Transgenic rice event lp126-2 and methods for detecting same

Abstract

The present application provides a nucleic acid sequence comprising one or more selected from the sequences of SEQ ID NO: 1-7 or its complementary sequence, which is derived from transgenic rice event LP126-2, a representative sample of seeds comprising the event has been deposited under accession number CCTCC NO: P202318. The transgenic rice event LP126-2 of the present application not only has good resistance to the feeding of Lepidoptera pests, and can tolerate glyphosate-containing agricultural herbicides, has the advantages of: being free from economic losses caused by Lepidoptera pests; being able to tolerate commonly used commercial herbicide glyphosate in rice crops; not reducing the yield of rice; enhancing breeding efficiency, being able to track the transgenic insert in the breeding population and its offspring with molecular markers. Meanwhile, the detection method provided by the present application can quickly, accurately and stably identify the presence of plant materials derived from transgenic rice event LP126-2.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology and relates to detection methods for transgenic plants and their products. Specifically, it relates to the transgenic rice event LP126-2, which is resistant to insects and tolerant to glyphosate herbicide application, and the nucleic acid sequence and method for detecting transgenic rice LP126-2. Background Technology

[0002] Rice ( Oryza sativa Rice (L.) is a major food crop in many parts of the world. Biotechnology has been applied to rice to improve its agronomic traits and quality. Insect resistance is an important agronomic trait in rice production, especially resistance to lepidopteran insects (such as the rice stem borer, rice leaf roller, and rice leaf roller). Rice resistance to lepidopteran insects can be obtained by transgenic methods to express lepidopteran resistance genes in rice plants. Another important agronomic trait is herbicide tolerance, especially tolerance to glyphosate herbicides. Rice tolerance to glyphosate herbicides can be obtained by transgenic methods to express glyphosate-tolerant genes (such as...) epsps It was obtained by expression in rice plants.

[0003] Besides the functional genes themselves, the selection and sequential arrangement of regulatory elements are crucial for obtaining favorable transformation events, and their technical effects are unpredictable. Furthermore, it is known that the expression of exogenous genes in plants is influenced by their insertion location on the rice chromosome, possibly due to the proximity of chromatin structures (such as heterochromatin) or transcriptional regulatory elements (such as enhancers) to the integration site. Therefore, it is often necessary to screen a large number of events to identify those suitable for commercialization (i.e., events where the introduced target gene is optimally expressed). For example, significant differences in the expression levels of introduced genes have been observed between events in plants and other organisms; differences may also exist in spatial or temporal expression patterns, such as the relative expression of transgenes differing between different plant tissues. These differences manifest as the actual expression pattern potentially not matching the expected expression pattern of the transcriptional regulatory elements in the introduced gene construct. Therefore, it is often necessary to generate hundreds or thousands of different events and screen from these events for a single event with the expected transgene expression levels and patterns for commercial purposes. Such transformation events result in superior resistance to lepidopteran pests (such as the rice stem borer, rice leaf roller, and rice leaf roller) and glyphosate herbicide without affecting rice yield. These transgenic traits can be backcrossed into other genetic backgrounds using conventional breeding methods. Offspring produced through this hybridization retain the transgenic expression characteristics and phenotypic traits of the original transformant. Applying this strategy ensures reliable gene expression in many varieties, providing stable resistance to lepidopteran pests and glyphosate herbicide, protecting these varieties from major lepidopteran pests, providing broad-spectrum weed control, and allowing them to adapt well to local growing conditions.

[0004] Being able to detect the presence of specific events to determine whether the offspring of sexual hybridization contain the target gene would be beneficial. Furthermore, methods for detecting specific events would help comply with relevant regulations, such as the requirement for formal approval and labeling of foods derived from recombinant crops before they can be placed on the market. Detecting the presence of transgenes using any well-known polynucleotide detection method is possible, such as polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. These methods typically focus on commonly used genetic elements, such as promoters, terminators, and marker genes. Therefore, unless the sequence of the chromosomal DNA adjacent to the inserted transgenic DNA (“flanking DNA”) is known, the above methods cannot be used to distinguish different events, especially those produced using the same DNA construct. Therefore, it is currently common to use a pair of primers spanning the junction of the inserted T-DNA and the flanking DNA via PCR to identify transgenic specific events; specifically, a first primer containing the flanking sequence and a second primer containing the inserted sequence. Summary of the Invention

[0005] The purpose of this invention is to provide a transgenic rice event LP126-2 and a nucleic acid sequence for detecting the LP126-2 event in rice plants, as well as a detection method thereof, which can accurately and rapidly identify whether a biological sample contains DNA molecules of a specific transgenic rice event LP126-2.

[0006] To achieve the above objectives, the present invention provides a nucleic acid sequence comprising one or more sequences selected from sequences SEQ ID NO:1-7 (i.e., SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7) or their complementary sequences. In some embodiments, the nucleic acid sequence is derived from plants, seeds, or cells containing the rice event LP126-2. A representative sample of seeds containing the event was deposited on June 14, 2023, at the China Center for Type Culture Collection (CCTCC, located at Wuhan University, 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China), with the classification name: Rice Seed LP126-2 (Oryza sativa L. LP126-2). In some embodiments, the nucleic acid sequence is an amplicon for diagnosing the presence of the rice event LP126-2.

[0007] In some embodiments of the present invention, a nucleic acid sequence is provided comprising at least 11 consecutive nucleotides of SEQ ID NO:3 or its complementary sequence, and / or at least 11 consecutive nucleotides of SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:1 or its complementary sequence, and / or SEQ ID NO:2 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:3 or its complementary sequence, and / or SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:5 or its complementary sequence.

[0008] The SEQ ID NO:1 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 5' end of the insert sequence in transgenic rice event LP126-2. The SEQ ID NO:1 or its complementary sequence spans the flanking genomic DNA sequence of the rice insertion site and the DNA sequence at the 5' end of the insert sequence. The presence of the SEQ ID NO:1 or its complementary sequence is sufficient to identify the transgenic rice event LP126-2. The SEQ ID NO:2 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 3' end of the insert sequence in transgenic rice event LP126-2. The SEQ ID NO:2 or its complementary sequence spans the DNA sequence at the 3' end of the insert sequence and the flanking genomic DNA sequence of the rice insertion site. The presence of the SEQ ID NO:2 or its complementary sequence is sufficient to identify the transgenic rice event LP126-2.

[0009] The nucleic acid sequence provided by this invention can be at least 11 or more consecutive polynucleotides (first nucleic acid sequence) of any portion of the transgenic insertion sequence in SEQ ID NO:3 or its complementary sequence, or at least 11 or more consecutive polynucleotides (second nucleic acid sequence) of any portion of the 5' flanking rice genomic DNA region in SEQ ID NO:3 or its complementary sequence. The nucleic acid sequence can further be a portion of SEQ ID NO:3 homologous to or complementary to a portion of SEQ ID NO:1 containing the complete SEQ ID NO:1. When the first and second nucleic acid sequences are used together, these nucleic acid sequences include a DNA primer pair in a DNA amplification method for generating amplification products. When the amplification product generated in the DNA amplification method using the DNA primer pair is an amplification product including SEQ ID NO:1, the presence of the transgenic rice event LP126-2 or its progeny can be diagnosed. Those skilled in the art will appreciate that the first and second nucleic acid sequences do not necessarily consist solely of DNA, but may also include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or analogues that do not serve as templates for one or more polymerases. Furthermore, the probes or primers described in this invention should be at least approximately 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides in length, which may be selected from the nucleotides described in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5. When selected from the nucleotides shown in SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5, the probes and primers may be approximately 17 to 50 or more consecutive nucleotides in length. The SEQ ID NO:3 or its complementary sequence is a 795-nucleotide sequence located near the insertion junction at the 5' end of the inserted sequence in transgenic rice event LP126-2. The SEQ ID NO:3 or its complementary sequence consists of a 309-nucleotide rice flanking genomic DNA sequence (nucleotides 1-309 of SEQ ID NO:3), a 369-nucleotide pLP126 construct DNA sequence (nucleotides 310-678 of SEQ ID NO:3), and a 117-nucleotide 3' end DNA sequence of the Nos terminator (nucleotides 679-795 of SEQ ID NO:3). The presence of the SEQ ID NO:3 or its complementary sequence is sufficient to identify the transgenic rice event LP126-2.

[0010] The nucleic acid sequence may be at least 11 or more consecutive polynucleotides (third nucleic acid sequence) of any portion of the transgenic insertion sequence in SEQ ID NO:4 or its complementary sequence, or at least 11 or more consecutive nucleotides (fourth nucleic acid sequence) of any portion of the 3' flanking rice genomic DNA region in SEQ ID NO:4 or its complementary sequence. The nucleic acid sequence may further be a portion of SEQ ID NO:4 that is homologous to or complementary to the entirety of SEQ ID NO:2. When the third and fourth nucleic acid sequences are used together, these nucleic acid sequences include a DNA primer pair in the DNA amplification method that produces the amplification product. The presence of the transgenic rice event LP126-2 or its progeny can be diagnosed when the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product including SEQ ID NO:2. The SEQ ID NO:4 or its complementary sequence is a 1060-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence in transgenic rice event LP126-2. The SEQ ID NO:4 or its complementary sequence consists of a 53-nucleotide Nos (carmine synthase) transcription terminator sequence (nucleotides 1-53 of SEQ ID NO:4), a 207-nucleotide pLP126 construct DNA sequence (nucleotides 54-207 of SEQ ID NO:4), and an 800-nucleotide flanking genomic DNA sequence of the rice integration site (nucleotides 261-1060 of SEQ ID NO:4). The presence of the SEQ ID NO:4 or its complementary sequence is sufficient to identify the transgenic rice event LP126-2.

[0011] The SEQ ID NO:5 or its complementary sequence is a 17257-nucleotide sequence characterizing the transgenic rice event LP126-2, and its specific genomic and genetic elements are shown in Table 1. The presence of the transgenic rice event LP126-2 can be identified by the presence of the SEQ ID NO:5 or its complementary sequence.

[0012] Table 1. Genome and genetic elements contained in SEQ ID NO:5

[0013]

[0014] The nucleic acid sequence or its complementary sequence can be used in DNA amplification to generate amplification products, and the presence of transgenic rice event LP126-2 or its progeny in biological samples can be diagnosed by detecting the amplification products; the nucleic acid sequence or its complementary sequence can be used in nucleotide detection to detect the presence of transgenic rice event LP126-2 or its progeny in biological samples.

[0015] The present invention provides a DNA primer pair comprising a first primer and a second primer, wherein the first primer and the second primer each comprise a fragment of SEQ ID NO:5 or its complementary sequence, and when used together with DNA containing rice event LP126-2 for an amplification reaction, an amplification product for detecting rice event LP126-2 in a sample is generated.

[0016] In some embodiments, the first primer is selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:8 or SEQ ID NO:10; the second primer is selected from SEQ ID NO:2 or its complementary sequence, SEQ ID NO:11 or SEQ ID NO:14.

[0017] In some embodiments of the present invention, the amplification product comprises at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence.

[0018] Further, the amplification product includes consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:2 or its complementary sequence.

[0019] Furthermore, the amplification product includes SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, or SEQ ID NO:7 or its complementary sequence.

[0020] In the above technical solution, the primers include at least one of the nucleic acid sequences. Specifically, the primers include a first primer and a second primer, wherein the first primer is selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:8 or SEQ ID NO:12, and the second primer is selected from SEQ ID NO:9 or SEQ ID NO:13; or the first primer is selected from SEQ ID NO:2 or its complementary sequence, SEQ ID NO:10 or SEQ ID NO:15, and the second primer is selected from SEQ ID NO:11 or SEQ ID NO:14.

