Rubber grass lactation tube specificity expression promoter pTkREF and expression vector and application thereof

Abstract

The present application provides a rubber grass lactiferous specific expression promoter pTkREF and an expression vector and application thereof. The present application also provides an expression cassette and a recombinant expression vector containing the promoter. Specifically, the promoter pTkREF provided by the present application can specifically drive the expression of an exogenous gene in rubber grass lactiferous, and the expression amount in leaves, flowers, flower stalks and roots is extremely low. Through the genetic modification of rubber grass by the promoter, the molecular mechanism of the lactiferous structure development and the rubber production regulation pathway of rubber grass can be revealed, and the promoter can be widely applied in plant genetic engineering research, so that the lactiferous specific expression gene can be efficiently expressed in the lactiferous, the gene function can be explored, and the rubber production content of rubber grass can be improved.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and more specifically, relates to a rubber grass latex duct-specific expression promoter pTkREF, its expression vector, and its applications. Background Technology

[0002] Natural rubber is an important industrial raw material, produced and stored in specialized "latex duct" structures. The biosynthesis of natural rubber in latex duct cells is a complex process regulated by multiple genes. Therefore, elucidating the functions of genes and proteins in rubber synthesis is crucial for understanding its molecular mechanisms.

[0003] Currently, plant transgenic technology is an important means of verifying gene function or improving the traits of agronomic products. Promoters, as crucial elements of gene regulation, determine the expression intensity and tissue characteristics of downstream genes. RNA polymerase II recognizes and binds to transcription start sites, regulating gene transcription. In plant genetic engineering, the introduction of exogenous genes can enhance a specific desirable trait in plants. Therefore, selecting a suitable promoter is crucial for ensuring the stable and efficient expression of exogenous genes within plants.

[0004] Promoters mainly include constitutive promoters, inducible promoters, and tissue-specific promoters. The constitutive promoter Cauliflower mosaic virus (CaMV) 35S is one of the most widely used constitutive promoters in dicotyledonous plants, which can initiate gene expression in various tissues and cells of the plant [1]. The Ubiquitin promoter is also common in monocotyledonous plants [2]. Inducible promoters have very low or no activity under the natural growth state of the plant. However, when stimulated by adverse conditions such as drought, pests, and ion concentration, the transcriptional activity of the promoter is significantly increased, initiating the expression of some stress-resistant genes to cope with stress. Compared with constitutive promoters, the activity of inducible promoters is regulated by external signals and generally does not affect the normal growth of plants. However, when some tissue-specific genes are initiated and expressed in various tissues of the plant, it may lead to negative effects such as plant malformation, reduced biomass, or even plant death [3]. To address this issue, researchers utilize tissue-specific promoters to initiate gene expression, ensuring that the target gene is activated and transcribed only in specific plant tissues or organs. This reduces the negative impacts of gene overexpression.

[0005] In the study of the molecular mechanism of natural rubber synthesis, since natural rubber is produced in the plant isoprene / terpenoid secondary metabolic pathway, constitutive expression of rubber synthesis pathway genes throughout the plant will predictably cause physiological metabolic disorders of other important isoprene compounds such as quinones, sterols and plant hormones, affecting plant development [4]. To avoid such problems, the study of latex duct tissue-specific promoters is essential, using latex duct tissue-specific promoters to activate the expression of target genes specifically in latex duct tissues. Currently, there are no reports on the screening and functional verification of latex duct-specific promoters in rubber grass.

[0006] References:[1]Odell JT,Nagy F.,and Chua NHIdentification of DNAsequences required for activity of the cauliflower mosaic virus 35S promoter[J].Nature.1985,313(6005):810-812.

[0007] [2] Alan H. Christensen, Peter H. Quail. Ubiqui tin promoter-based vectors for high-level expression of selectable and / or screenable marker genes in monocotyledonous plants [J]. Pubmed, 1996, 5(3): 213-218.

[0008] [3]Zheng H.-Q.,Lin S.-Z.,Zhang Q.,et al.Isolation and analysis of aTIR-specific promoter from poplar[J].Forestry Studies in China.2007,9(2):95-106

[0009] [4]Fray R.,Wallace A.,Fraser P.,et al.Constitutive expression of afruit phytoene synthase gene in transgenic tomatoes causes dwarfism byredirecting metabolites from the gibberellin pathway[J].The PlantJournal.1995,8:693-701. Summary of the Invention

[0010] To address at least one deficiency or improvement need in the existing technology, this invention provides a rubber grass latex duct-specific promoter pTkREF, its expression vector, and its applications. This helps to reveal the molecular mechanisms of latex duct structure development and latex production regulation pathways in rubber grass, enabling a more detailed understanding of the molecular mechanisms of morphogenesis and cell differentiation in plant embryo development. Furthermore, it can be widely applied in plant genetic engineering research, enabling the latex duct gene to be specifically and efficiently expressed in the latex duct to explore gene function, thereby increasing the latex content of rubber grass and obtaining high-quality rubber grass plants.

