to claim 21, characterized in that, The thickness of the covering soil is 3cm-5cm.

24. The cultivation method according to claim 21, characterized in that, The ambient temperature during the first stage after backfilling is 20℃-25℃ and the humidity is 80%-85%.

25. The cultivation method according to claim 21, characterized in that, The ambient temperature during the second stage after backfilling is 14℃-18℃ and the humidity is 90%-95%.

26. The cultivation method according to claim 21, characterized in that, The second stage after covering with soil involves ventilation.

27. The cultivation method according to claim 21, characterized in that, The second stage after covering with soil involves spraying water onto the culture system.

28. The cultivation method according to claim 11, characterized in that, The soilless cultivation process includes controlling the temperature and humidity of the first and second soilless stages after germination, up to the harvest stage.

29. The cultivation method according to claim 28, characterized in that, The ambient temperature for the first stage without soil covering is 20℃-25℃ and the humidity is 70%-80%.

30. The cultivation method according to claim 28, characterized in that, The ambient temperature for the second stage without soil cover is 14℃-18℃ and the humidity is 90%-95%.

31. The cultivation method according to claim 28, characterized in that, The second stage without soil covering involves ventilation treatment.

32. The cultivation method according to claim 28, characterized in that, The second stage without soil covering involves spraying water in a mist-like manner into the space of the culture system.

33. The cultivation method according to any one of claims 28-32, characterized in that, The ambient temperature during the germination stage is 20℃-25℃ and the humidity is 70%-80%.

34. The cultivation method according to any one of claims 11-32, characterized in that, The fruiting bodies are harvested when the cap diameter is 2cm-4cm.

35. The cultivation method according to claim 34, characterized in that, The humidity is controlled at 70%-80% after harvesting.

36. The cultivation method according to claim 34, characterized in that, The time interval between the two harvests is 7 to 15 days.

Citation Information

Patent Citations

  • Tibet light brown agaricus bisporus strains and cultivation method of fruit bodies of Tibet light brown agaricus bisporus strains

    CN103875452A

  • Earthing-free cultivation method of Agaricus sp.

    CN106069199A