[0021] The present invention also provides a DNA probe comprising a fragment of SEQ ID NO:5 or its complementary sequence, wherein the DNA probe hybridizes under strict hybridization conditions with DNA molecules comprising nucleic acid sequences selected from SEQ ID NO:1-7 or their complementary sequences, and does not hybridize under strict hybridization conditions with DNA molecules not comprising nucleic acid sequences selected from SEQ ID NO:1-7 or their complementary sequences.

[0022] In some embodiments, the DNA probe comprises a sequence selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and SEQ ID NO:7 or its complementary sequence.

[0023] In some embodiments, the DNA probe is labeled with a fluorescent group.

[0024] In some embodiments, the probe comprises at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence; further, the probe comprises consecutive nucleotides at positions 1-11 or 12-22 in SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 in SEQ ID NO:2 or its complementary sequence.

[0025] The present invention also provides a marker nucleic acid molecule comprising a fragment of SEQ ID NO:5 or its complementary sequence, wherein the marker nucleic acid molecule hybridizes with a DNA molecule comprising a nucleic acid sequence selected from SEQ ID NO:1-7 or its complementary sequence under strict hybridization conditions, and does not hybridize with a DNA molecule not containing a nucleic acid sequence selected from SEQ ID NO:1-7 or its complementary sequence under strict hybridization conditions.

[0026] In some embodiments, the marker nucleic acid molecule comprises a sequence selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and SEQ ID NO:7 or its complementary sequence.

[0027] In one embodiment, the marker nucleic acid molecule comprises at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence.

[0028] In some embodiments, the marker nucleic acid molecule comprises consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:2 or its complementary sequence.

[0029] Furthermore, the present invention provides a method for detecting the presence of DNA from the transgenic rice event LP126-2 in a sample, comprising:

[0030] (1) Contact the sample to be tested with the DNA primer pair in the nucleic acid amplification reaction;

[0031] (2) Perform nucleic acid amplification reaction;

[0032] (3) Detect the presence of amplification products;

[0033] The amplification product includes a nucleic acid sequence selected from SEQ ID NO:1-7 or its complementary sequence, indicating that the sample contains DNA from the transgenic rice event LP126-2.

[0034] The present invention also provides a method for detecting the presence of DNA from the transgenic rice event LP126-2 in a sample, comprising:

[0035] (1) Contact the sample to be tested with the DNA probe and / or the labeled nucleic acid molecule;

[0036] (2) Hybridize the sample to be tested with the probe and / or the labeled nucleic acid molecule under strict hybridization conditions;

[0037] (3) Detect the hybridization of the sample to be tested with the probe and / or the marker nucleic acid molecule.

[0038] The stringent conditions can be defined as hybridization at 65°C in a 6×SSC (sodium citrate) and 0.5% SDS (sodium dodecyl sulfate) solution, followed by washing the membrane once each with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS.

[0039] The process involves detecting the hybridization of the sample to be tested and the marker nucleic acid molecules, and then using marker-assisted breeding analysis to determine whether insect resistance and / or herbicide tolerance are genetically linked to the marker nucleic acid molecules.

[0040] The present invention also provides a DNA detection kit, comprising: a DNA primer pair that generates an amplicon for diagnosing the transgenic rice event LP126-2; and a probe specific to SEQ ID NO:1-7 or a marker nucleic acid molecule specific to SEQ ID NO:1-7. Specifically, the detection kit includes the probe, primer pair, or marker nucleic acid molecule described in this invention.

[0041] In some embodiments, the present invention provides a DNA detection kit comprising at least one DNA molecule, said DNA molecule comprising at least 11 consecutive nucleotides in the homologous sequence of SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in the homologous sequence of SEQ ID NO:4 or its complementary sequence, which can serve as DNA primers or probes specific to the transgenic rice event LP126-2 or its progeny.

[0042] Further, the DNA molecule comprises consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:2 or its complementary sequence.

[0043] Furthermore, the DNA molecule includes the homologous sequence of SEQ ID NO:1 or its complementary sequence, the homologous sequence of SEQ ID NO:2 or its complementary sequence, the homologous sequence of SEQ ID NO:6 or its complementary sequence, or the homologous sequence of SEQ ID NO:7 or its complementary sequence. To achieve the above objectives, the present invention also provides a plant cell comprising nucleic acid sequences encoding insect resistance Cry1Ab, Cry2Ab, and Cry1Fa proteins, nucleic acid sequences encoding glyphosate herbicide tolerance EPSPS proteins, and nucleic acid sequences in a specific region, wherein the nucleic acid sequences in the specific region include the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, or SEQ ID NO:7.

[0044] The sequences provided by this invention include those listed in Table 2 below:

[0045] Table 2. Relevant Sequences of the Invention

[0046]

[0047]

[0048] The present invention also provides a method for protecting rice plants from insect infestation, comprising providing at least one transgenic rice plant cell in the diet of target insects, wherein the genome of the transgenic rice plant contains, in sequence, the nucleic acid sequences of positions 321-16446 of SEQ ID NO:1 and SEQ ID NO:5 and SEQ ID NO:2; or the genome of the transgenic rice plant contains the sequence shown in SEQ ID NO:5, thereby inhibiting target insects that feed on the transgenic rice plant cell from further feeding on the rice plant.

[0049] The present invention also provides a method for protecting rice plants from damage caused by herbicides, wherein at least one transgenic rice plant is planted, the genome of which sequentially contains the nucleic acid sequences of SEQ ID NO:1, positions 321-16446 of SEQ ID NO:5 and SEQ ID NO:2; or the genome of the transgenic rice plant contains the sequence shown in SEQ ID NO:5.

[0050] The present invention also provides a method for controlling weeds in a field where rice plants are grown, comprising applying an effective dose of glyphosate herbicide to a field where at least one transgenic rice plant is grown, wherein the genome of the transgenic rice plant contains, in sequence, the nucleic acid sequences of positions 321-16446 of SEQ ID NO:1, SEQ ID NO:5, and SEQ ID NO:2; or the genome of the transgenic rice plant contains the sequence shown in SEQ ID NO:5.

[0051] The present invention also provides a method for cultivating rice plants resistant to insects, comprising: planting at least one rice seed containing the transgenic rice event LP126-2;

[0052] To enable the rice seeds to grow into rice plants;

[0053] The rice plants were attacked with target insects and / or sprayed with an effective dose of glyphosate herbicide, and the resulting plants were harvested with reduced plant damage compared to other plants that did not contain the transgenic rice event LP126-2.

[0054] In some embodiments, the present invention provides a method for cultivating rice plants that are resistant to insects and tolerant to glyphosate herbicides, comprising:

[0055] Plant at least one rice seed containing the genetically modified rice event LP126-2;

[0056] To enable the rice seeds to grow into rice plants;

[0057] The rice plants were sprayed with an effective dose of glyphosate herbicide, and the harvested plants showed reduced plant damage compared to other plants that did not have the transgenic rice event LP126-2. The plants with reduced plant damage were also resistant to insect feeding damage.

[0058] In some embodiments, the present invention also provides a method for producing insect-resistant rice plants, comprising introducing a transgenic rice event LP126-2 into the genome of the rice plant and selecting plants exhibiting reduced plant damage from insect feeding. In some embodiments, the method comprises: sexually crossing an insect-resistant transgenic rice event LP126-2 first parent rice plant with a second parent rice plant lacking insect resistance to produce a large number of progeny plants; attacking the progeny plants with target insects; and selecting the progeny plants exhibiting reduced plant damage compared to other plants without the transgenic rice event LP126-2.

[0059] In some embodiments, the present invention also provides a method for producing glyphosate-tolerant rice plants, comprising introducing a transgenic rice event LP126-2 into the genome of the rice plant and selecting glyphosate-tolerant rice plants. In some embodiments, the method comprises: sexually crossing a first parent rice plant of the glyphosate-tolerant transgenic rice event LP126-2 with a second parent rice plant lacking glyphosate tolerance to produce a large number of progeny plants; treating the progeny plants with glyphosate herbicide; and selecting the glyphosate-tolerant progeny plants.

[0060] In some embodiments, the present invention also provides a method for producing rice plants that are resistant to insects and tolerant to glyphosate herbicide application, comprising: introducing a transgenic rice event LP126-2 into the genome of the rice plant; and selecting rice plants that are resistant to glyphosate and have insect resistance. In some embodiments, the method comprises sexually crossing a first parent rice plant of the transgenic rice event LP126-2 that has glyphosate tolerance and insect resistance with a second parent rice plant lacking glyphosate tolerance and / or insect resistance, thereby producing a large number of progeny plants; treating the progeny plants with glyphosate; and selecting the glyphosate-resistant progeny plants that are also resistant to insect feeding damage.

[0061] This invention also provides a composition derived from the transgenic rice event LP126-2, said composition being any composition or product made of material comprising plants, seeds, plant cells, or plant parts containing the rice event LP126-2. In some embodiments, the composition may be viable or non-viable. If sufficient expression levels are detected in said composition, the composition is expected to contain nucleic acid sequences capable of diagnosing the presence of transgenic rice event LP126-2 material in said composition. Specifically, the non-viable composition includes, but is not limited to, non-viable seeds, processed seeds, seed parts, and plant parts for use in feed and food products, oils, etc. The viable composition includes, but is not limited to, seeds, plants, and plant cells. Thus, rice plants containing event LP126-2 can be used to manufacture any commodity normally obtained from rice. Any such commodity derived from rice plants containing event LP126-2 may contain at least detectable DNA specific and unique to the rice event LP126-2.

[0062] The probe- or primer-based detection method and / or kit of the present invention can be used to detect the transgenic rice event LP126-2 nucleic acid sequence, such as SEQ ID NO:1 or SEQ ID NO:2, wherein the probe sequence or primer sequence is selected from the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, to diagnose the presence of transgenic rice event LP126-2.

[0063] In summary, the transgenic rice event LP126-2 of this invention possesses dual traits of insect resistance and herbicide tolerance, offering the following advantages: 1) protection from economic losses caused by lepidopteran pests (such as the rice stem borer, rice leaf roller, and other major pests in rice-growing areas); 2) the ability to apply glyphosate-containing agricultural herbicides to rice crops for broad-spectrum weed control; and 3) no reduction in rice yield. Specifically, event LP126-2 of this invention exhibits high resistance to target pests, resulting in pest mortality rates as high as 100%, protecting plants to a damage rate as low as 0%; it also demonstrates high tolerance to glyphosate herbicides, protecting plants to a damage rate as low as 0% even at 4 times the recommended dosage; furthermore, plants containing this event exhibit excellent agronomic traits, with yield percentages reaching up to 101%. Furthermore, the genes encoding insect resistance and glyphosate tolerance traits are linked to the same DNA segment and exist at a single locus in the genome of the transgenic rice event LP126-2. This improves breeding efficiency and allows for the use of molecular markers to track transgenic insertion fragments in breeding populations and their progeny. Simultaneously, the primer or probe sequences provided in the detection method of this invention can generate amplification products that identify the transgenic rice event LP126-2 or its progeny, enabling rapid, accurate, and stable identification of the presence of plant material derived from the transgenic rice event LP126-2.

[0064] the term

[0065] The following definitions and methods are intended to better define this invention and guide those skilled in the art in carrying it out. Unless otherwise stated, the terms should be understood according to their conventional usage by those skilled in the art.

[0066] The "rice" mentioned refers to cereal crops of the genus Oryza (Rice). Oryza sativa L.), and includes all plant species that can interbreed with rice, including wild rice species.

[0067] The term "comprising" means "including but not limited to". The term "processed product" refers to a product obtained by processing raw materials such as plants and seeds, such as compositions.

[0068] The term "plant" includes the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can regenerate, plant callus, plant clumps, and complete plant cells in a plant or plant part, such as embryo, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. It should be understood that parts of transgenic plants within the scope of this invention include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, and flowers, stems, fruits, leaves, and roots, all of which are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of this invention and are therefore at least partially composed of transgenic cells.