[0011] To achieve the above objectives, according to one aspect of the present invention, a rubber grass latex duct-specific expression promoter is provided, characterized in that the gene has one of the following nucleotide sequences:

[0012] (1) Having a DNA sequence as shown in SEQ NO 1;

[0013] (2) A DNA sequence that has more than 70% homology with the DNA sequence defined in (1) and has promoter function;

[0014] (3) A DNA sequence that can hybridize with the DNA sequence in (1) or (2) under highly stringent conditions and has promoter function.

[0015] According to a second aspect of the invention, an expression cassette is also provided, the expression cassette comprising the rubber grass latex-specific expression promoter of claim 1.

[0016] According to a third aspect of the present invention, a recombinant expression vector is also provided, the recombinant expression vector comprising the rubber grass latex duct-specific expression promoter of claim 1, the rubber grass latex duct-specific expression promoter being linked upstream of the gene sequence to be expressed in the vector.

[0017] Preferably, the gene to be expressed includes any one of structural genes, reporter genes, regulatory genes, natural small RNAs, or artificially synthesized small RNAs.

[0018] Preferably, the recombinant vector is pCAMBIA1303-pTkREF::GUS, and the gene to be expressed is the GUS gene.

[0019] According to a fourth aspect of the present invention, the application of the rubber grass latex duct-specific expression promoter as described in claim 1 in the cultivation of transgenic plants, wherein the transgenic plants express exogenous genes by initiating the expression of exogenous genes by the rubber grass latex duct-specific expression promoter.

[0020] Preferably, the application includes:

[0021] Using rubber grass genomic DNA as a template, the rubber grass latex-specific expression promoter described in claim 1 was amplified; the target fragment was recovered and ligated into the pEASY-Blunt vector. Positive clones were verified by double enzyme digestion; the clones with correct verification were the desired promoters. Homologous recombination was used to ligate the promoter fragment upstream of the plant expression vector pCAMBIA1303 GUS reporter gene, resulting in a recombinant expression vector fused with the GUS reporter gene. The plant expression vector was then transformed into Agrobacterium using chemical transformation; finally, the recombinant expression vector was transformed into rubber grass using Agrobacterium-mediated transformation.

[0022] Preferably, the rubber grass latex-specific expression promoter is further connected to a regulatory element that regulates gene expression.

[0023] Preferably, the plant is a dicotyledonous plant.

[0024] Preferably, the dicotyledonous plant is any one of rubber grass, lettuce, or rubber tree.

[0025] In summary, compared with the prior art, the above-described technical solutions conceived by this invention can achieve the following beneficial effects:

[0026] (1) The latex duct-specific expression promoter of rubber grass provided in this embodiment of the invention can significantly improve the specific expression of endogenous or exogenous genes only in the latex ducts of rubber grass, while the expression level in other parts of rubber grass is extremely low. This avoids the impact on plant growth and rubber synthesis caused by the physiological metabolic disorders of other important isoprene-like substances such as quinones and sterols in the plant isoprene / terpenoid secondary metabolic pathway during natural rubber synthesis. It can also change the latex duct structure, increase latex content, or change the molecular weight of natural rubber, thereby improving the rubber content and quality of rubber-producing plants. Given that there are currently no reports on the screening and functional verification of latex duct-specific promoters in rubber grass, the rubber grass latex duct-specific expression promoter successfully screened in this invention has pioneering significance.

[0027] (2) The rubber grass latex duct-specific expression promoter provided in the embodiments of the present invention plays an important role in regulating latex duct development, increasing rubber content, and regulating the latex production pathway in latex-producing plants. It lays the foundation for revealing the latex duct structure development, rubber content accumulation, and latex production regulation pathway in latex-producing plants, and has great application prospects. Attached Figure Description

[0028] Figure 1 This is a schematic diagram of the pTkREF gene in rubber grass transcriptome sequencing provided in this embodiment of the invention;

[0029] Figure 2 This is a tissue-specific expression diagram of the pTkREF gene provided in an embodiment of the present invention;

[0030] Figure 3 This is a schematic diagram of the structure of the recombinant vector pEASY-TkREF provided in an embodiment of the present invention;

[0031] Figure 4 This is an image showing the electrophoretic detection results of the pEASY-TkREF vector constructed according to an embodiment of the present invention;

[0032] Figure 5 This is a schematic diagram of the pCAMBIA1303-pTkREF::GUS expression vector structure provided in an embodiment of the present invention;

[0033] Figure 6 This is an electrophoresis detection result of the pCAMBIA1303-pTkREF::GUS expression vector constructed according to an embodiment of the present invention;

[0034] Figure 7 This is an image showing the results of DNA level electrophoresis detection by T0 generation PCR using the pCAMBIA1303-pTkREF::GUS vector provided in this embodiment of the invention.