[0069] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including the regulatory sequence preceding the coding sequence (5' non-coding sequence) and the regulatory sequence following the coding sequence (3' non-coding sequence). A "natural gene" is a gene that is naturally found to have its own regulatory sequence. A "chimeric gene" is any gene that is not a natural gene but contains regulatory and coding sequences not naturally found. An "endogenous gene" is a natural gene located at its natural position in an organism's genome. A "foreign gene" is a foreign gene that is currently present in an organism's genome and was not originally present; it also refers to a gene introduced into a recipient cell through a transgenic process. Foreign genes can include natural genes inserted into non-natural organisms or chimeric genes. A "transgenic gene" is a gene that has been introduced into the genome through a transformation process. The site where recombinant DNA has been inserted into the plant genome can be called an "insertion site" or a "target site."

[0070] "Flanking DNA" can comprise the genome naturally present in organisms such as plants or exogenous (heterologous) DNA introduced through a transformation process, such as fragments associated with the transformation event. Therefore, flanking DNA can comprise a combination of natural and exogenous DNA. In this invention, a "flanking region," "flanking sequence," "genome boundary region," or "genome boundary sequence" refers to a sequence of at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500, or 5000 base pairs or longer, located directly upstream or downstream of and adjacent to the original exogenous inserted DNA molecule. When the flanking region is downstream, it can also be referred to as a "left boundary flanking," "3' flanking," "3' genome boundary region," or "genome 3' boundary sequence," etc. When this flanking region is located upstream, it can also be referred to as the "right boundary flanking region", "5' flanking region", "5' genome boundary region", or "genome 5' boundary sequence", etc.

[0071] Transformation procedures that induce random integration of exogenous DNA result in transformants containing distinct flanking regions, which are unique to each transformant. When recombinant DNA is introduced into plants via conventional hybridization, these flanking regions typically remain unchanged. Transformants also contain unique junctions between segments of the heterologous insert DNA and genomic DNA, or between two segments of genomic DNA, or between two segments of heterologous DNA. A "junction" is the point where two specific DNA segments join. For example, junctions exist where the insert DNA joins flanking DNA. Junction points also exist in transformed organisms, where two DNA segments are joined together in a manner modified from those found in natural organisms. "Junction DNA" refers to DNA containing junction points.

[0072] This invention provides a transgenic rice event called LP126-2 and its progeny, wherein the transgenic rice event LP126-2 is the rice plant LP126-2, which includes the plant and seeds of the transgenic rice event LP126-2 and its plant cells or regenerable parts thereof, wherein the plant parts of the transgenic rice event LP126-2 include, but are not limited to, cells, pollen, flowers, buds, roots, stems, leaves and products from the rice plant LP126-2.

[0073] The present invention relates to a transgenic rice event LP126-2 comprising a DNA construct that, when expressed in plant cells, acquires resistance to insects and tolerance to glyphosate herbicides.

[0074] In some embodiments of the invention, the DNA construct comprises four tandem expression cassettes: a first expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operatively linked to a nucleic acid sequence of the insect-resistant Cry2Ab protein (Cry2Ab) of Bacillus thuringiensis, the Cry2Ab protein exhibiting lepidopteran insect resistance; a second expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operatively linked to a nucleic acid sequence of the insect-resistant Cry1Fa protein (Cry1Fa) of Bacillus thuringiensis, the Cry1Fa exhibiting lepidopteran insect resistance; and a third expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operatively linked to a nucleic acid sequence of the Cry1Ab protein, the Cry1Ab protein exhibiting resistance primarily to lepidopteran insects. The fourth expression cassette contains a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, wherein the promoter is operatively linked to a gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), the nucleic acid sequence of which is resistant to glyphosate herbicide. Further, the promoter can be a suitable promoter isolated from plants, including constitutive, inducible, and / or tissue-specific promoters, including but not limited to, cauliflower mosaic virus (CaMV) 35S promoter, Scrophularia mosaic virus (FMV) 35S promoter, ubiquitin promoter, actin promoter, Agrobacterium tumefaciens promoter, etc. Agrobacterium tumefaciensNosine synthase (NOS) promoter, octopine synthase (OCS) promoter, Cestrum yellow leaf curl virus promoter, potato tuber storage protein (Patatin) promoter, ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) promoter, E9 promoter, GOS promoter, alcA / alcR promoter, Agrobacterium rhizogenes ( Agrobacterium rhizogenes The RolD promoter and the Arabidopsis thaliana Suc2 promoter. The polyadenylation signal sequence can be a suitable polyadenylation signal sequence that functions in plants, including but not limited to those derived from Agrobacterium tumefaciens (Agrobacterium). grobacterium tumefaciens The polyadenylation signal sequence of the cauliflower mosaic virus (CaMV) gene, the polyadenylation signal sequence of the protease inhibitor II (PINII) gene, and the polyadenylation signal sequence of the α-tubulin gene were all derived from the cauliflower mosaic virus (CaMV) 35S terminator.

[0075] In addition, the expression cassette may also include other genetic elements, including but not limited to enhancers and signal peptide / transporter nucleic acid coding sequences. The enhancers can enhance gene expression levels, and these enhancers include, but are not limited to, tobacco etching virus (TEV) translation activator, CaMV35S enhancer, and FMV35S enhancer. The signal peptide / transporter can guide the transport of Cry1Ab protein and / or EPSPS protein to specific organelles or compartments outside or inside the cell, for example, targeting chloroplasts using sequences encoding chloroplast transport peptides, or targeting the endoplasmic reticulum using the "KDEL" retention sequence.

[0076] The Cry1Ab , Cry2Ab and Cry1Fa Genes can originate from Bacillus thuringiensis (Bt). Bacillus thuringiensis It is obtained by separating it from (Bt) and can be modified by optimizing the codon or by other means. Cry1Ab , Cry2Ab and Cry1Fa The nucleic acid sequence of the gene is modified to increase the stability and availability of the transcript in the transformed cell.

[0077] In some embodiments of the present invention, rice cells, seeds or plants containing the transgenic rice event LP126-2 contain, in sequence, the nucleic acid sequences of positions 321-16446 of SEQ ID NO:1 and SEQ ID NO:5 and SEQ ID NO:2, or contain SEQ ID NO:5.

[0078] The order Lepidoptera, which includes moths and butterflies, is the order with the most agricultural and forestry pests, such as the rice stem borer, rice leaf roller, and rice leaf roller.

[0079] The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene can be derived from Agrobacterium tumefaciens (Agrobacterium tumefaciens). Agrobacterium tumefaciens The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene, isolated from strain CP4, can be modified by optimizing the codon or otherwise altering the polynucleotide encoding the EPSPS gene to increase the stability and availability of the transcript in transformed cells. The EPSPS gene can also be used as a selective marker gene.

[0080] The term "glyphosate" refers to N-phosphonomethylglycine and its salts. Treatment with "glyphosate herbicide" means treatment with any herbicide formulation containing glyphosate. The selection of the application rate of a particular glyphosate formulation to achieve an effective biological dose does not exceed the skill level of an average agronomist. Treatment of fields containing plant material derived from the LP126-2 transgenic rice event with any glyphosate-containing herbicide formulation will control weed growth in the fields without affecting the growth or yield of the plant material derived from the LP126-2 transgenic rice event.

[0081] The DNA construct is introduced into plants using transformation methods, including but not limited to Agrobacterium-mediated transformation, gene gun transformation, and pollen tube pathway transformation.

[0082] Agrobacterium-mediated transformation is a commonly used method for plant transformation. Exogenous DNA to be introduced into the plant is cloned into the T-DNA region between the common sequences on the left and right boundaries of a vector. The vector is then transformed into Agrobacterium cells, which are subsequently used to infect plant tissues, whereby the T-DNA region of the vector containing the exogenous DNA is inserted into the plant genome.

[0083] The gene gun transformation method refers to bombarding plant cells with a vector containing exogenous DNA (particle-mediated biological bombardment transformation).

[0084] After transformation, transgenic plants must be regenerated from the transformed plant tissues, and offspring with exogenous DNA must be selected using appropriate markers.

[0085] DNA constructs are combinations of interconnected DNA molecules that provide one or more expression cassettes. Specifically, DNA constructs are plasmids capable of self-replication within bacterial cells and containing various restriction endonuclease sites for introducing DNA molecules that provide functional genetic elements, namely promoters, introns, leader sequences, coding sequences, 3' terminator regions, and other sequences. The expression cassettes contained in the DNA constructs include genetic elements necessary for the transcription of messenger RNA, and these cassettes can be designed for expression in prokaryotic or eukaryotic cells. The expression cassettes of the present invention are designed most specifically for expression in plant cells.

[0086] A transgenic “event” is obtained by transforming plant cells with a heterologous DNA construct, comprising at least one nucleic acid expression cassette containing the target gene, inserted into the plant genome via transgenic methods to generate a plant population, regenerate the plant population, and select specific plants with characteristics of the insertion at a specific genomic site. The term “event” refers to the original transformant containing heterologous DNA and the offspring of that transformant. The term “event” also refers to the offspring obtained by sexual hybridization between the transformant and other varietal individuals containing heterologous DNA, where, even after repeated backcrossing with a backcross parent, the inserted DNA and flanking genomic DNA from the transformant parent are present at the same chromosomal location in the hybrid offspring. The term “event” also refers to a DNA sequence from the original transformant containing the inserted DNA and flanking genomic sequences closely adjacent to the inserted DNA, which is intended to be transferred to offspring produced by sexual hybridization of a parental line containing the inserted DNA (e.g., the original transformant and its self-crossed offspring) with a parental line not containing the inserted DNA, and the offspring receiving the inserted DNA containing the target gene.

[0087] In this invention, "recombination" refers to a form of DNA and / or protein and / or organism that is not normally found in nature and is therefore produced through artificial intervention. Such artificial intervention can produce recombinant DNA molecules and / or recombinant plants. The "recombinant DNA molecule" is obtained by artificially combining two sequence segments that are otherwise separate, for example, by chemical synthesis or by manipulating isolated nucleic acid segments using genetic engineering techniques. Techniques for manipulating nucleic acids are well known.

[0088] The term "transgenic" includes any cell, cell line, callus, tissue, plant part, or plant whose genotype has been altered due to the presence of a heterologous nucleic acid. "Transgenic" includes the original transgenic organism that was so altered, as well as offspring individuals generated from the original transgenic organism through sexual hybridization or asexual reproduction. In this invention, the term "transgenic" does not include genomic (chromosomal or extrachromosomal) alterations achieved through conventional plant breeding methods or naturally occurring events such as random allogeneic fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.

[0089] In this invention, "heterogeneous" means that the first molecule is not typically found to combine with the second molecule in nature. For example, a molecule may originate from a first species and be inserted into the genome of a second species. Therefore, such a molecule is heterologous to the host and is artificially introduced into the host cell's genome.

[0090] The transgenic rice event LP126-2, which is resistant to lepidopteran insects and tolerant to glyphosate herbicide, can be cultivated through the following steps: First, a first parent rice plant is sexually crossed with a second parent rice plant to produce diverse first-generation progeny plants. The first parent rice plant consists of rice plants bred from the transgenic rice event LP126-2 and its progeny, which are obtained by transformation using the expression cassette of the present invention that is resistant to lepidopteran insects and tolerant to glyphosate herbicide. The second parent rice plant lacks resistance to lepidopteran insects and / or is tolerant to glyphosate herbicide. Then, progeny plants that are resistant to lepidopteran insect invasion and / or tolerant to glyphosate herbicide are selected to cultivate rice plants that are resistant to lepidopteran insects and tolerant to glyphosate herbicide. These steps may further include backcrossing progeny plants with lepidopteran insect resistance and / or glyphosate tolerance with a second or third parent rice plant, and then selecting progeny by lepidopteran insect invasion, application of glyphosate herbicide, or identification by trait-related molecular markers (such as DNA molecules containing the 5' and 3' junction sites identified in the transgenic rice event LP126-2), thereby producing rice plants that are lepidopteran insect resistant and glyphosate herbicide tolerant.

[0091] It should also be understood that two different transgenic plants can be hybridized to produce offspring containing two independent, segregated foreign genes. Self-pollination of appropriate offspring can yield plants that are homozygous for both added foreign genes. Backcrossing of parental plants and heteromorphic hybridization with non-transgenic plants, as mentioned above, are also to be expected, as is asexual reproduction.

[0092] The term "probe" refers to a segment of isolated nucleic acid molecule to which conventional detectable markers or reporter molecules may be bound, such as radioisotopes, ligands, chemiluminescent agents, or enzymes. This probe is complementary to one strand of the target nucleic acid. In this invention, the probe is complementary to one strand of DNA from the genome of the transgenic rice event LP126-2, regardless of whether the genomic DNA originates from the transgenic rice event LP126-2, its seeds, or from plants, seeds, or extracts of the transgenic rice event LP126-2. The probes of this invention include not only deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), but also polyamides and other probe materials that specifically bind to the target DNA sequence and can be used to detect the presence of that target DNA sequence.

[0093] The term "primer" refers to a segment of isolated nucleic acid molecule that binds to a complementary target DNA strand through nucleic acid hybridization and annealing, forming a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pairs of this invention relate to their application in the amplification of target nucleic acid sequences, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

[0094] Methods for designing and using primers and probes are well known in the art. DNA molecules containing full-length or fragmented sequences of SEQ ID NO:1-7 can be used as primers and probes for detecting rice event LP126-2, and can be readily designed by those skilled in the art using the sequences provided herein.

[0095] The probes and primers are typically 11 polynucleotides or longer, preferably 18 polynucleotides or longer, more preferably 24 polynucleotides or longer, and most preferably 30 polynucleotides or longer. These probes and primers specifically hybridize to the target sequence under highly stringent hybridization conditions. Although probes that differ from the target DNA sequence and maintain hybridization ability to the target DNA sequence can be designed using conventional methods, preferably, the probes and primers of this invention have complete DNA sequence identity with the continuous nucleic acid of the target sequence.

[0096] Primers and probes for the flanking genomic DNA and insert sequences based on the present invention can be determined using conventional methods, for example, by isolating the corresponding DNA molecules from plant material derived from the transgenic rice event LP126-2 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule contains the transgenic insert sequence and a flanking region of the rice genome, and fragments of the DNA molecule can be used as primers or probes.

[0097] The nucleic acid probes and primers of this invention hybridize with target DNA sequences under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from the transgenic rice event LP126-2 in a sample. Nucleic acid molecules or fragments thereof can specifically hybridize with other nucleic acid molecules under certain conditions. As used in this invention, if two nucleic acid molecules can form antiparallel double-stranded nucleic acid structures, it can be said that the two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules exhibit perfect complementarity, one nucleic acid molecule is said to be a "complement" of the other nucleic acid molecule. As used in this invention, when every nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to exhibit "perfect complementarity". If two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under at least conventional "low stringent" conditions, the two nucleic acid molecules are said to be "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under conventional "high stringent" conditions, the two nucleic acid molecules are said to be "complementary". Deviations from perfect complementarity are permissible, as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. For a nucleic acid molecule to function as a primer or probe, it only needs to be sufficiently complementary in sequence to form a stable double-stranded structure under the specific solvent and salt concentration used.

[0098] As used in this invention, the substantially homologous sequence is a nucleic acid molecule that, under highly stringent conditions, can specifically hybridize with the complementary strand of a matching nucleic acid molecule. Suitable stringent conditions for promoting DNA hybridization, such as treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C followed by washing with 2.0× SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from approximately 2.0× SSC, 50°C for low-stringent conditions to approximately 0.2× SSC, 50°C for high-stringent conditions. Furthermore, the temperature conditions in the washing step can be increased from approximately 22°C (room temperature) for low-stringent conditions to approximately 65°C for high-stringent conditions. Both the temperature conditions and the salt concentration can be changed, or one can remain constant while the other is changed. Specifically, a nucleic acid molecule of the present invention can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences, under moderately stringent conditions, such as about 2.0 × SSC and about 65°C. More specifically, a nucleic acid molecule of the present invention can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences, under highly stringent conditions. In the present invention, preferred marker nucleic acid molecules have SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, or SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences. Another preferred marker nucleic acid molecule of the present invention has 80% to 100% or 90% to 100% sequence identity with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or their complementary sequences, or any fragment of the above sequences. SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:7 can be used as markers in plant breeding methods to identify offspring of genetic hybridization. Hybridization of the probe with the target DNA molecule can be detected by any method well known to those skilled in the art, including but not limited to fluorescent labeling, radioactive labeling, antibody labeling and chemiluminescent labeling.

[0099] Regarding amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "strict conditions" refer to conditions in which primers are allowed to hybridize only with the target nucleic acid sequence during a DNA thermal amplification reaction. Primers having a wild-type sequence (or its complementary sequence) corresponding to the target nucleic acid sequence are able to bind to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.

[0100] The term "specific binding (target sequence)" means that, under strict hybridization conditions, the probe or primer hybridizes only with the target sequence in a sample containing the target sequence.

[0101] As used in this invention, "amplified DNA," "amplification product," or "amplifier" refers to the nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether rice plants are produced by sexual hybridization of the transgenic rice event LP126-2 of this invention, or whether rice samples collected from fields contain the transgenic rice event LP126-2, or whether rice extracts contain the transgenic rice event LP126-2, DNA extracted from rice plant tissue samples or extracts can be amplified using a primer pair nucleic acid amplification method to generate an amplifier that is diagnostic for the presence of DNA related to the transgenic rice event LP126-2. The primer pair includes a first primer derived from a flanking sequence in the plant genome adjacent to the insertion site of the inserted exogenous DNA, and a second primer derived from the inserted exogenous DNA. The amplifier has a specific length and sequence that is also diagnostic for the transgenic rice event LP126-2. The length of the amplicon can be the binding length of the primer pair plus one nucleotide base pair, preferably about fifty nucleotide base pairs, more preferably about two hundred and fifty nucleotide base pairs, and most preferably about four hundred and fifty nucleotide base pairs or more.

[0102] Optionally, primer pairs can be derived from flanking genomic sequences on either side of the inserted DNA to generate amplicons comprising the entire inserted nucleic acid sequence. One of the primer pairs derived from plant genome sequences can be located at a distance from the inserted DNA sequence, ranging from one nucleotide base pair to approximately 20,000 nucleotide base pairs. The use of the term "amplifier" specifically excludes primer dimers formed during thermal amplification of DNA.

[0103] Nucleic acid amplification reactions can be performed using any nucleic acid amplification method known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. PCR amplification methods have been developed to amplify 22kb of genomic DNA and 42kb of bacteriophage DNA. These methods, as well as other DNA amplification methods in the art, can be used in this invention. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic rice event LP126-2 can be used to amplify the genome of the transgenic rice event LP126-2 using the provided primer sequences, followed by standard DNA sequencing of the PCR amplicons or cloned DNA.

[0104] DNA detection kits based on DNA amplification methods may contain DNA primer molecules that specifically hybridize to target DNA and amplify diagnostic amplicones under appropriate reaction conditions. The kits may provide agarose gel-based detection methods or many other methods known in the art for detecting diagnostic amplicones. Kits containing DNA primers homologous to or complementary to any portion of the rice genome region of SEQ ID NO:3 or SEQ ID NO:4, and homologous to or complementary to any portion of the transgenic insertion region of SEQ ID NO:5, are provided by this invention. Specifically, primer pairs useful in DNA amplification methods are SEQ ID NO:8 and SEQ ID NO:9, which amplify diagnostic amplicones homologous to a portion of the 5' transgenic / genomic region of the transgenic rice event LP126-2, wherein the amplicon includes SEQ ID NO:1. Other DNA molecules used as DNA primers may be selected from SEQ ID NO:5.

[0105] The amplicon generated by these methods can be detected using a variety of techniques. One such method is GeneticBit Analysis, which designs a DNA oligonucleotide chain spanning the insert DNA sequence and adjacent flanking genomic DNA sequences. This oligonucleotide chain is immobilized in the wells of a microplate. After PCR amplification of the target region (using one primer each in the insert sequence and adjacent flanking genomic sequences), the single-stranded PCR product hybridizes with the immobilized oligonucleotide chain and serves as a template for a single-base extension reaction using DNA polymerase and ddNTPs specifically labeled for the next expected base. Results can be obtained using fluorescence or ELISA-like methods. The signal indicates the presence of the insert / flanking sequence, signifying successful amplification, hybridization, and single-base extension.

[0106] Another method is pyrosequencing. This method designs an oligonucleotide chain that spans the insertion DNA sequence and the binding site of adjacent genomic DNA. This oligonucleotide chain is hybridized with single-stranded PCR products of the target region (using one primer each within the insertion sequence and in adjacent flanking genomic sequences), and then incubated with DNA polymerase, ATP, thioacylase, luciferase, adenosine triphosphate diphosphatase, adenosine-5'-phosphate sulfate, and luciferin. dNTPs are added separately, and the resulting light signal is measured. The light signal represents the presence of the insertion / flanking sequence, indicating that amplification, hybridization, and single- or multi-base extension reactions were successful.

[0107] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9:492-498, 1999) can also be used to detect the amplicon of this invention. This method requires designing an oligonucleotide chain that spans the insertion DNA sequence and the binding site of adjacent genomic DNA. This oligonucleotide chain is hybridized with a single-stranded PCR product of the target region (using one primer within the insertion sequence and one primer in adjacent flanking genomic sequences), and then incubated with DNA polymerase and a fluorescently labeled ddNTP. Single-base extension results in the insertion of ddNTPs. This insertion can be measured using a fluorometer to determine the change in polarization. The change in polarization indicates the presence of the insertion / flanking sequence, signifying that the amplification, hybridization, and single-base extension reactions were successful.

[0108] Taqman is described as a method for detecting and quantifying the presence of DNA sequences, detailed in the manufacturer's instructions for use. A brief example is provided below: a FRET oligonucleotide probe is designed to bind across the insert DNA sequence and adjacent flanking genomic regions. This FRET probe and PCR primers (one primer within the insert sequence and one primer in adjacent flanking genomic sequences) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the splitting of the fluorescent and quenched portions of the probe, and the release of the fluorescent portion. The generation of a fluorescent signal indicates the presence of the insert / flanking sequence, signifying successful amplification and hybridization.

[0109] Based on the principle of hybridization, suitable techniques for detecting plant material derived from the transgenic rice event LP126-2 may also include Southern blot hybridization, Northern blot hybridization, and in situ hybridization. Specifically, these suitable techniques include incubating the probe and sample, washing to remove unbound probes, and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe; for example, radiolabeled probes can be detected by X-ray exposure and development, or enzyme-labeled probes can be detected by a color change resulting from substrate transformation.

[0110] Tyangi et al. (Nature Biotech 14:303-308, 1996) described the application of molecular markers in sequence detection. Briefly, a FRET oligonucleotide probe was designed that spans the insertion DNA sequence and the adjacent flanking genomic region. The unique structure of this FRET probe results in a secondary structure that allows for the retention of fluorescent and quenched portions in close proximity. The FRET probe and PCR primers (one primer within the insertion sequence and one primer in the adjacent flanking genomic sequence) were cyclically reacted in the presence of a thermostable polymerase and dNTPs. Upon successful PCR amplification, hybridization of the FRET probe and the target sequence leads to the loss of the probe's secondary structure, causing spatial separation of the fluorescent and quenched portions and generating a fluorescent signal. The generation of the fluorescent signal indicates the presence of the insertion / flanking sequence, signifying successful amplification and hybridization.

[0111] Other described methods, such as microfluidics, provide methods and devices for isolating and amplifying DNA samples. Optical dyes are used to detect and determine specific DNA molecules. Nanotube devices containing electronic sensors for detecting DNA molecules or nanobeads that bind specific DNA molecules and are thus detectable are useful for detecting the DNA molecules of this invention.