[0035] Figure 8 The results are GUS detection results of the T0 generation of the pCAMBIA1303-pTkREF::GUS vector provided in the embodiments of the present invention.

[0036] Figure 9 The results are GUS detection results of the positive control vector (pCAMBIA1303-CaMV35S::GUS) T0 generation provided in the embodiments of the present invention. Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. Furthermore, the technical features involved in the various embodiments of this invention described below can be combined with each other as long as they do not conflict with each other.

[0038] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the biochemical reagents, carriers, and consumables used in the following examples are commercially available products.

[0039] Example 1: Obtaining the rubber grass latex duct-specific promoter (pTkREF)

[0040] 1. RNA extraction and transcriptome sequencing from rubber grass

[0041] Samples from five different parts of the rubber plant during its peak flowering period—roots, latex, leaves, flowers, and flower stalks—were cryopreserved in liquid nitrogen. The liquid nitrogen-preserved samples were then placed in a mortar pre-cooled with liquid nitrogen, and an appropriate amount of liquid nitrogen was added to ensure the mortar remained moist. The samples were ground into powder, and RNA extraction was performed according to the experimental procedures of the QIAGEN RNeasy Plant Mini Kit. The extracted samples were then run on a 1% agarose gel for analysis, requiring no protein contamination (i.e., no obvious bright bands in the wells). Nucleic acid concentration was detected using a NanoDrop Spectrophotometer. The concentration was 411 ng / µl for samples in the logarithmic phase and 227 ng / µl for samples in the stationary phase, meeting the requirements for sequencing with no significant protein contamination and a nucleic acid concentration >60 ng / µl.

[0042] After RNA extraction, Illumina library construction and sequencing were performed.

[0043] 2. Transcriptome analysis and promoter screening

[0044] The raw sequencing data was first processed using Trimmomatic to remove sequencing adapter sequences and filter low-quality sequences. The filtered data was then aligned to the upland cotton reference genome using HiSAT2 software with default settings. The aligned data were then sorted to remove PCR repeats. Sequences with an alignment quality below 25 were further filtered using Samtools. Perl scripts were used to filter sequences aligned to multiple genomic loci. The filtered sequencing results were then used to calculate gene expression levels (FPKM - fragments per kilobase of transcript per million mapped reads) using Stringtie software with default settings. Figure 1 The diagram shows the expression level of the pTkREF gene in the transcriptome sequencing of rubber grass. Figure 2 This is a tissue-specific expression map of the pTkREF gene; from Figure 1 and Figure 2 According to the transcriptome sequencing results of rubber grass, TkREF (Rubber Elongation Factor) was found to be among the most prominent genes expressed in latex, while its expression levels were extremely low in leaves, flowers, flower stalks, and roots. Therefore, preliminary screening predicted that the gene TkREF would be predominantly highly expressed in latex ducts.

[0045] 3. Promoter region screening and PCR amplification of promoter sequences

[0046] Based on the genome sequencing results, the promoter region of the TkREF gene was predicted by consulting literature or applying promoter prediction software. Ultimately, the 1980 bp upstream sequence of the TkREF gene was identified as the promoter sequence (pTkREF), and primers were designed. The primer sequences are as follows:

[0047] pTkREF-F:GTTTCCTAATGGGTTGCTCCTTG

[0048] pTkREF-R:AGTTCCAGAAACTACGTGAACGG

[0049] The pTkREF sequence was amplified by PCR and ligated into the blunt-ended vector pEASY-Blunt. (Sanger)

[0050] After confirming the sequencing results were correct, the promoter sequence was ligated into the pCAMBIA1303 expression vector using homologous recombination, with GUS as the reporter gene (pCAMBIA1303-pTkREF::GUS). The vector was digested with BamHI and NcoI (single underline), and the 15 bp upstream and downstream of the restriction endonuclease were used as homologous arms (double underlined). The primer sequences are as follows:

[0051] clonepTkREF-F: gagctcggtacccgg ggatccGTTTCCTAATGGGTTGCTCCTTG;clonepTkREF-R: aactagtcagatcta ccatggAGTTCCAGAAACTACGTGAACGG.