[0112] DNA detection kits can be developed using the compositions described in this invention and methods described or known in the field of DNA detection. These kits are advantageous for identifying the presence of DNA from the transgenic rice event LP126-2 in samples and can also be used to cultivate rice plants containing DNA from the transgenic rice event LP126-2. The kits may contain DNA primers or probes homologous to or complementary to at least a portion of SEQ ID NO: 1, 2, 3, 4, or 5, or other DNA primers or probes homologous to or complementary to DNA contained in transgenic genetic elements, these DNA sequences being used for DNA amplification reactions or as probes in DNA hybridization methods.

[0113] Contained in the rice genome and in Figure 1 The DNA structure of the transgenic insertion sequence binding site with the rice genome, as described in Table 1, comprises: a portion of the insertion sequence from the right boundary region (RB) of Agrobacterium tumefaciens located at the 5' end of the rice LP126-2 flanking genome region; the first expression cassette consisting of the Scrophularia mosaic virus 35S promoter (pFMV), operably linked to the maize heat shock protein gene HSP70 protein intron (iZmHSP), operably linked to maize chloroplast transport peptide 2 (ZmCTP), operably linked to the Bacillus thuringiensis insect resistance Cry2Ab protein (Cry2Ab), and operably linked to the alkaloid synthase transcription terminator (Nos); and the second expression cassette consisting of the maize ubiquitin gene promoter Ubi (pZmUbi) containing a tandem repeat of the enhancer region, operably linked to the Bacillus thuringiensis insect resistance gene Cry1Fa (Cry1Fa), and operably linked to Agrobacterium tumefaciens pTi15955. The fourth expression cassette consists of the terminator ORF25PolyA; the third expression cassette consists of the cauliflower mosaic virus 35S promoter (p35S), operably linked to the 5' untranslated leading strand sequence (WtCab) of wheat chloroplast a / b binding protein, operably linked to the intron of rice actin gene 1 (iOsAct1), operably linked to the insect resistance Cry1Ab protein (Cry1Ab) of Bacillus thuringiensis, and operably linked to the terminator (In2) of benzenesulfonamide-induced gene 2; The cassette comprises a rice actin 1 promoter (pOsAct1) operably linked to an Arabidopsis chloroplast transport peptide (AtCTP), operably linked to a glyphosate-resistant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) of Agrobacterium CP4 strain, and operably linked to a transcription terminator (Nos) of annattoline synthase, a portion of the insert sequence from the left border region (LB) of Agrobacterium, and a flanking genomic region of rice plant LP126-2 located at the 3' end of the transgenic insert sequence (SEQ ID NO:5). In the DNA amplification method, the DNA molecule used as a primer can be any portion derived from the transgenic insert sequence in the transgenic rice event LP126-2, or any portion derived from the DNA region of the flanking rice genome in the transgenic rice event LP126-2.

[0114] The transgenic rice event LP126-2 can be combined with other transgenic rice varieties, such as herbicide-tolerant rice (e.g., glufosinate, dicamba, etc.) or transgenic rice varieties carrying other insect-resistant genes (e.g., resistance to disease, planthoppers, aphids, etc.). Various combinations of all these different transgenic events, bred together with the transgenic rice event LP126-2 of this invention, can provide improved hybrid transgenic rice varieties resistant to multiple pests and tolerant to multiple herbicides. These varieties can exhibit superior characteristics such as increased yield compared to non-transgenic varieties and single-trait transgenic varieties.

[0115] This invention provides a transgenic rice event LP126-2, a method for detecting the nucleic acid sequence of rice plants containing this event, and a transgenic rice event LP126-2 that is resistant to feeding damage from lepidopteran pests and tolerant to the phytotoxic effects of glyphosate-containing agricultural herbicides. This dual-trait rice plant expresses the Cry1Ab, Cry2Ab, and Cry1Fa proteins of Bacillus thuringiensis, which provides resistance to feeding damage from lepidopteran pests (such as the rice stem borer, rice leaf roller, and other major pests in rice-growing areas); and it expresses the glyphosate-resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein of Agrobacterium CP4, which confers glyphosate tolerance to the plant. Attached Figure Description

[0116] Figure 1 This is a schematic diagram of the binding site between the transgenic insertion sequence and the rice genome in the present invention for detecting the nucleic acid sequence of rice plant LP126-2 and its detection method.

[0117] Figure 2 This is a schematic diagram of the recombinant expression vector pLP126 used in the present invention for detecting the nucleic acid sequence of rice plant LP126-2 and its detection method;

[0118] Figure 3 The present invention describes the in vitro resistance effect of transgenic rice containing transgenic rice event LP126-2 against lepidopteran pests.

[0119] Figure 4 The image shows the effect of artificial inoculation of the transgenic rice containing the transgenic rice event LP126-2 in a field of rice stem borer.

[0120] Figure 5 The image shows the effect of artificial inoculation of the transgenic rice containing the transgenic rice event LP126-2 in a field of rice stem borer.

[0121] Figure 6 The image shows the effect of artificial inoculation of the transgenic rice containing the transgenic rice event LP126-2 in a field with the Chinese stem borer.

[0122] Figure 7 The image shows the effect of artificial inoculation of the transgenic rice containing the transgenic rice event LP126-2 in a rice leaf roller field. Detailed Implementation

[0123] The technical solution of the present invention for detecting the nucleic acid sequence of rice plant LP126-2 and its detection method is further illustrated below through specific embodiments.

[0124] Example 1 Cloning and Transformation

[0125] 1.1 Vector Cloning

[0126] The recombinant expression vector pLP126 (e.g.) was constructed using standard gene cloning techniques. Figure 2(As shown). The vector pLP126 contains four tandem transgenic expression cassettes. The first expression cassette consists of the Scrophularia mosaic virus 35S promoter (pFMV), operably linked to the intron of the maize heat shock protein gene HSP70 (iZmHSP), operably linked to maize chloroplast transport peptide 2 (ZmCTP), operably linked to the Bacillus thuringiensis insect resistance Cry2Ab protein (Cry2Ab), and operably linked to the transcription terminator (Nos) of alkaloid synthase. The second expression cassette consists of the maize ubiquitin gene promoter Ubi (pZmUbi) containing a tandem repeat of an enhancer region, operably linked to the Bacillus thuringiensis insect resistance gene Cry1Fa (Cry1Fa), and operably linked to Agrobacterium rhizogenes pTi15955. The first expression cassette consists of the terminator ORF25PolyA; the second expression cassette consists of the cauliflower mosaic virus 35S promoter (p35s), operably linked to the 5' untranslated leading strand sequence (WtCab) of wheat chloroplast a / b binding protein, operably linked to the intron of rice actin gene 1 (iOsAct1), operably linked to the insect resistance Cry1Ab protein (Cry1Ab) of Bacillus thuringiensis, and operably linked to the terminator (In2) of benzenesulfonamide-induced gene 2; the third expression cassette consists of the rice actin 1 promoter (pOsAct1), operably linked to the Arabidopsis chloroplast transport peptide (AtCTP), operably linked to the glyphosate-resistant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) of Agrobacterium CP4 strain, and operably linked to the transcription terminator (Nos) of carmine synthase. The vector pLP126 was transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) using liquid nitrogen, and the transformed cells were screened using 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) as a selectable marker.

[0127] 1.2 Plant Transformation

[0128] Transformation was performed using the conventional Agrobacterium infection method:

[0129] 1. Collect mature grains from Zhonghua 11 rice plants, remove the inner and outer shells, then soak the shelled grains in 75% alcohol for 1 minute, and then disinfect them with 50% sodium hypochlorite for 15-20 minutes.

[0130] 2. Place the sterilized rice grains on the callus induction medium on a clean bench and culture them in the dark at 30°C. The callus induction medium is composed of N6 macro-particles + MS micro-particles + B5 organic + hydrolyzed casein 300 mg / L + inositol 100 mg / L + proline 500 mg / L + sucrose 30 g / L + 2,4-D 1 mg / L.

[0131] 3. After inducing callus for 20-25 days, the induced callus is pre-cultured for later transformation experiments. The pre-culture medium is (N6 macro + MS micro + B5 organic + hydrolyzed casein 300 mg / L + inositol 100 mg / L + proline 500 mg / L + sucrose 30 g / L + 2,4-D 1 mg / L).

[0132] 4. After pre-culture, add Agrobacterium suspension (OD660 = 0.4-0.6) to the vigorous embryogenic callus tissue and soak for 20 min. After infection, place it on sterilized filter paper and blow dry. Then, inoculate the callus onto co-culture medium and incubate in the dark at 22℃ for 2-4 days. The co-culture medium is (N6 macro + MS micro + B5 organic + hydrolyzed casein 300 mg / L + inositol 100 mg / L + proline 500 mg / L + sucrose 30 g / L + 2,4-D 1 mg / L + AS 100 μmol).

[0133] 5. After co-culture, perform recovery culture for 7-10 days. Recovery medium (N6 macro-level + MS micro-level + B5 organic + hydrolyzed casein 300 mg / L + inositol 100 mg / L + proline 500 mg / L + sucrose 30 g / L + 2,4-D 1 mg / L + cephalosporin 500 mg / L).

[0134] 6. Transfer the recovered callus to selection medium and incubate in the dark for 4 weeks. Selection medium (N6 macro-level + MS micro-level + B5 organic + hydrolyzed casein 300 mg / L + inositol 100 mg / L + proline 500 mg / L + sucrose 30 g / L + 2,4-D 1 mg / L + cephalosporin 500 mg / L + glyphosate 600-1000 mg / L).

[0135] 7. Transfer the selected resistant callus to differentiation medium and culture at 25°C for differentiation. Differentiation medium (MS salt 4.3 g / L + 6-BA 1 mg / L + KT 1 mg / L + NAA 0.25 mg / L).

[0136] 8. Transfer the differentiated seedlings to rooting medium. Rooting medium (MS salt 2.15 g / L, MS vitamins, sucrose 30 g / L + NAA 1 mg / L) is cultured at 25℃ until the plant height reaches about 10 cm, then transferred to a greenhouse for further cultivation.

[0137] 1.3 Identification and Screening of Genetically Modified Organisms

[0138] A total of 1,500 independent transgenic T0 plants were generated. All T0 plants underwent molecular testing (including target gene copy number, insertion location, etc.), target traits (insect resistance and herbicide tolerance), and agronomic trait evaluation. After removing abnormal transformants, LP126-2 was obtained through screening.

[0139] Example 2: Detection of LP126-2 event in transgenic rice using TaqMan

[0140] Approximately 100 mg of leaves from the LP126-2 transgenic rice species was taken as a sample, and genomic DNA was extracted using Qiagen's DNeasy PlantMaxi Kit. The DNA was then detected using Taqman probe-based quantitative PCR. cry1Ab , cry2Ab , cry1Fa and epsps The copy number was determined. Wild-type rice plants (transformation recipients) were used as a control, and the results were analyzed using the same method. The experiment was repeated in triplicate, and the average value was taken.

[0141] The specific method is as follows:

[0142] Step 11: Take 100 mg of leaves from the transgenic rice event LP126-2, grind them into a homogenate in a mortar using liquid nitrogen, and take 3 replicates for each sample;

[0143] Step 12: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. Refer to the product manual for specific methods.

[0144] Step 13: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);

[0145] Step 14: Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μl;

[0146] Step 15: The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and wild-type rice plants (transformation recipients) were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR were as follows:

[0147] The following primers and probes are used for detection. cry1Ab Gene sequence:

[0148] Primer 1: TGGGAGGACGGAATGATATTG, as shown in SEQ ID NO:16 in the sequence listing;

[0149] Primer 2: AACTCGTCCGTGAGCATCATC, as shown in SEQ ID NO:17 in the sequence listing;

[0150] Probe 1: AACTCCGCGCTGCGATGAATCC, as shown in SEQ ID NO:18 in the sequence listing;

[0151] The following primers and probes are used to detect cry2Ab Gene sequence:

[0152] Primer 3: GGACAGAGGCACCGCATT, as shown in SEQ ID NO:19 in the sequence listing;

[0153] Primer 4: CGGGTCTGCAAGCAAACG, as shown in SEQ ID NO:20 in the sequence listing;

[0154] Probe 2: TCCACTTGGCGGTTGAACTCCTCC, as shown in SEQ ID NO:21 in the sequence listing;

[0155] The following primers and probes are used to detect cry1Fa Gene sequence:

[0156] Primer 5: GCTATGTCCAGTCCCCAACCT, as shown in SEQ ID NO:22 in the sequence listing;

[0157] Primer 6: CAAGCTGCTAACCTGCACTTGT, as shown in SEQ ID NO:23 in the sequence listing;

[0158] Probe 3: CCCAAACGACACAGCGTCGCG, as shown in SEQ ID NO:24 in the sequence listing;

[0159] The following primers and probes are used to detect the epsps gene sequence:

[0160] Primer 7: GCAAATCCTCTGGCCTTTCC, as shown in SEQ ID NO:25 in the sequence listing;

[0161] Primer 8: TGAAGGACCGGTGGGAGAT, as shown in SEQ ID NO:26 in the sequence listing;

[0162] Probe 4: CGTCCGCATTCCCGGCGA, as shown in SEQ ID NO:27 in the sequence listing;

[0163] The PCR reaction system is

[0164]

[0165] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and is stored in amber tubes at 4°C.

[0166] PCR reaction conditions are

[0167]

[0168] Data were analyzed using SDS2.3 (Applied Biosystems) software to obtain the single-copy transgenic rice event LP126-2.

[0169] Example 3: Detection of LP126-2 event in transgenic rice

[0170] 3.1 Genomic DNA Extraction

[0171] DNA extraction was performed using the conventional CTAB (hexadecyltrimethylammonium bromide) method: 2 grams of young transgenic rice leaves from the LP126-2 event were ground into powder in liquid nitrogen, and then 0.5 mL of DNA extraction CTAB Buffer [20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM...] was added. EDTA (ethylenediaminetetraacetic acid) was added, and the pH was adjusted to 8.0 with NaOH. After thorough mixing, the mixture was extracted at 65°C for 90 min. 0.5 volumes of phenol and chloroform were added, and the mixture was inverted and mixed. The mixture was centrifuged at 12,000 rpm for 10 min. The supernatant was collected, and 1 volume of isopropanol was added. The centrifuge tube was gently shaken and incubated at -20°C for 30 min. The mixture was then centrifuged again at 12,000 rpm for 10 min. The DNA was collected at the bottom of the tube. The supernatant was discarded, and the precipitate was washed with 0.5 mL of 70% ethanol. The mixture was centrifuged at 12,000 rpm for 5 min. The precipitate was vacuum dried or air-dried in a clean bench. The DNA precipitate was dissolved in an appropriate amount of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and stored at -20°C.

[0172] 3.2 Analysis of flanking DNA sequences

[0173] The concentration of the extracted DNA samples was determined to be between 80-100 ng / μL. The selected restriction endonuclease was then used. Spe I, Pst I, Bss HII (5' end analysis) and Sac I, Kpn I, Xma I, Nhe I (3' end analysis) Genomic DNA was digested separately. 26.5 μL of genomic DNA, 0.5 μL of the selected restriction endonuclease, and 3 μL of digestion buffer were added to each digestion system. Digestion was performed at an appropriate temperature for 1 hour. After digestion, 70 μL of anhydrous ethanol was added to the digestion system, the mixture was incubated on ice for 30 min, centrifuged at 12000 rpm for 7 min, the supernatant was discarded, and the mixture was dried. Then, 8.5 μL of double-distilled water (ddH2O), 1 μL of 10× T4 buffer, and 0.5 μL of T4 ligase were added, and ligation was performed overnight at 4°C. PCR amplification was performed using a series of nested primers to separate 5' and 3' transgenic / genomic DNA. Specifically, the primer combination for separating 5' transgenic / genomic DNA included SEQ ID NO:13 and SEQ ID NO:34 as the first primer, SEQ ID NO:35 and SEQ ID NO:36 as the second primer, and SEQ ID NO:13 as the sequencing primer. The primer combination for isolating 3' transgenic / genomic DNA included SEQ ID NO:15 and SEQ ID NO:37 as the first primer, SEQ ID NO:38 and SEQ ID NO:39 as the second primer, and SEQ ID NO:15 as the sequencing primer. The PCR reaction conditions are shown in Table 3.

[0174] The obtained amplicon was electrophoresed on a 2.0% agarose gel to separate the PCR reaction products, and the target fragment was then isolated from the agarose matrix using the QIAquickGel Extraction Kit (catalog #28704, Qiagen Inc., Valencia, CA). The purified PCR products were then sequenced (e.g., ABI Prism™ 377, PE Biosystems, Foster City, CA) and analyzed (e.g., DNASTAR Sequencing Software, DNASTAR Inc., Madison, WI).

[0175] The 5' and 3' flanking and junction sequences were confirmed using standard PCR methods. The 5' flanking and junction sequences can be confirmed using SEQ ID NO:8 or SEQ ID NO:12, in combination with SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:34. The 3' flanking and junction sequences can be confirmed using SEQ ID NO:11 or SEQ ID NO:14, in combination with SEQ ID NO:10, SEQ ID NO:15, or SEQ ID NO:37. The PCR reaction system and amplification conditions are shown in Tables 3 and 4. Those skilled in the art will understand that other primer sequences can also be used to confirm the flanking and junction sequences.

[0176] DNA sequencing of PCR products provides DNA that can be used to design other DNA molecules, which can be used as primers and probes for the identification of rice plants or seeds derived from the transgenic rice event LP126-2.

[0177] Nucleotide positions 1-309 of SEQ ID NO:5 show the right flanking (5' flanking sequence) of the rice genome sequence in the transgenic rice event LP126-2, and nucleotide positions 16458-17257 of SEQ ID NO:5 show the left flanking (3' flanking sequence) of the rice genome sequence in the transgenic rice event LP126-2. The 5' conjugation sequence is listed in SEQ ID NO:1, and the 3' conjugation sequence is listed in SEQ ID NO:2.

[0178] 3.3 PCR Conjugation Assay

[0179] The conjugation sequence is a relatively short polynucleotide molecule that is a novel DNA sequence that, when detected in polynucleotide assays, is diagnostic for the DNA of transgenic rice event LP126-2. The conjugation sequence of SEQ ID NO:1 comprises 11 bp on each side of the T-DNA RB region insertion site of transgenic rice event LP126-2 and the rice genomic DNA insertion site. The conjugation sequence of SEQ ID NO:2 comprises 11 bp on each side of the T-DNA LB region insertion site of transgenic rice event LP126-2 and the rice genomic DNA insertion site. Longer or shorter polynucleotide conjugation sequences can be selected from SEQ ID NO:3 or SEQ ID NO:4. The conjugation sequences (5' conjugate region SEQ ID NO:1 and 3' conjugate region SEQ ID NO:2) are useful as DNA probes or as DNA primer molecules in DNA detection methods. The conjugation sequences SEQ ID NO:6 and SEQ ID NO:7 are also novel DNA sequences from the transgenic rice event LP126-2, and can be used as DNA probes or DNA primers to detect the presence of the transgenic rice event LP126-2 DNA. SEQ ID NO:6 (nucleotides 310-795 of SEQ ID NO:3) spans the LP126 construct DNA sequence and the Nos transcription termination sequence, and SEQ ID NO:7 (nucleotides 1-260 of SEQ ID NO:4) spans the Nos transcription termination sequence and the LP126 construct DNA sequence.

[0180] In addition, amplicon is generated by using primers from at least one of SEQ ID NO:3 or SEQ ID NO:4, which, when used in a PCR method, produce diagnostic amplicon for transgenic rice event LP126-2.

[0181] Specifically, a PCR product is generated from the 5' end of the transgenic insertion sequence. This PCR product comprises a portion of genomic DNA flanking the 5' end of the T-DNA insertion sequence in the genome of plant material derived from the transgenic rice event LP126-2. This PCR product contains SEQ ID NO:3. For PCR amplification, primer 11 (SEQ ID NO:8) is designed to hybridize with the genomic DNA sequence flanking the 5' end of the transgenic insertion sequence, and primer 12 (SEQ ID NO:9) is paired with it at the transgenic Nos transcription termination sequence.

[0182] A PCR product was generated from the 3' end of the transgenic insert sequence. This PCR product contained a portion of genomic DNA flanking the 3' end of the T-DNA insert sequence from the genome of plant material derived from the transgenic rice event LP126-2. This PCR product contained SEQ ID NO:4. For PCR amplification, primer 14 (SEQ ID NO:11) was designed to hybridize with the genomic DNA sequence flanking the 3' end of the transgenic insert sequence, and primer 13 (SEQ ID NO:10) was designed to pair with it with the tNos transcription termination sequence located at the 3' end of the insert.

[0183] The DNA amplification conditions described in Tables 3 and 4 can be used for the above-described PCR conjugation assays to generate diagnostic amplicones for the transgenic rice event LP126-2. Amplicon detection can be performed using a thermal cycler such as a Stratagene Robocycle, MJEngine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient, or by methods and equipment known to those skilled in the art.

[0184] Table 3. PCR steps and reaction mixture conditions for identifying the 5' transgenic insert / genome conjugation region of transgenic rice event LP126-2.

[0185]

[0186] Table 4. Conditions for the Perkin-Elmer 9700 Thermal Cyclist

[0187]

[0188] Mix gently. If the thermal cycler does not have an insulation cap, add 1-2 drops of mineral oil above each reaction mixture. Perform PCR using the above cycling parameters (Table 4) on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. For the Perkin-Elmer 9700 thermal cycler, set the ramp speed to its maximum value.

[0189] The experimental results showed that primers 11 and 12 (SEQ ID NO: 8 and 9) produced a 795 bp amplified fragment when used in the PCR reaction of transgenic rice event LP126-2 genomic DNA, but no fragment was amplified when used in the PCR reaction of untransformed rice genomic DNA and non-LP126-2 rice genomic DNA; primers 13 and 14 (SEQ ID NO: 10 and 11) produced a 1060 bp amplified fragment when used in the PCR reaction of transgenic rice event LP126-2 genomic DNA, but no fragment was amplified when used in the PCR reaction of untransformed rice genomic DNA and non-LP126-2 rice genomic DNA.

[0190] PCR conjugation assays can also be used to identify whether materials derived from the transgenic rice event LP126-2 are homozygous or heterozygous. Primers 15 (SEQ ID NO:12), 16 (SEQ ID NO:13), and 17 (SEQ ID NO:14), or primers 16 (SEQ ID NO:13), 17 (SEQ ID NO:14), and 18 (SEQ ID NO:15) are used in the amplification reaction to generate diagnostic amplicones for the transgenic rice event LP126-2. The DNA amplification conditions described in Tables 5 and 6 can be used for the above conjugation assays to generate diagnostic amplicones for the transgenic rice event LP126-2.

[0191] Table 5. Reaction solution for bonding test

[0192]

[0193] Table 6. Conditions for bonding determination using the Perkin-Elmer 9700 thermal cycler.

[0194]

[0195] PCR was performed using the cycling parameters (Table 6) on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. The ramp speed should be set to its maximum value when using the Perkin-Elmer 9700 thermal cycler.