[0052] Genomic DNA was extracted from rubber grass leaves using a standard DNA extraction kit as a template (Full-Gen DNA). The pTkREF9 sequence was amplified by PCR using the Genomic DNA Kit (pTkREF-F and pTkREF-R) with primers pTkREF-F and pTkREF-R. The DNA polymerase reaction system is shown in Table 1 (Takara, [missing information]). GXL DNA Polymerase was used; the reaction program was: 98℃ pre-denaturation for 5 min, then 98℃ for 10 s, 60℃ for 15 s, 68℃ for 2 min 30 sec, for 35 cycles, and finally 68℃ for 5 min. PCR successfully obtained a 1980 bp promoter sequence. The pTkREF target band was purified and ligated into the pEASY-Blunt blunt-end vector. Preliminary restriction enzyme digestion with Nco I and EcoRI yielded sizes of 2951 bp and 2985 bp, respectively. After successful digestion, Sanger sequencing was performed to obtain the amplified sequence, which was compared with the pTkREF sequence on the genome. The results were consistent, yielding a 1980 bp promoter sequence. Figure 3 As shown, the correctly sequenced and constructed vector was named pEASY-pTkREF. The pEASY-pTkREF promoter cloning and vector construction results are as follows: Figure 4 As shown.

[0053] Table 1. PCR reaction system for pTkREF promoter cloning

[0054]

[0055] Example 2: Construction and genetic transformation of the plant expression vector for the latex duct-specific promoter pTkREF in rubber grass.

[0056] 1. Construction of pTkREF plant expression vector

[0057] The pCAMBIA1303 plant expression vector is available from the Miaoling plasmid platform. This vector uses a 35S promoter to generate a GUS reporter gene, and the plant selection marker is hygromycin (HPT). The plant expression vector was constructed using homologous recombination. First, the promoter sequence containing the vector's homologous arms and restriction enzyme sites was amplified using PCR. The plant expression vector pCAMBIA1303 was then digested with BamHI and NcoI. The promoter sequence and linearized vector were purified and recovered by gel extraction. The obtained sequence and vector were then processed using Novitan recombinase (Novitexin). The recombinant plasmid was ligated and transformed using the II One Step Cloning Kit to obtain the pCAMBIA1303-pTkREF::GUS plant expression vector. The recombinant plasmid was verified by PCR and double enzyme digestion; KpnI and HindIII enzymes were used to digest it, yielding bands of 13031 bp and 524 bp in size. Figure 5 The image shows a schematic diagram of the pCAMBIA1303-pTkREF::GUS expression vector. Figure 6 The image shows the construction results of the pCAMBIA1303-pTkREF::GUS expression vector.

[0058] 2. Genetic transformation of pCAMBIA1303-pTkREF::GUS expression vector

[0059] The pCAMBIA1303-pTkREF::GUS vector was transformed into Agrobacterium EHA105 using chemical transformation. Using rubber grass as the recipient, the pCAMBIA1303-pTkREF::GUS expression vector was transformed into rubber grass via Agrobacterium-mediated genetic transformation.

[0060] Hygromycin was used as a plant selection marker to screen for resistant buds. Four T0 generation pCAMBIA1303-pTkREF::GUS positive plants were obtained. Genomic DNA was extracted from the leaves of the transgenic plants for PCR molecular detection. Primers were selected from a segment of the pTkREF promoter sequence and a segment of the GUS gene sequence, respectively, and the amplified band size was 667 bp. The primer sequences are as follows: REF-227-F: GATTAAATGGGCGGGAAAAT; GUS-440-R: CAACGAACTGAACTGGCAGA. DNA polymerase was purchased from Kangwei 2×Taq, and the PCR reaction system is shown in Table 2. The reaction program was: 95℃ pre-denaturation for 10 min, then 95℃ for 30 sec, 56℃ for 30 sec, 72℃ for 30 sec, 35 cycles, and finally 72℃ for 10 min. The amplified band size was 667 bp. Figure 7 As shown, a total of 4 transgenic plants with positive DNA levels were obtained.