[0196] In the amplification reaction, the biological sample containing template DNA contains DNA that diagnoses the presence of the transgenic rice event LP126-2 in the sample. Alternatively, the reaction will generate two distinct DNA amplicones from a biological sample containing DNA derived from the rice genome, wherein the DNA derived from the rice genome is heterozygous relative to the allele corresponding to the inserted DNA present in the transgenic rice event LP126-2. These two distinct amplicones will correspond to a first amplicon derived from a wild-type rice genomic locus and a second amplicon diagnosing the presence of the transgenic rice event LP126-2 DNA. A rice DNA sample that produces only a single amplicon corresponding to the second amplicon described for a heterozygous genome can diagnose the presence of the transgenic rice event LP126-2 in the sample, and this sample is produced from rice seeds that are homozygous relative to the allele corresponding to the inserted DNA present in the transgenic rice plant LP126-2.

[0197] It should be noted that the primer pairs for the transgenic rice event LP126-2 were used to generate diagnostic amplicones for the genomic DNA of the transgenic rice event LP126-2. These primer pairs include, but are not limited to, primers 11 and 12 (SEQ ID NO: 8 and 9), and primers 13 and 14 (SEQ ID NO: 10 and 11), used in the DNA amplification method described above. Additionally, a control primer set 9 and 10 (SEQ ID NO: 28 and SEQ ID NO: 29) for amplifying endogenous rice genes is included as an intrinsic standard for the reaction conditions. Analysis of DNA extracts from the transgenic rice event LP126-2 should include a positive tissue DNA extract control from the transgenic rice event LP126-2, a negative DNA extract control from a non-transgenic rice event LP126-2, and a negative control without template rice DNA. In addition to these primer pairs, any primer pairs from SEQ ID NO:3 or SEQ ID NO:4, or their complementary sequences, can be used to generate, when used in a DNA amplification reaction, amplicon containing SEQ ID NO:1 or SEQ ID NO:2 that is diagnostic for tissues derived from the transgenic rice plant LP126-2. The DNA amplification conditions described in Tables 3-6 can be used to generate diagnostic amplicones for the transgenic rice event LP126-2 using appropriate primer pairs. Extracts of rice plant or seed DNA presumed to contain the transgenic rice event LP126-2, or products derived from the transgenic rice event LP126-2, that produce diagnostic amplicones for the transgenic rice event LP126-2 when tested in DNA amplification methods, can be used as templates for amplification to determine the presence of the transgenic rice event LP126-2.

[0198] Example 4: Detection of LP126-2 event in transgenic rice using Southern blot hybridization

[0199] 4.1 DNA Extraction for Southern Blot Hybridization

[0200] Southern blot analysis was performed using homozygous transformation events at generations T4 and T5. Approximately 5–10 g of plant tissue was ground in liquid nitrogen using a mortar and pestle. The plant tissue was resuspended in 12.5 mL of extraction buffer A (0.2 M Tris pH=8.0, 50 mM EDTA, 0.25 M NaCl, 0.1% v / v β-mercaptoethanol, 2.5% w / v polyvinylpyrrolidone) and centrifuged at 4000 rpm for 10 min (2755 g). After discarding the supernatant, the precipitate was resuspended in 2.5 mL of extraction buffer B (0.2 M Tris pH=8.0, 50 mM EDTA, 0.5 M NaCl, 1% v / v β-mercaptoethanol, 2.5% w / v polyvinylpyrrolidone, 3% sarcosyl, 20% ethanol) and incubated at 37 °C for 30 min. During incubation, the sample was mixed once with a sterile loop. After incubation, add an equal volume of chloroform / isoamyl alcohol (24:1), gently mix by inversion, and centrifuge at 4000 rpm for 20 minutes. Collect the aqueous layer and centrifuge at 4000 rpm for 5 minutes after adding 0.54 volumes of isopropanol to precipitate DNA. Discard the supernatant and resuspend the DNA precipitate in 500 μL TE. To degrade any RNA present, incubate DNA and 1 μL of 30 mg / mL RNAase A at 37°C for 30 minutes, centrifuge at 4000 rpm for 5 minutes, and precipitate DNA by centrifugation at 14000 rpm for 10 minutes in the presence of 0.5 volumes of 7.5 M ammonium acetate and 0.54 volumes of isopropanol. Discard the supernatant, wash the precipitate with 500 μL of 70% ethanol, and resuspend it in 100 μL TE after drying.

[0201] 4.2 Restriction enzyme digestion

[0202] DNA concentration was quantitatively detected using a spectrophotometer or fluorometer (using 1×TAE and GelRED dye). 5 μg of DNA was digested in a 100 μL reaction system each time. Restriction endonucleases were used. Avr II and Hin dIII digests genomic DNA separately, using partial sequences of Cry2Ab and EPSPS on T-DNA as probes; restriction endonucleases are then used. Avr II and Hin dIII was used to digest genomic DNA separately, using partial sequences of Cry1Ab and Cry1Fa on T-DNA as probes. For each enzyme, the digest was incubated overnight at an appropriate temperature. The sample was then spun using a speed vacuum centrifuge to reduce the volume to 30 μL.

[0203] 4.3 Gel electrophoresis

[0204] Add bromophenol blue loading dye to each sample derived from Example 4.2 and load each sample onto a 0.7% agarose gel containing ethidium bromide. Separate the samples by electrophoresis in TBE electrophoresis buffer and incubate the gel overnight at 20 volts.

[0205] Wash the gel in 0.25M HCl for 15 minutes to depurify the DNA, then wash with water. Set up Southern blotting hybridization as follows: Place 20 thick sheets of dry blotting paper in a dish, then place 4 thin sheets of dry blotting paper on top. Pre-wet one sheet of thin blotting paper in 0.4M NaOH and place it on top of the stack, followed by a Hybond-N+ transfer membrane (Amersham Pharmacia Biotech, #RPN303B) pre-wetted in 0.4M NaOH. Place the gel on top, ensuring there are no air bubbles between the gel and the membrane. Place 3 additional pre-soaked blotting papers on top of the gel, and fill the buffer dish with 0.4M NaOH. Connect the gel stack and the buffer dish with a wick pre-soaked in 0.4M NaOH to transfer the DNA onto the membrane. Perform DNA transfer at room temperature for approximately 4 hours. After transfer, rinse the Hybond membrane in 2×SSC for 10 seconds; the DNA binds to the membrane via UV cross-linking.

[0206] 4.4 Hybridization

[0207] Suitable DNA sequences were amplified by PCR for probe preparation. The DNA probes were SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33, or sequences homologous to or complementary to these sequences. 25 ng of probe DNA was boiled in 45 μL TE for 5 minutes, placed on ice for 7 minutes, and then transferred to a Redimone II (Amersham Pharmacia Biotech, #RPN1633) tube. 5 μL of 32P-labeled dCTP was added to the Redimone tube, and the probe was incubated at 37°C for 15 minutes. The probe was purified by centrifugation using a G-50 microcentrifuge column (Amersham Pharmacia Biotech, #27-5330-01) to remove unincorporated dNTPs, according to the manufacturer's instructions. Probe activity was measured using a scintillation counter. The Hybond membrane was prehybridized by wetting it for 30 minutes at 65°C with 20 mL of preheated Church prehybridization buffer (500 mM Na3PO4, 1 mM EDTA, 7% SDS, 1% BSA). The labeled probe was boiled for 5 minutes and then placed on ice for 10 minutes. An appropriate amount of probe was added to the prehybridization buffer (1 million counts per 1 mL of prehybridization buffer), and hybridization was performed overnight at 65°C. The next day, the hybridization buffer was discarded, and the membrane was washed with 20 mL of Church wash solution 1 (40 mM Na3PO4, 1 mM EDTA, 5% SDS, 0.5% BSA), followed by washing in 150 mL of Church wash solution 1 at 65°C for 20 minutes. This process was repeated twice with Church wash solution 2 (40 mM Na3PO4, 1 mM EDTA, 1% SDS). The membrane was then exposed to a phosphor screen or X-ray film to detect the probe binding sites.

[0208] Each Southern sample includes two control samples: (1) DNA from negative (untransformed) isolates, used to identify any endogenous rice sequence that can hybridize with the element-specific probe; and (2) DNA from positive isolates, in which the element-specific probe has been introduced. Hin The amount of dIII-digested pLP126, based on the probe length equivalent to one copy number, is used to illustrate the sensitivity of the experiment when detecting single gene copies within the rice genome.

[0209] Hybridization data provided confirmatory evidence supporting TaqMan. TM PCR analysis showed that LP126-2 of rice plants contains... cry2Ab , cry1Fa , cry1Ab and epsps A single copy of the gene. Using this Cry2Ab probe, Hin dIII and Avr Enzymatic digestion II produced single bands of approximately 6.13 kb and 20.14 kb in size, respectively; using the Cry1Fa probe, Hin dIII and Avr Enzymatic digestion II produced single bands of approximately 17.5 kb and 20.14 kb in size, respectively; using the Cry1Ab probe, Hin dIII and Avr Enzymatic digestion II produced single bands of approximately 17.5 kb and 14.4 kb in size, respectively; using this EPSPS probe, Hin dIII and Avr Enzymatic digestion II produced single bands of approximately 17.5 kb and 14.4 kb in size, respectively. This indicates that one copy each of Cry1Ab, Cry2Ab, Cry1Fa, and EPSPS exists in the rice transformation event LP126-2.

[0210] Example 5 Insect resistance detection

[0211] 5.1 In vitro bioassay of rice plant LP126-2

[0212] Two rice plants, LP126-2 (a transgenic rice species) and wild-type rice (non-transgenic, transformation recipient control (CK-)), were used to treat rice stem borer (a disease caused by the rice stem borer). Chilo suppressalis ), rice stem borer ( Tryporyza incertulas), giant borer ( Sesamia inferens ), rice leaf roller ( Cnaphalocrocis medinalis Guenee). Bioassays were performed as follows:

[0213] Fresh leaves (V3-V4 stage) from two rice plants, LP126-2 (a transgenic rice event) and wild-type rice (non-transgenic, transformation recipient control (CK-)), were taken, rinsed with sterile water, and dried with absorbent paper. The leaves were then cut into strips approximately 1cm × 3cm in size. One to three strips (the number determined by insect feeding habits) were placed on filter paper at the bottom of a round plastic culture dish, moistened with distilled water. One artificially reared second-instar larva was introduced into each dish. After covering the culture dishes, they were placed under conditions of 26-28℃, 70%-80% relative humidity, and a photoperiod (light / dark) of 16:8 for 5 days. The results were then statistically analyzed. The mortality rate (mortality rate = (number of dead insects / number of tested insects) × 100%) was used to identify the level of resistance. The results are shown in Table 7. Figure 3 As shown in the figure. In vitro insect resistance bioassay results indicate that the transgenic rice event LP126-2 exhibits good resistance to rice stem borer, rice leaf roller, rice stem borer, and rice leaf folder.

[0214] Table 7. Results of in vitro insect resistance bioassay for transgenic rice LP126-2 - Mortality rate (%)

[0215]

[0216] 5.2 Field Insect Resistance Determination of LP126-2 Genetically Modified Rice

[0217] (1) Borer borer

[0218] The resistance of transgenic rice LP126-2 to the main target pest, the rice stem borer, was determined using a live inoculation method. Inoculation was conducted during the peak tillering stage of rice, with 10 newly hatched rice stem borer larvae inoculated per plant at the ligule (the area between the stem and the leaf sheath of the second or third leaf). Before inoculation, other insect eggs and natural enemies were removed to ensure the accuracy of the experiment. After inoculation, the plant was covered with an 80-mesh net. Thirty days after inoculation (when the number of dead heart seedlings ceased to increase), the condition of dead heart was investigated for each material, and the larval mortality rate, dead heart rate, and dead heart index were calculated. Specifically, the occurrence of the rice stem borer was investigated at each site. A parallel-line skipping method was used, with 6 points (5 plants per point) investigated in each plot. Record the number of tillers, dead sheaths, dead hearts, panicles, white panicles, and the number of rice stem borer larvae and pupae for each rice plant. Calculate the dead heart index using the following formula: Dead heart index = Dead heart rate of positive test material / Dead heart rate of the transformation recipient control variety × 100, where the dead heart rate is the number of dead heart plants in the test material / total number of plants. White panicle index = Number of white panicles in the test material / Total number of panicles in the test plant × 100. Based on the dead heart index of the rice stem borer at the tillering stage or the white panicle index at the panicle stage, and using the resistance evaluation criteria in Table 8, the resistance identification results for the transgenic rice event LP126-1 are shown in Table 9. From Table 9 and... Figure 4 It can be seen that when the rice stem borer was infested during the peak tillering stage, the dead heart index of the transgenic rice event LP126-2 was 0, indicating that the transgenic rice event LP126-2 has good resistance to the rice stem borer.