[0061] Table 2. PCR detection reaction system for transgenic positive plants

[0062]

[0063] Example 3: Functional verification of the rubber grass latex duct-specific promoter (pTkREF)

[0064] GUS histochemical staining was performed on pCAMBIA1303-pTkREF::GUS transgenic positive plants. The procedure was as follows: Wild-type rubber grass plants were used as negative controls, and 35S::GUS transgenic plants were used as positive controls. Leaves of healthy growth from wild-type plants, 35S::GUS transgenic plants, and transgenic positive plants were placed in GUS staining solution (50mM sodium phosphate buffer, 0.5mM K4[Fe(CN)6].3H2O, 0.5mM K3[Fe(CN)6], 0.1% Triton × 100, 10mM EDTA, 1mM X-Gluc, ddH2O to 100mL) and incubated at 37℃ for 3-5 hours. After incubation, the leaves were removed and placed in 75% ethanol for dehydration, with fresh 75% ethanol every 2 hours until the leaves were completely dehydrated. The results showed that pCAMBIA1303-TkREF::GUS transgenic positive plants only showed successful staining at the vein sites containing latex duct structures, while GUS activity was not detected in any leaf parts. Figure 8 As shown, all four transgenic positive plants successfully exhibited blue coloration at the latex duct location, indicating that the pTkREF-driven β-glucuronidase (GUS) reporter gene was specifically expressed in the latex ducts of rubber grass. However, under the 35S constitutive promoter-driven condition, the GUS gene was expressed in all rubber grass leaf cells, resulting in a blue coloration across the entire leaf, lacking latex duct specificity.

[0065] This invention first extracts RNA and performs transcriptome sequencing analysis on samples taken from different parts of rubber plant. Based on the sequencing results, the gene TkREF, which exhibits a significant predominance of expression in latex duct tissue, was screened, and its promoter region was predicted. Finally, the 1980 bp upstream sequence of the TkREF gene was identified as the promoter sequence pTkREF. Promoter primers were then designed based on this sequence, and using rubber plant genomic DNA as a template, the 1980 bp upstream sequence of TkREF was obtained via PCR. A reporter gene β-glucuronidase (GUS) was ligated downstream of the latex duct-specific promoter to construct an expression vector. This vector was then transformed into rubber plant using Agrobacterium-mediated genetic transformation to obtain transgenic positive plants. GUS tissue localization analysis of the obtained transgenic positive plants showed that pTkREF drives the GUS gene to specifically express only in rubber plant latex ducts. This indicates that the promoter in this invention can be used to initiate the specific expression of exogenous genes in rubber plant latex ducts and is applicable to most plants with latex duct structures. This invention successfully obtained the promoter pTkREF, which is specifically expressed in the latex ducts of rubber grass. This helps to reveal the molecular mechanism of latex duct structure development and latex production regulation pathway in rubber grass. It can be widely applied in plant genetic engineering research, enabling latex duct-specific expression genes to be efficiently expressed in latex ducts, thereby exploring gene functions, increasing latex content in rubber grass, and obtaining high-quality rubber grass plants.

[0066] Those skilled in the art will readily understand that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A rubber grass latex duct-specific expression promoter p TkREF Its characteristics are, The nucleotide sequence of the promoter is the DNA sequence shown in SEQ NO 1.

2. An expression box, characterized in that, The expression cassette includes the rubber grass latex-specific expression promoter p as described in claim 1. TkREF .

3. A recombinant expression vector, characterized in that, The recombinant expression vector contains the rubber grass latex-specific expression promoter p as described in claim 1. TkREF The rubber grass latex-specific expression promoter is linked upstream of the gene sequence to be expressed in the vector.

4. The recombinant expression vector as described in claim 3, wherein the gene to be expressed includes any one of structural genes, reporter genes, regulatory genes, natural small RNAs, or artificially synthesized small RNAs.

5. The recombinant expression vector as described in claim 3, wherein the recombinant vector is pCAMBIA1303-p TkREF :: GUS The gene to be expressed is GUS Gene.

6. A rubber grass latex-specific expression promoter p as described in claim 1 TkREF In the cultivation of transgenic rubber grass, the transgenic rubber grass is activated by a rubber grass latex duct-specific expression promoter to express exogenous genes.

7. The application according to claim 6, characterized in that, The applications include: Using rubber grass genomic DNA as a template, the rubber grass latex duct-specific expression promoter p as described in claim 1 was amplified. TkREF The target fragment was recovered and ligated into the pEASY-Blunt vector. Positive clones were verified by double enzyme digestion; the correctly verified clone was the desired promoter. The promoter fragment was ligated into the plant expression vector pCAMBIA1303 using homologous recombination. GUS Upstream of the reporter gene, the promoter and GUS The recombinant expression vector of the reporter gene fusion was transferred into Agrobacterium using chemical transformation; the recombinant expression vector was then transferred into rubber grass using Agrobacterium-mediated transformation.

8. The application according to claim 7, characterized in that: The promoter for latex-specific expression of rubber grass is also connected downstream of a regulatory element that regulates gene expression.

Images