[0219] Table 8. Evaluation criteria for rice resistance to rice stem borer

[0220]

[0221] Table 9. Resistance results of transgenic rice LP126-2 to rice stem borer

[0222]

[0223] (2) Rice stem borer

[0224] The resistance of transgenic rice LP126-2 to the main target pest, the rice stem borer, was determined using a live inoculation method with inoculated egg masses. Inoculation was conducted during the peak tillering stage of rice, with approximately 70 egg masses inoculated per plant at the ligule (the area between the stem and the second or third leaf sheath). Before inoculation, other insect eggs and natural enemies were removed to ensure the accuracy of the experiment. After inoculation, the plant was covered with an 80-mesh net. Thirty days after inoculation (when the number of dead heart seedlings ceased to increase), the condition of dead heart was investigated for each material, and the dead heart rate and dead heart index were calculated. Specifically, the occurrence of the rice stem borer was investigated at each site. A parallel-line skipping method was used, with 6 points and 5 plants per point in each plot. Record the number of tillers, dead sheaths, dead hearts, panicles, white panicles, and the number of rice stem borer larvae and pupae for each rice plant. Calculate the dead heart index using the following formula: Dead Heart Index = Dead Heart Rate of Positive Test Material / Dead Heart Rate of Transformation Recipient Control Variety × 100. Where the dead heart rate is the number of dead-hearted plants in the test material / total number of plants. White Panicle Index = Number of White Panicles in the Test Material / Total Number of Panicles in the Test Plant × 100. Based on the dead heart index of the rice stem borer during the tillering stage or the white panicle index during the panicle stage, and using the resistance evaluation criteria in Table 10, the resistance identification results for the transgenic rice event LP126-1 are shown in Table 11. From Table 11 and... Figure 5 It can be seen that when the rice stem borer was infested during the peak tillering stage, the dead heart index of the transgenic rice event LP126-2 was 0, indicating that the transgenic rice event LP126-2 has good resistance to the rice stem borer.

[0225] Table 10. Evaluation criteria for rice resistance to rice stem borer

[0226]

[0227] Table 11. Resistance results of transgenic rice LP126-2 to rice stem borer

[0228]

[0229] (3) Large borer

[0230] The resistance of transgenic rice LP126-2 to the main target pest, the rice stem borer, was determined using a live inoculation method. Inoculation was conducted during the peak tillering stage of rice, with 20 newly hatched stem borer larvae inoculated per plant at the ligule (the area between the stem and the leaf sheath of the second or third leaf). Before inoculation, other insect eggs and natural enemies were removed to ensure the accuracy of the experiment. After inoculation, the plant was covered with an 80-mesh net. Thirty days after inoculation (when the number of dead heart seedlings ceased to increase), the condition of dead heart was investigated for each material, and the larval mortality rate, dead heart rate, and dead heart index were calculated. Specifically, the occurrence of the stem borer was investigated at each site. A parallel-line skipping method was used, with 6 points (5 plants per point) investigated in each plot. The number of tillers, dead sheaths, dead hearts, panicles, white panicles, and stem borer larvae and pupae were recorded for each rice plant. The resistance evaluation results for the transgenic rice event LP126-1 were shown in Table 13, based on the stem borer dead heart index during the tillering stage or the white panicle index during the panicle stage, using the resistance evaluation criteria in Table 12. From Table 13 and... Figure 6 It can be seen that when the rice was infested with the stem borer during the peak tillering stage, the dead heart index of the transgenic rice event LP126-2 was 0, indicating that the transgenic rice event LP126-2 has good resistance to the stem borer.

[0231] Table 12. Evaluation criteria for rice resistance to rice stem borer

[0232]

[0233] Table 13. Resistance results of transgenic rice LP126-2 to the rice stem borer.

[0234]

[0235] (4) Rice leaf roller

[0236] The resistance of transgenic rice event LP126-2 to the rice leaf folder, a major target pest in the field, was determined using a live inoculation method. Inoculation was conducted during the peak tillering stage of rice, with 20 newly hatched rice leaf folder larvae inoculated per plant at the ligule (the area between the stem and the leaf sheath of the second or third leaf). Before inoculation, other insect eggs and natural enemies were removed to ensure the accuracy of the experiment. After inoculation, the plant was covered with an 80-mesh net. Thirty days after inoculation (when the number of dead heart seedlings ceased to increase), the condition of dead heart was investigated for each material, and the larval mortality rate, dead heart rate, and dead heart index were calculated. Specifically, the occurrence of rice leaf folder was investigated at each site using a parallel-line skipping method, with 6 points (5 plants per point) surveyed in each plot. Record the number of tillers, dead sheaths, dead hearts, panicles, white panicles, rice leaf roller larvae, and pupae for each rice plant. Calculate the dead heart index using the following formula: Dead heart index = Dead heart rate of positive test material / Dead heart rate of the transformation recipient control variety × 100. Where the dead heart rate is the number of dead heart plants in the test material / total number of plants. White panicle index = Number of white panicles in the test material / Total number of panicles in the test plant × 100. Based on the dead heart index of rice leaf roller at the tillering stage or the white panicle index at the panicle stage, and using the resistance evaluation criteria in Table 14, the resistance identification results for the transgenic rice event LP126-1 are shown in Table 15. From Table 15 and... Figure 7 It can be seen that when rice leaf folder was infested during the peak tillering stage, the dead heart index of the transgenic rice event LP126-2 was 0, indicating that the transgenic rice event LP126-2 has good resistance to rice leaf folder.

[0237] Table 14. Evaluation criteria for rice resistance to rice leaf folder

[0238]

[0239] Table 15. Resistance results of transgenic rice LP126-2 to rice leaf folder

[0240]

[0241] Example 6 Herbicide tolerance test of rice transformation events

[0242] This experiment used Roundup herbicide (41% glyphosate isopropylammonium salt solution) for spraying. A randomized block design was employed with three replicates. The plot area was 15m². 2(5m × 3m), row spacing 60cm, plant spacing 20cm, conventional cultivation management, with a 1.5m wide isolation strip between plots. Transgenic rice LP126-2 and wild-type rice plants (non-transgenic, transformation recipient control (CK-)) were treated with the following two methods: 1) spraying with water; 2) spraying Roundup herbicide at a dose of 3360 g ae / ha (4 times the recommended dose) at the V3 leaf stage, followed by a second spraying of Roundup herbicide at the early tillering stage at the same dose. It should be noted that different contents and formulations of glyphosate herbicides, when converted to an equivalent amount of glyphosate acid, are applicable to the following conclusions. Symptoms of herbicide damage were investigated 1 week and 2 weeks after application, and plot yields were measured at harvest. The grading criteria for herbicide damage symptoms are shown in Table 17. Herbicide damage rate was used as an evaluation index to assess herbicide tolerance in the transformation event. Specifically, the herbicide damage rate (%) = ∑(number of affected plants of the same level × number of levels) / (total number of plants × highest level) × 100; where the herbicide damage rate refers to the glyphosate damage rate, which was determined based on the herbicide damage survey results two weeks after glyphosate treatment. Rice yield in each plot was measured by the total yield (weight) of the middle three rows of rice grains in each plot. The yield difference between different treatments was measured as a percentage of yield, calculated as: yield percentage (%) = glyphosate spray yield / water spray yield × 100. The results of herbicide tolerance and rice yield of the transgenic rice event LP126-2 are shown in Table 18.

[0243] Table 17. Grading Standards for the Severity of Glyphosate Herbicide Damage to Rice

[0244]

[0245] Table 18. Results of glyphosate herbicide tolerance and rice yield of transgenic rice event LP126-2

[0246]

[0247] The results showed that, regarding the herbicide (glyphosate) damage rate: 1) the damage rate of transgenic rice event LP126-2 under glyphosate herbicide (3360 g ae / ha) treatment was basically 0, thus, transgenic rice event LP126-2 has good glyphosate herbicide tolerance.

[0248] In terms of yield: there was no significant difference in yield between the two treatments of spraying with water and spraying with 3360 g ae / ha glyphosate. After spraying with glyphosate herbicide, the yield of LP126-2 was slightly higher than that of the water-spraying group, which further indicates that LP126-2 has good glyphosate herbicide tolerance.

[0249] In summary, through TaqMan TM Analysis (see Example 2) detected the presence of transgenic rice plants in the regenerated plants. cry1Ab, cry2Ab, cry1Fa and epsps The gene was identified, and the copy number of insect resistance and glyphosate herbicide tolerance lines was characterized. Based on the copy number of the target gene, good insect resistance, glyphosate herbicide tolerance, and agronomic traits (see Examples 5 and 6), the event LP126-2 was selected as superior through screening, possessing a single-copy transgene, good insect resistance, glyphosate herbicide tolerance, and excellent agronomic traits.

Claims

1. A nucleic acid molecule, characterized in that, The sequence of the nucleic acid molecule is shown in SEQ ID NO:5 or its complementary sequence. The nucleic acid molecule is derived from the transgenic rice event LP126-2. The rice seeds of the transgenic rice event LP126-2 have been deposited at the China Center for Type Culture Collection with the accession number CCTCC NO:P202318.

2. A DNA primer pair comprising a first primer and a second primer, characterized in that, When the first primer and the second primer are used together with DNA containing rice event LP126-2 in an amplification reaction, an amplicon for detecting rice event LP126-2 in the sample is generated. The first primer is selected from SEQ ID NO:8 or SEQ ID NO:12, and the second primer is selected from SEQ ID NO:9 or SEQ ID NO:13; or the first primer is selected from SEQ ID NO:10 or SEQ ID NO:15, and the second primer is selected from SEQ ID NO:11 or SEQ ID NO:14; rice seeds containing rice event LP126-2 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202318.

3. A method for detecting the presence of DNA from the transgenic rice event LP126-2 in a sample, characterized in that, include: (1) The sample to be tested is brought into contact with the DNA primer pair described in claim 2 during a nucleic acid amplification reaction; (2) Perform nucleic acid amplification reaction; (3) Detect the presence of amplification products; The amplification product includes a nucleic acid sequence of SEQ ID NO:5 or its complementary sequence, indicating that the test sample contains DNA of the transgenic rice event LP126-2; rice seeds containing rice event LP126-2 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202318.

4. A DNA detection kit, characterized in that, include: The DNA primer pair as described in claim 2.

5. A method for protecting rice plants from insect infestation, characterized in that, The invention includes providing at least one transgenic rice plant cell in the diet of target insects, the genome of which contains the sequence shown in SEQ ID NO:5, and the target insects that feed on the transgenic rice plant cell are inhibited from further feeding on the transgenic rice plant; the seeds of the transgenic rice plant have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202318.

6. A method for protecting rice plants from damage caused by herbicides, characterized in that, At least one transgenic rice plant, the genome of which contains the sequence shown in SEQ ID NO:5, is planted and an effective dose of glyphosate herbicide is applied; the seeds of the transgenic rice plant have been deposited at the China Center for Type Culture Collection with the accession number CCTCC NO:P202318.

7. A method for controlling weeds in rice paddies, characterized in that, This includes applying an effective dose of glyphosate herbicide to a field where at least one transgenic rice plant is planted, the genome of which contains the sequence shown in SEQ ID NO:5; the seeds of the transgenic rice plant have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202318.

Images